CN112301105B - RDA method and kit for rapidly detecting neisseria gonorrhoeae - Google Patents

RDA method and kit for rapidly detecting neisseria gonorrhoeae Download PDF

Info

Publication number
CN112301105B
CN112301105B CN202010081197.1A CN202010081197A CN112301105B CN 112301105 B CN112301105 B CN 112301105B CN 202010081197 A CN202010081197 A CN 202010081197A CN 112301105 B CN112301105 B CN 112301105B
Authority
CN
China
Prior art keywords
seq
rda
neisseria gonorrhoeae
probe
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010081197.1A
Other languages
Chinese (zh)
Other versions
CN112301105A (en
Inventor
陈翀
刘华勇
谢婵芳
叶月娥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Pushi Lihua Technology Co ltd
Original Assignee
Guangzhou Pushi Lihua Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Pushi Lihua Technology Co ltd filed Critical Guangzhou Pushi Lihua Technology Co ltd
Priority to CN202010081197.1A priority Critical patent/CN112301105B/en
Publication of CN112301105A publication Critical patent/CN112301105A/en
Application granted granted Critical
Publication of CN112301105B publication Critical patent/CN112301105B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an RDA method and a kit for rapidly detecting neisseria gonorrhoeae, which comprise a specific primer pair and an RDA fluorescent marked probe so as to realize safe, specific, sensitive and simple detection of Neisseria Gonorrhoeae (NG), thereby overcoming the defects of the traditional detection technology. The kit provided by the method can omit the nucleic acid extraction step, realizes the detection of neisseria gonorrhoeae within 20min at the constant temperature of 37-42 ℃, has the specificity of 100 percent, and is very suitable for on-site rapid detection. Compared with the common PCR method, the RDA fluorescence method is to react at constant temperature without changing temperature or complex instrument, and has short reaction time. Therefore, the method and the kit thereof have the characteristics of simple and quick operation, good specificity, high sensitivity, low cost and the like, provide an effective technical means for on-site quick detection and screening of neisseria gonorrhoeae, and have wide application prospects.

Description

RDA method and kit for rapidly detecting neisseria gonorrhoeae
Technical Field
The invention belongs to the technical field of molecular biology. More particