CN112899396A

CN112899396A - Method and kit for rapidly detecting microorganisms and using method

Info

Publication number: CN112899396A
Application number: CN202011418845.4A
Authority: CN
Inventors: 陆利; 李玲萍; 黎梅莲; 方少荣; 杨健; 郭峰
Original assignee: Jiya Cell Technology Co ltd; Debiqi Biotechnology Xiamen Co ltd
Current assignee: Jiya Cell Technology Co ltd; Debiqi Biotechnology Xiamen Co ltd
Priority date: 2020-12-06
Filing date: 2020-12-06
Publication date: 2021-06-04

Abstract

The invention provides a method, a kit and a using method for rapidly detecting microorganisms, which skillfully and effectively combine a nucleic acid hands-free technology, a nucleic acid rapid enrichment technology, a lateral laminar flow technology or a fluorescence acquisition technology, greatly shorten the steps of extracting and purifying the nucleic acid of a sample, prolong the time of a conventional PCR amplification enrichment technology and the like, and realize the goal that a sample enters a detection system and the result is output within 30 min; the result display mode of the reaction product by using the lateral laminar flow technology greatly gets rid of the dependence on equipment, realizes the target of rapid detection without equipment, and uses the detection principle of multi-amplicon, multi-target and multi-region capture and the constant temperature amplification mode to realize the characteristics of efficient reversion, efficient enrichment and the like of the micro template; greatly improving the detection limit of the quick detection system.

Description

Method and kit for rapidly detecting microorganisms and using method

Technical Field

The invention relates to the field of microorganisms, in particular to a method for quickly detecting microorganisms, a kit and a using method.

Background

At present, the detection method of the microorganism mainly comprises the following steps: microorganism culture separation method, antibody antigen detection method, and nucleic acid molecule detection method. The traditional method has the characteristics of multiple operation steps, long detection process, long report period, high detection environment and equipment requirements and the like, and greatly restricts the requirement of specific epidemic outbreak on the detection capability of microorganisms.

Disclosure of Invention

Technical problem to be solved

Aiming at the defects of the prior art, the invention provides a method, a kit and a use method for rapidly detecting microorganisms.

(II) technical scheme

In order to achieve the purpose, the invention provides the following technical scheme: a method for rapid detection of microorganisms comprising the steps of:

step 1, collecting a sample, and allowing the sample to enter a nucleic acid rapid release module to release nucleic acid efficiently;

step 2, the released nucleic acid enters a nucleic acid rapid enrichment module to be rapidly amplified to form an amplified product;

step 3, amplifying the product, carrying out high-efficiency specific display on the result by using a quick color development module;

the rapid release module in the step 1 comprises a nucleic acid rapid release agent, a nucleic acid stabilizing agent and a rapid detection enhancer;

in the step 2, the rapid nucleic acid enrichment module is an isothermal amplification technology reaction system and/or a Cas gene editing technology reaction system;

and 3, the rapid color development module is a fluorescence rapid detection device or a lateral laminar flow technology reagent card.

The invention further provides a rapid detection reagent for pathogenic microorganism nucleic acid, which comprises a nucleic acid hand-free agent, a rapid detection reagent for nucleic acid and a rapid detection reagent card, wherein the nucleic acid hand-free agent comprises 500-1M Tris-HCl, 25-500 mM NaCl, 1-3M N, N' -diaminoguanidine hydrochloride, 0.5-3% of BL25(W/V), 0.2-10mM DTT, 0.5-10% of TritonX-100, 0.2-20 mM EDTA, 0.05-1% of lithium dodecyl sulfate and 0.5-2% of Tween-20;

the rapid nucleic acid detection reagent comprises an upstream primer, a downstream primer, an enrichment primer group and a probe group, wherein the upstream primer, the downstream primer, the enrichment primer group and the probe group are designed for designing specificity in a specific sequence region of pathogenic microorganisms to be detected, detection is carried out by a fluorescence collector or a lateral reagent card through an enrichment reaction system, the probe group is arranged in a specific upstream primer group, a specific downstream primer group and an enrichment region, and a capture object of the specific enrichment primer group is an RNA virus sample;

the rapid detection reagent card comprises a card box, a sample pad, a nitrocellulose membrane for embedding and detecting a modification group specific antibody and absorption paper.

As an improvement of the invention, the proportion relation between the probe number of the probe set and the specific sequence area of the pathogenic microorganism to be detected is 1-3;

the specific upstream primer group consists of a series of primers which are specifically complementary with the target region, the distance between every two primers is 8-50nt, and the length of each primer is 30-100 bp;

the specific downstream primer group consists of a series of primers which are specifically complementary with the target region, the distance between every two primers is 8-50nt, and the length of each primer is 25-80 bp; the 5 ' end of the specific downstream primer group needs to be modified by a chemical group, the 5 ' end, the 3 ' end and the middle position of the probe of the specific probe group need to be modified by the chemical group, the middle base modification position of the specific probe is 5-20 nt away from the 3 ' end of the probe, the distance between the specific probe and the 3 ' end of the downstream primer is 1-50 nt, and the size of the reaction enrichment product of the specific probe group and the downstream primer group is 80-2000 bp;

the specific enrichment primer group is positioned outside the downstream primer capture region, and the distance between the specific enrichment primer group and the outermost edge primer 5' end of the downstream primer group is not less than 50 bp; the number of the specific enrichment primer groups is 2-20 times of the specific sequence area of the microorganism to be detected.

As an improvement of the invention, the specific sequence area of pathogenic microorganism to be detected is 2-4, the specific upstream primer group consists of 3-5 primers which are specifically complementary with the target area, and the length of the primers is 45-60 bp; the specific downstream primer group consists of 3-5 primers which are specifically complementary with the target region, the 5' end of the specific downstream primer group needs to be modified by Biotin, and the length of the primers in the specific downstream primer group is 35-45 bp; the proportional relation between the probe number of the probe set and the specific sequence area of the pathogenic microorganism to be detected is 2;

FAM and FITC are modified at the 5 'end of a specific probe set probe, modification blocking modification is carried out at the 3' end, and the modified chemical groups comprise: c3 and C6, the intermediate base modifications including: AP site and THF modification;

the distance between the middle base modification position of the specific probe and the 3' end of the probe is 8-10 nt; the distance between the specific probe and the 3' end of the downstream primer is 20-30 nt; the size of a reaction enrichment product of the specific probe group and the downstream primer group is 80-200 bp, and the number of the specific enrichment primer groups is 4-8 times of that of a specific sequence region of the microorganism to be detected.

As an improvement of the invention, the enrichment reaction system comprises a high-efficiency enrichment enzyme mixed solution and a high-efficiency enrichment reaction solution, the high-efficiency enrichment enzyme mixed solution comprises one or more of reverse transcriptase, recombinase, single-chain binding protein, chain displacement enzyme, AP site recognition enzyme and Cas series enzyme, and the reverse transcriptase comprises AMV and MMLV.

As an improvement of the invention, the high-efficiency enriched enzyme mixed solution comprises reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme, AP site recognition enzyme or reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme and Cas series enzyme, wherein the reverse transcriptase is 400 UMMLV.

As an improvement of the invention, the recombinase comprises one or more of 0.05-0.2 mu M uvsX, 1-4 uM uvsY and 0.2-10U MrecA; the single-chain binding protein comprises Ecoil SSB, T4gp 32; the AP site recognition enzyme comprises Ecoil Endonuclease IV, fpg; the Cas series of enzymes are Cas12 system enzymes.

As an improvement of the invention, the high-efficiency enrichment reaction solution comprises 1-200 mM Tris Acetate pH 8.3, 10-1M KOAc, 5mM DTT, 0.1-5% creatine kinase, 1-30% PEG-3000, 0.5-10% trehalose, 5-100 mM Phosphocreatine, 1-4 mM ATP, 1.8-4 mM dNTPs and 0.1-2% Brij-35.

The invention further provides a use method of the microbial nucleotide kit, which comprises the following steps:

step 1, collecting a sample, adding the sample into a one-step method sample reactor, dropping the sample from top to bottom to mix uniformly, and standing for 5-10 min to obtain a nucleic acid hand-free agent product;

step 2, dripping the nucleic acid hand-free agent product into a rapid detection reaction card through an extrusion one-step method sample reactor tube body, and incubating the reaction mixture for 1-60 min at 25-60 ℃; the detection reaction product penetrates the bottom of the nucleic acid rapid reactor through a button control rod of the tube cover of the nucleic acid rapid reactor and enters a sample inlet of a nucleic acid rapid detection card; the detection reaction product releases a pre-loaded reaction buffer solution into the sample pad through the nucleic acid rapid reactor; and (3) standing the nucleic acid rapid detection card for 2-5 min, reacting, and observing whether a window strip exists or not after the reaction is finished so as to judge the detection result.

As an improvement of the invention, the one-step sample reaction tube consists of a tube body which can be molded and a tube cover containing a one-way switch, the one-step sample reaction tube comprises 0.1-3 ml of nucleic acid hands-free agent, and a nucleic acid rapid detection reagent of the rapid detection reaction card is arranged in a nucleic acid rapid reactor in advance, and the nucleic acid rapid reactor is a closed adjustable switch or an adjustable heating constant temperature reactor.

(III) advantageous effects

Compared with the prior art, the invention provides a method, a kit and a use method for rapidly detecting microorganisms, and the method, the kit and the use method have the following beneficial effects:

1. the invention skillfully and effectively combines a nucleic acid hands-free technology, a nucleic acid rapid enrichment technology, a lateral laminar flow technology or a fluorescence acquisition technology, greatly shortens the steps of extracting and purifying the nucleic acid of the sample, has the characteristics of long time of the conventional PCR amplification enrichment technology and the like, and realizes the goal that the sample enters a detection system and the result is output within 30 min;

2. the invention uses the lateral laminar flow technology to greatly get rid of the dependence on equipment in a result display mode of reaction products, and realizes the aim of rapid detection without equipment;

3. the rapid nucleic acid enrichment technology of the invention skillfully uses the multi-amplicon, multi-target and multi-region capture detection principle and the constant-temperature amplification mode to realize the characteristics of efficient reversion, efficient enrichment and the like of a micro-template; greatly improving the detection limit of the quick detection system.

Drawings

FIG. 1 is a diagram of an RNA template of the present invention;

FIG. 2 is a schematic diagram of the rapid test platform of the present invention;

FIG. 3 is a flow chart of the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Referring to FIGS. 1-3, the present invention provides a method for rapid detection of nucleic acid based on molecular level, which comprises three modules; firstly, a sample nucleic acid quick release module; secondly, the following steps: a nucleic acid rapid enrichment amplification module; thirdly, the method comprises the following steps: a fast detection module; the method comprises the following steps: collecting a sample, and allowing the sample to enter a nucleic acid quick release module to release nucleic acid efficiently; the nucleic acid released efficiently enters a nucleic acid rapid enrichment module for rapid amplification; and (3) carrying out high-efficiency specific display on the result of the rapid enrichment amplification product by using a rapid color development module.

Further, the sample nucleic acid quick release module comprises a nucleic acid quick release agent, a nucleic acid stabilizing agent, a quick detection reinforcing agent and the like;

further, the nucleic acid rapid enrichment amplification module comprises an isothermal amplification technology reaction system, a Cas gene editing technology reaction system, an isothermal amplification technology and Cas gene editing technology coupling system; preferably isothermal amplification technology reaction systems.

Furthermore, the rapid detection module comprises a fluorescence rapid detection device, a lateral laminar flow technology reagent card and the like; preferably lateral laminar flow technology reagent cards.

The invention also provides a rapid detection reagent for pathogenic microorganism nucleic acid, which comprises: nucleic acid hands-free agent, nucleic acid rapid detection reagent, rapid detection reagent card, etc.;

further, the nucleic acid hand-free agent comprises 500-1000 mM Tris-HCl, 25-500 mM NaCl, 1-3M N, N' -diaminoguanidine hydrochloride, 0.5-3% of BL25(W/V), 0.2-10mM DTT, 0.5-10% TritonX-100(V/V), 0.2-20 mM EDTA, 0.05-1% of lithium dodecyl sulfate (W/V) and 0.5-2% Tween-20 (V/V);

further, the rapid nucleic acid detection reagent comprises a specific primer group and a probe group designed for a specific template of the pathogenic microorganism to be detected, and detection is carried out by a fluorescence acquisition instrument or a lateral reagent card through an enrichment reaction system;

further, the specific primer group comprises an upstream primer, a downstream primer and an enrichment primer group aiming at the region to be detected;

further, the area to be detected is a specific sequence area of pathogenic microorganisms to be detected;

further, the area to be detected comprises a plurality of specific areas of pathogenic microorganisms to be detected, preferably 2-4 specific areas;

further, the specific upstream primer set consists of a series of primers specifically complementary to the target region; are respectively named as F1.

Further, the specific upstream primer group has a separation distance of 8-50nt between the primers F1 and F2 or F2 and F3 or Fi and Fi +1,

further, the length of the primer in the specific upstream primer group is 30-100 bp, and the preferable length of the primer is 45-60 bp;

further, the specific downstream primer set consists of a series of primers specifically complementary to the target region; rn, preferably 3-5, respectively;

further, the 5' end of the specific downstream primer group needs to be modified by a chemical group;

further, the 5' end chemical group modification comprises: biotin, Biotin-TEG, preferably Biotin;

further, the specific downstream primer group has a separation distance of 8-50nt between the primers R1 and R2 or R2 and R3 or Ri and Ri +1,

further, the length of the primer in the specific downstream primer group is 25-80 bp, preferably 35-45 bp;

further, the specific probe set is arranged in the enrichment region of the specific upstream and downstream primer sets;

further, the proportion relation between the number of probes of the specific probe set and the specific sequence area of the pathogenic microorganism to be detected is 1-3; preferably 2;

furthermore, the 5 'end, the 3' end and the middle position of the specific probe set probe are required to be modified by chemical groups;

further, the modification chemical groups of the probes in the specific probe set comprise: FAM, FITC and the like are modified at the 5' end; the 3' end is modified by blocking modification, and the modified chemical groups comprise: c3, C6, etc.; intermediate base modifications include: AP site THF modification, etc.;

furthermore, the distance between the middle base modification position of the specific probe and the 3' end of the probe is 5-20 nt, preferably 8-10 nt;

further, the distance between the specific probe and the 3' end of the downstream primer is 1-50 nt, preferably 20-30 nt;

further, the size of the reaction enrichment product of the specific probe group and the downstream primer group is 80-2000 bp; preferably 80-200 bp;

further, the target captured by the pathogenic microorganism specific enrichment primer set is an RNA virus sample;

further, the specificity enrichment primer group consists of a series of primers complementary to the target to-be-detected microorganism RNA template;

furthermore, the specific enrichment primer group is positioned outside the downstream primer capture region, and the distance between the specific primer group and the outermost edge primer 5' end of the downstream primer group is not less than 50 bp;

further, the number of the specific enrichment primer groups is 2-20 times, preferably 4-8 times that of the specific sequence region of the microorganism to be detected;

further, the enrichment reaction system comprises a high-efficiency enrichment enzyme mixed solution and a high-efficiency enrichment reaction solution;

further, the highly efficient enzyme-enriched mixed liquor comprises one or more of reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme, AP site recognition enzyme and Cas series enzyme, preferably reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme, AP site recognition enzyme or reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme and Cas series enzyme;

further, the reverse transcriptase includes AMV, MMLV; preferably 400U MMLV;

further, the recombinase comprises one or more of 0.05-0.2 mu M uvsX, 1-4 mu M uvsY and 0.2-10U MrecA; preferably: 0.2. mu.M uvsX, 1.8. mu.M uvsY;

further, the single-chain binding proteins include Ecoil SSB, T4gp 32; preferably 31-50 uM T4gp 32;

further, the strand displacement enzymes include phi29, Bst2.0, Bst3.0, Sau DNA Polymerase (Large Fragment), T7DNA Polymerase, etc.; preferably 1-20U of Sau DNA Polymerase (Large Fragment);

further, AP site recognition enzymes include Ecoil Endonuclease IV, fpg, etc.;

further, the Cas series enzyme is a Cas12 system enzyme, preferably Cas12 a;

further, the high-efficiency enrichment reaction solution comprises 1-200 mM Tris Acetate pH 8.3, 10-1M KOAc, 5mM DTT, 0.1-5% flaw kinase (w/v), 1-30% PEG-3000, 0.5-10% trehalose, 5-100 mM phosphor flaw, 1-4 mM ATP, 1.8-4 mM dNTPs and 0.1-2% Brij-35 (v/v);

further, the rapid detection reagent card comprises a card box, a sample pad, a nitrocellulose membrane for embedding and detecting the modification group specific antibody and absorption paper;

further, the antibodies for embedding and detecting the specificity of the modification groups comprise a Biotin antibody and a FITC antibody;

the invention also provides a rapid detection kit for detecting the microbial nucleic acid. The method comprises a one-step method sample reactor and a rapid detection reaction card; the one-step method sample reactor consists of the nucleic acid hand-free agent and a one-step type sample reaction tube; the rapid detection reaction card consists of the nucleic acid rapid detection reagent, the nucleic acid rapid detection card and the nucleic acid rapid reactor;

furthermore, the one-step type sample reaction tube consists of a tube body which can be molded and a tube cover containing a one-way switch;

further, the one-step sample reaction tube comprises 0.1-3 ml of nucleic acid hands-free agent;

further, the nucleic acid rapid detection reagent of the rapid detection reaction card comprises a nucleic acid rapid reaction vessel which is pre-filled with nucleic acid;

further, the nucleic acid rapid reactor is a closed type adjustable switch and adjustable heating constant-temperature reactor;

further, the rapid detection card is a detection card which can be loaded with a nucleic acid rapid reactor and can be closed;

the invention also provides a use method of the microbial nucleic acid detection kit; collecting a sample, adding the sample into a one-step method sample reactor, dropping the sample from top to bottom to be uniformly mixed, and standing for 5-10 min to obtain a nucleic acid hand-free agent product; dripping the nucleic acid hand-free agent product into a rapid detection reaction card through a tube body of a sample reactor in an extrusion one-step method, and incubating the reaction mixture for 1-60 min at 25-60 ℃; the detection reaction product penetrates the bottom of the nucleic acid rapid reactor through a button control rod of the tube cover of the nucleic acid rapid reactor and enters a sample inlet of a nucleic acid rapid detection card; the detection reaction product releases a pre-loaded reaction buffer solution into the sample pad through the nucleic acid rapid reactor; and (3) standing the nucleic acid rapid detection card for 2-5 min, reacting, and observing whether a window strip exists or not after the reaction is finished so as to judge the detection result.

Further, the sample types include pharyngeal swabs, whole blood, nasal swabs, saliva, and the like;

further, the ratio of the nucleic acid hands-free agent to the sample amount is 1-100;

furthermore, the amount of the added quick detection reaction card is 1-4 drops, and the volume is 10-100 ul.

Example 1

Preparation of novel coronavirus nucleic acid rapid detection reagent

1.1 designing a primer probe;

SARS-CoV-2 N gene CDS sequence

ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAA(SEQ ID NO：1)

enrichment primer set

N-RT-oligo 1:GAGACAGTATGCTTTAGTGGCAG(SEQ ID NO：2)

N-RT-oligo 2:GAGACAGGCCGAGGCTTCTTAGAAG(SEQ ID NO：3)

N-RT-oligo 3:GAGACAGGACAGTTTGGCCTTG(SEQ ID NO：4)

N-RT-oligo 4:GAGACAGTGGCCTTTACCAGAC(SEQ ID NO：5)

Rapid enrichment upstream primer group

N-RPA-F1:TGGGCCAGAAGCTGGACTTCCCTATGG(SEQ ID NO：6)

N-RPA-F2:CTTCCCTATGGTGCTAACAAAGACGGCATCATA(SEQ ID NO：7)

N-RPA-F3:CAACTGAGGGAGCCTTGAATACACCAAAAGATCACATT(SEQ ID NO：8)

N-RPA-F4:CACATTGGCACCCGCAATCCTGCTAACAATGCTG(SEQ ID NO：9)

Rapid enrichment downstream primer group

N-RPA-R1:5‘-Biotin-GCTCTCAAGCTGGTTCAATCTGTCAAGCAG-3’(SEQ ID NO：10)

N-RPA-R2:5’-Biotin-GTCAAGCAGCAGCAAAGCAAGAGCAGCA-3‘(SEQ ID NO：11)

N-RPA-R3:5‘-Biotin-GAGCAGCATCACCGCCATTGCCAGCCATTC-3’(SEQ ID NO：12)

N-RPA-R4:5’-Biotin-GCTGCCTGGAGTTGAATTTCTTGAACTGTTGCG-3‘(SEQ ID NO：13)

N-RPA-R5:5‘-Biotin-CTGTTGCGACTACGTGATGAGGAACGAGAAG-3’(SEQ ID NO：14)

Probe needle

N-RPA-nfo-Probe:

5’FAM-CAATCGTGCTACAACTTCCTCAAGGAACAACA-THF-TTGCCAAAAGGCTTCTAC-C3-3’(SEQ ID NO：15)

Positive quality control product template

PC-F:

5‘-FAM-CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA

ACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGA-3‘(SEQ ID NO：16)

PC-R:

5-Biotin-TCTGCTCCCTTCTGCGTAGAAGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTT GTAGCAC GATTGCAGCATTGTTAGCAGGATTGCGGGTGCCAATGTG-3’(SEQ ID NO：17)

1.2 kit configuration

The kit comprises SARS-CoV2 detection reagent, one-step method sample reactor, and detection reagent card; the formulations were prepared essentially as follows:

preparation and packaging of one-step nucleic acid hand-free agent

Subpackaging the prepared one-step nucleic acid hand-free agent into corresponding reactors according to 0.5ml per tube; preparing a primer MIX for rapid detection reagent:

adding corresponding reagents according to the above, shaking, mixing uniformly, and performing instantaneous centrifugation.

Preparing enzyme Mix:

RPA reaction solution

The reaction solution was prepared as follows:

name of the component	1X	100X
			Primer MIX	5	500
Enzyme MIX	2	200
			RPA reaction solution	28	2800

Adding the components in the table into a centrifuge tube, shaking, mixing uniformly, and performing instantaneous centrifugation. And subpackaging the reaction liquid and a nucleic acid rapid detection reactor, and freeze-drying the reaction liquid into dry powder in a freeze dryer for storage.

1.3 preparation of Rapid test reagent card

The components according to the reagent card are as follows

Nucleic acid rapid detection reagent card assembled according to in-table components

1.4 preparation of Rapid test reagent card

Assembling the components according to the following table, and storing the assembled rapid detection reagent card at 2-8 ℃ in the dark

Assembly	Number of
		Reactor of pre-packaged freeze-drying rapid detection reagent	1
Reagent card for quickly detecting nucleic acid	1
		Packaging bag (WU JI KE LI)	1

1.5 preparation of quality control Material

Preparation of positive quality control product

Name (R)	Dosage (mu l)
		PC-F(100μM)	2
PC-R(100μM)	2
		5Xanneling buffer	4
10mM Tris-HCl	12

Preparing a positive quality control material reaction system according to the table, placing the positive quality control material reaction system in a thermal cycler, and performing gradient cooling annealing to obtain a reaction product which can be used as a positive quality control material.

Preparation of negative quality control product

Taking human leukocyte genome DNA without target region as negative quality control product

1.6 reaction procedure results judgment

The sample detection treatment is carried out according to the detection flow shown in the following FIG. 3, and the sample is placed in a reaction device and incubated at 42 ℃ for 20min.

And (5) judging a result:

1. a new coronavirus sample (E5 concentration) has a strip on the C line and a strip on the T line, and the detection result is positive;

2. the C line of the negative quality control product (E6 concentration) has a strip, the T line has no strip, and the detection result is negative;

3. and if no band appears on the NTC (non-RPA product) line C and a band appears or does not appear on the T line, the detection result is judged to be invalid.

The detection result of the kit is as follows: and (3) detecting a positive quality control product, a negative quality control product and a novel coronavirus pseudovirus sample according to the above process, and passing the quality detection of the kit based on the detection result to be used for next performance evaluation and related detection evaluation.

Example 2

Application of RPA-LF technology in novel coronavirus rapid detection based on cas system

Primer design

SARS-CoV-2 N gene CDS sequence

Enrichment primer set

N-RT-oligo 1:GAGACAGTATGCTTTAGTGGCAG(SEQ ID NO：2)

N-RT-oligo 2:GAGACAGGCCGAGGCTTCTTAGAAG(SEQ ID NO：3)

N-RT-oligo 3:GAGACAGGACAGTTTGGCCTTG(SEQ ID NO：4)

N-RT-oligo 4:GAGACAGTGGCCTTTACCAGAC(SEQ ID NO：5)

Rapid enrichment upstream primer group

N-RPA-F1:TGGGCCAGAAGCTGGACTTCCCTATGG(SEQ ID NO：6)

N-RPA-F2:CTTCCCTATGGTGCTAACAAAGACGGCATCATA(SEQ ID NO：7)

N-RPA-F3:CAACTGAGGGAGCCTTGAATACACCAAAAGATCACATT(SEQ ID NO：8)

N-RPA-F4:CACATTGGCACCCGCAATCCTGCTAACAATGCTG(SEQ ID NO：9)

Rapid enrichment downstream primer group

N-RPA-R1:5’-GCTCTCAAGCTGGTTCAATCTGTCAAGCAG-3’(SEQ ID NO：10)

N-RPA-R2:5’-GTCAAGCAGCAGCAAAGCAAGAGCAGCA-3’(SEQ ID NO：11)

N-RPA-R3:5’-GAGCAGCATCACCGCCATTGCCAGCCATTC-3’(SEQ ID NO：12)

N-RPA-R4:5’-GCTGCCTGGAGTTGAATTTCTTGAACTGTTGCG-3’(SEQ ID NO：13)

N-RPA-R5:5’-CTGTTGCGACTACGTGATGAGGAACGAGAAG-3’(SEQ ID NO：14)

IVT-crRNA-Cas12a_N:

AACTGATTACAAACATTGGCCGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC(SEQ ID NO：18)

T7 primer:GAAATTAATACGACTCACTATAGGG(SEQ ID NO：19)

N-RPA-Cas-Probe:5’-FAM-TTATTATT-Biotin-3’(SEQ ID NO：20)

1.2 kit configuration

The kit comprises SARS-CoV2 detection reagent, one-step method sample reactor, and detection reagent card; the formulations were prepared essentially as follows: the preparation and packaging of the one-step nucleic acid hand-free agent are the same as those in example 1.

Preparation of rapid detection reagent

gRNA in vitro synthesis

Annealing: IVT-crRNA-Cas12a _ N anneals to T7primer an annealing reaction was formulated as follows:

name of reagent	Dosage of
		IVT-crRNA-Cas12a_N(100μM)	2
T7 primer(100μM)	2
		5xanneling buffer	4
10mM Tris-HCl(pH 7.5)	12

Gradient annealing was performed according to the following procedure:

95℃5min；

75℃2min；

70℃2min；

...

25℃2min

the annealing product was named Pre-crRNA Mix;

in vitro synthesis of gRNA;

using the NEB HiScribe T7 high-performance RNA synthesis kit (NEB Co., cat.2050s), the following table was prepared according to the instructions:

name of reagent	Dosage of
		Pre-crRNA Mix	2
T7 RNA polymerase	2
		NTP	2
10x T7 Reaction Buffer	3
		10mM Tris-HCl(pH 7.5)	21

Carrying out vortex oscillation and uniform mixing and instantaneous centrifugation on the reaction tube, placing the reaction tube in a thermal cycler, incubating the reaction tube for 4 hours at 37 ℃, and closing a thermal cover; after the reaction is finished, preserving at-20 ℃ for later use;

and (3) purification:

using RNA Clean&Concentrator^TMThe reaction product was purified using-5 kit (ZYMO RESEARCH, cat. r1013) and the reaction tubes were purified according to the following procedure as described in the specification.

DNA template digestion:

a DNA template digestion reaction system was prepared according to the following table:

name of reagent	Dosage (mu l)
		DNase I(40U)	5
DNA Digestion buffer	5
		Pre-gRNA Mix	30
NF-H2O	10

Shaking the reaction tube, mixing, centrifuging instantly, standing at room temperature for 15min,

purifying;

1. adding RNA Binding Buffer (100 mu.l) with corresponding volume according to the ratio of the sample volume to the RNA Binding Buffer 1: 2;

2. adding 150 μ l ethanol (95-100%) and shaking for mixing;

3. transferring the reaction solution to an adsorption column, centrifuging, and discarding waste liquid;

4. adding 400 mul RNA Prep Buffer, centrifuging and discarding waste liquid into an adsorption column;

5. adding 700 mul of RNA Wash Buffer into the adsorption column, centrifuging and discarding waste liquid;

6. mu.l of RNA Wash Buffer (12000 rpm) was added to the adsorption column and centrifuged at room temperature for 1min to remove the Wash Buffer. Carefully transferring the adsorption column to a new nuclease-free centrifuge tube;

7. suspending and adding 15 mul DNase/RNase-Free Water into the center of the adsorption tube; standing at room temperature for 5min, performing instantaneous centrifugation, and collecting the synthesized N-gRNA by a centrifugal tube;

preparing a primer MIX:

Preparing enzyme Mix:

name (R)	Dosage of
		MMLV	200U
Gp32	28μg
		UvsX	30μg
UvsY	7μg
		DNA polymerase I(S.aureus	12.8μg
Cas12a	3μM

RPA reaction solution

The reaction solution was prepared as follows:

1.3 preparation of Rapid test reagent card

The components according to the reagent card are as follows

1.4 preparation of Rapid test reagent card

1.5 reaction procedure results judgment

And (5) judging a result:

Example 3

Application of RPA-fluorometer technology in novel coronavirus rapid detection based on nfo system

Designing a primer:

detecting the object template: novel coronavirus N gene template

SARS-CoV-2 N gene CDS sequence

Enrichment primer set

N-RT-oligo 1:GAGACAGTATGCTTTAGTGGCAG(SEQ ID NO：2)

N-RT-oligo 2:GAGACAGGCCGAGGCTTCTTAGAAG(SEQ ID NO：3)

N-RT-oligo 3:GAGACAGGACAGTTTGGCCTTG(SEQ ID NO：4)

N-RT-oligo 4:GAGACAGTGGCCTTTACCAGAC(SEQ ID NO：5)

Rapid enrichment upstream primer group

N-RPA-F1:TGGGCCAGAAGCTGGACTTCCCTATGG(SEQ ID NO：6)

N-RPA-F2:CTTCCCTATGGTGCTAACAAAGACGGCATCATA(SEQ ID NO：7)

N-RPA-F3:CAACTGAGGGAGCCTTGAATACACCAAAAGATCACATT(SEQ ID NO：8)

N-RPA-F4:CACATTGGCACCCGCAATCCTGCTAACAATGCTG(SEQ ID NO：9)

Rapid enrichment downstream primer group

N-RPA-R1:5’GCTCTCAAGCTGGTTCAATCTGTCAAGCAG(SEQ ID NO：10)

N-RPA-R2:5’GTCAAGCAGCAGCAAAGCAAGAGCAGCA(SEQ ID NO：11)

N-RPA-R3:5’GAGCAGCATCACCGCCATTGCCAGCCATTC(SEQ ID NO：12)

N-RPA-R4:5’GCTGCCTGGAGTTGAATTTCTTGAACTGTTGCG(SEQ ID NO：13)

N-RPA-R5:5’CTGTTGCGACTACGTGATGAGGAACGAGAAG(SEQ ID NO：14)

Probe needle

N-RPA-nfo-Probe:

5’-CAATCGTGCTACAACTTCCTCAAGGAACAAC(FAM)A-THF-T(BHQ1)TGCCAAAAG GCTTCTAC-C3-3’(SEQ ID NO：15)

ACTB gene sequences

TGGGGTGTCCCCCATCTCCGGAGGCCCAGGGGCTTCTCCCGCGCCCCCCACGGCGGTCCGGTTCCCCCCCCATGCGCCCCCCGCTGCGGCCCAGACGGCGGCTCTGCACGGGCGAAGGGGCCGCGGCCGCCTGCGGCCGGGCCGTGAGCCGCCTGCCCCGGTCGGCTGGCCGGGCTTACCTGGCGGCGGGTGTGGACGGGCGGCGGATCGGCAAAGGCGAGGCTCTGTGCTCGCGGGGCGGACGCGGTCTCGGCGGTGGTGGCGCGTCGCGCCGCTGGGTTTTATAGGGCGCCGCCGCGGCCGCTCGAGCCATAAAAGGCAACTTTCGGAACGGCGCACGCTGATTGGCCCCGCGCCGCTCACTCACCGGCTTCGCCGCACAGTGCAGCATTTTTTTACCCCCTCTCCCCTCCTTTTGCGAAAAAAAAAAAGAGCGAGAGCGAGATTGAGGAAGAGGAGGAGGGAGAGTTTTGGCGTTGGCCGCCTTGGGGTGCTGGGCCCGGGGGCTGGGGGCGCGCGCCGTGGCCCCCGCGCCCC(SEQ ID NO：21)

IC-F:CGGGTGTGGACGGGCGGCGGATCGGCAAAG(SEQ ID NO：22)

IC-R:GGCCAATCAGCGTGCGCCGTTCCGAAAGTTGC(SEQ ID NO：23)IC-Probe:GACGCGGTCTCGGCGGTGGTGGCGC(HEX)G-THF-T(BHQ1)CGCGCCGCT(SEQ ID NO：24)

Positive quality control product template

PC-F:

CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA(SEQ ID NO：25)

ACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGA(SEQ ID NO：26)

PC-R:

TCTGCTCCCTTCTGCGTAGAAGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTGTAGCACGATTGCAGCATTGTTAGCAGGATTGCGGGTGCCAATGTG(SEQ ID NO：17)

1.2 preparation of reagents

Reagent preparation procedure the preparation was carried out according to example 1.

1.3 sample detection

Samples at the level of E5, E4 and E3 were obtained by taking the pseudovirus E10 which had been calibrated and carrying out a gradient dilution according to the following table.

Sample concentration level	Sample of the previous level concentration	PBS
			E9	5μl E10	45μl
E8	5μl E9	45μl
			E7	5μl E8	45μl
E6	5μl E7	45μl
			E5	5μl E6	45μl
E4	5μl E5	45μl
			E3	5μl E4	45μl

And adding the sample, the human gDNA and the PBS into a one-step method sample treatment reactor, quickly detecting a reagent card for reaction, collecting a fluorescence signal in a detection result by an end-point fluorescence method, comparing the collected fluorescence signal with a background signal, and judging a positive result and a negative result.

3.3 results of detection

Respectively counting the fluorescence intensity of the fluorescence signal and the background signal, detecting the signal-background signal/background signal according to the sample, and obtaining the following statistical results:

TABLE 1 detection results of end-point fluorescence method under nfo system

The nfo-PA-LF technology is used for testing the detection limit of the novel coronavirus rapid detection reagent.

4.1 sample preparation

The calibrated pseudovirus 1.0E10 was taken and subjected to gradient dilution according to the following table to obtain samples with different concentration gradient levels.

4.2 sample detection

Preparing a related detection reagent according to the step of the embodiment 1, and repeatedly detecting the sample 3 to obtain an estimated detection limit; and then 4 concentration gradient horizontal detections are carried out near the estimated detection limit. Repeating the detection for 20 times, and counting the concentration which can be detected by more than 95-100% to obtain the lowest detection limit.

4.3 results of detection

4.3.1 estimated detection limit results are shown in the following Table

Concentration gradient	Results
		E9	+
E8	+
		E7	+
E6	+
		E5	+
E4	+
		E3	+
E2	+
		50	-
40	-
		30	-
20	-
		10	-

4.3.2 minimum detection determination

4.3.3 conclusion

Combining the results, the lowest detection limit of the kit is 80copies/ml, and the estimated detection limit is 100 copies/ml.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> Debi Acer Biotech (Xiamen) Co.Ltd

Kiya cell science and technology Ltd

<120> method, kit and use method for rapidly detecting microorganisms

<141> 2020-09-23

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1260

<212> DNA

<213> Artificial sequence ()

<400> 1

atgtctgata atggacccca aaatcagcga aatgcacccc gcattacgtt tggtggaccc 60

tcagattcaa ctggcagtaa ccagaatgga gaacgcagtg gggcgcgatc aaaacaacgt 120

cggccccaag gtttacccaa taatactgcg tcttggttca ccgctctcac tcaacatggc 180

aaggaagacc ttaaattccc tcgaggacaa ggcgttccaa ttaacaccaa tagcagtcca 240

gatgaccaaa ttggctacta ccgaagagct accagacgaa ttcgtggtgg tgacggtaaa 300

atgaaagatc tcagtccaag atggtatttc tactacctag gaactgggcc agaagctgga 360

cttccctatg gtgctaacaa agacggcatc atatgggttg caactgaggg agccttgaat 420

acaccaaaag atcacattgg cacccgcaat cctgctaaca atgctgcaat cgtgctacaa 480

cttcctcaag gaacaacatt gccaaaaggc ttctacgcag aagggagcag aggcggcagt 540

caagcctctt ctcgttcctc atcacgtagt cgcaacagtt caagaaattc aactccaggc 600

agcagtaggg gaacttctcc tgctagaatg gctggcaatg gcggtgatgc tgctcttgct 660

ttgctgctgc ttgacagatt gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa 720

caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780

aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840

caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900

tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960

ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020

gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080

aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140

gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200

gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 2

gagacagtat gctttagtgg cag 23

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 3

gagacaggcc gaggcttctt agaag 25

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 4

gagacaggac agtttggcct tg 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 5

gagacagtgg cctttaccag ac 22

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence ()

<400> 6

tgggccagaa gctggacttc cctatgg 27

<210> 7

<211> 33

<212> DNA

<213> Artificial sequence ()

<400> 7

cttccctatg gtgctaacaa agacggcatc ata 33

<210> 8

<211> 38

<212> DNA

<213> Artificial sequence ()

<400> 8

caactgaggg agccttgaat acaccaaaag atcacatt 38

<210> 9

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 9

cacattggca cccgcaatcc tgctaacaat gctg 34

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 10

gctctcaagc tggttcaatc tgtcaagcag 30

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 11

gtcaagcagc agcaaagcaa gagcagca 28

<210> 12

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 12

gagcagcatc accgccattg ccagccattc 30

<210> 13

<211> 33

<212> DNA

<213> Artificial sequence ()

<400> 13

gctgcctgga gttgaatttc ttgaactgtt gcg 33

<210> 14

<211> 31

<212> DNA

<213> Artificial sequence ()

<400> 14

ctgttgcgac tacgtgatga ggaacgagaa g 31

<210> 15

<211> 50

<212> DNA

<213> Artificial sequence ()

<400> 15

caatcgtgct acaacttcct caaggaacaa cattgccaaa aggcttctac 50

<210> 16

<211> 99

<212> DNA

<213> Artificial sequence ()

<400> 16

cacattggca cccgcaatcc tgctaacaat gctgcaatcg tgctacaact tcctcaagga 60

acaacattgc caaaaggctt ctacgcagaa gggagcaga 99

<210> 17

<211> 99

<212> DNA

<213> Artificial sequence ()

<400> 17

tctgctccct tctgcgtaga agccttttgg caatgttgtt ccttgaggaa gttgtagcac 60

gattgcagca ttgttagcag gattgcgggt gccaatgtg 99

<210> 18

<211> 66

<212> DNA

<213> Artificial sequence ()

<400> 18

aactgattac aaacattggc cgatctacaa cagtagaaat tccctatagt gagtcgtatt 60

aatttc 66

<210> 19

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 19

gaaattaata cgactcacta taggg 25

<210> 20

<211> 8

<212> DNA

<213> Artificial sequence ()

<400> 20

ttattatt 8

<210> 21

<211> 537

<212> DNA

<213> Artificial sequence ()

<400> 21

tggggtgtcc cccatctccg gaggcccagg ggcttctccc gcgcccccca cggcggtccg 60

gttccccccc catgcgcccc ccgctgcggc ccagacggcg gctctgcacg ggcgaagggg 120

ccgcggccgc ctgcggccgg gccgtgagcc gcctgccccg gtcggctggc cgggcttacc 180

tggcggcggg tgtggacggg cggcggatcg gcaaaggcga ggctctgtgc tcgcggggcg 240

gacgcggtct cggcggtggt ggcgcgtcgc gccgctgggt tttatagggc gccgccgcgg 300

ccgctcgagc cataaaaggc aactttcgga acggcgcacg ctgattggcc ccgcgccgct 360

cactcaccgg cttcgccgca cagtgcagca tttttttacc ccctctcccc tccttttgcg 420

aaaaaaaaaa agagcgagag cgagattgag gaagaggagg agggagagtt ttggcgttgg 480

ccgccttggg gtgctgggcc cgggggctgg gggcgcgcgc cgtggccccc gcgcccc 537

<210> 22

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 22

cgggtgtgga cgggcggcgg atcggcaaag 30

<210> 23

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 23

ggccaatcag cgtgcgccgt tccgaaagtt gc 32

<210> 24

<211> 36

<212> DNA

<213> Artificial sequence ()

<400> 24

gacgcggtct cggcggtggt ggcgcgtcgc gccgct 36

<210> 25

<211> 47

<212> DNA

<213> Artificial sequence ()

<400> 25

cacattggca cccgcaatcc tgctaacaat gctgcaatcg tgctaca 47

<210> 26

<211> 52

<212> DNA

<213> Artificial sequence ()

<400> 26

acttcctcaa ggaacaacat tgccaaaagg cttctacgca gaagggagca ga 52

Claims

1. A method for rapid detection of microorganisms comprising the steps of:

2. A reagent for rapidly detecting pathogenic microorganism nucleic acid is characterized by comprising a nucleic acid hand-free agent, a nucleic acid rapid detection reagent and a rapid detection reagent card, wherein the nucleic acid hand-free agent comprises 500-1000 mM Tris-HCl, 25-500 mM NaCl, 1-3M N, N' -diaminoguanidine hydrochloride, 0.5-3% of BL25(W/V), 0.2-10mM DTT, 0.5-10% of TritonX-100, 0.2-20 mM EDTA, 0.05-1% of lithium dodecyl sulfate and 0.5-2% of Tween-20;

3. The reagent for rapidly detecting the pathogenic microorganism nucleic acid as claimed in claim 2, wherein the proportion relationship between the number of probes of the probe set and the specific sequence region of the pathogenic microorganism to be detected is 1-3;

4. The reagent for rapidly detecting pathogenic microorganism nucleic acid as claimed in claim 3, wherein the number of specific sequence regions of pathogenic microorganism to be detected is 2-4, the specific upstream primer group consists of 3-5 primers specifically complementary to the target region, and the length of the primers is 45-60 bp; the specific downstream primer group consists of 3-5 primers which are specifically complementary with the target region, and the length of the primers in the specific downstream primer group is 35-45 bp; the proportional relation between the probe number of the probe set and the specific sequence area of the pathogenic microorganism to be detected is 2;

5. The reagent of claim 4, wherein the 5 ' end of the specific downstream primer set is modified with Biotin, the 5 ' end of the probe set of the specific probe set is modified with FAM and FITC, the 3 ' end is modified with a blocking modification, and the modified chemical groups include: c3 and C6, the intermediate base modifications including: AP sites and THF modifications.

6. The reagent of claim 4, wherein the enrichment reaction system includes a high efficiency enrichment enzyme mixture and a high efficiency enrichment reaction solution, the high efficiency enrichment enzyme mixture includes one or more of reverse transcriptase, recombinase, single-chain binding protein, chain displacement enzyme, AP site recognition enzyme, and Cas series enzyme, and the reverse transcriptase includes AMV and MMLV.

7. The reagent of claim 6, wherein the enzyme mixture includes reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme, AP site recognition enzyme or reverse transcriptase, recombinase, single-chain binding protein, strand displacement enzyme and Cas series enzyme, and the reverse transcriptase is 400U MMLV.

8. The reagent of claim 6, wherein the recombinase comprises one or more of uvsX at 0.05-0.2 μ M, uvsY at 1-4 μ M, and MrecA at 0.2-10 μ M; the single-chain binding protein comprises Ecoil SSB, T4gp 32; the strand displacing enzyme includes phi29, Bst2.0, Bst3.0, Sau DNA Polymerase or T7DNA Polymerase; the AP site recognition enzyme comprises Ecoil Endonuclease IV, fpg; the Cas series of enzymes are Cas12 system enzymes.

9. The reagent of claim 8, wherein the recombinase is 0.2 μ M uvsX, 1.8 μ M uvsY; the single-chain binding protein is 31-50 mu M T4gp 32; the strand displacing enzyme is 1-20U of Sau DNA Polymerase, and the AP site recognition enzyme comprises Ecoil Endonuclease IV and fpg; the Cas series of enzymes are Cas12 system enzymes.

10. The reagent of claim 6, wherein the reaction solution for efficient enrichment comprises 1-200 mM Tris Acetate pH 8.3, 10-1M KOAc, 5mM DTT, 0.1-5% Creatine kinase, 1-30% PEG-3000, 0.5-10% trehalose, 5-100 mM phosphoprotein, 1-4 mM ATP, 1.8-4 mM dNTPs, and 0.1-2% Brij-35.

11. A microbial nucleic acid rapid detection kit is characterized by comprising a one-step sample reactor and a rapid detection reaction card, wherein the one-step sample reactor consists of a nucleic acid hand-free agent and a one-step sample reaction tube; the rapid detection reaction card consists of a nucleic acid rapid detection reagent, a nucleic acid rapid detection card and a nucleic acid rapid reactor.

12. The rapid detection kit for microbial nucleic acid according to claim , wherein the one-step sample reaction tube comprises a plastic tube body and a tube cover with a one-way switch; the one-step sample reaction tube comprises 0.1-3 ml of nucleic acid hand-free agent; the nucleic acid rapid detection reagent of the rapid detection reaction card comprises a nucleic acid rapid reactor which is preinstalled; the nucleic acid rapid reactor is a closed type adjustable switch and an adjustable heating constant temperature reactor; the rapid detection card can be used for loading a nucleic acid rapid reactor and can be used for sealing the detection card.

13. A method for using a microbial nucleotide kit is characterized by comprising the following steps:

14. The use method of the microbial nucleotide kit according to claim 13, wherein the sample type comprises throat swab, whole blood, nasal swab or saliva, the ratio of the nucleic acid hands-free agent to the sample amount is 1-100, the amount of the nucleic acid hands-free agent product added to the rapid detection reaction card is 1-4 drops, and the volume of the nucleic acid hands-free agent product is 10-100 μ l.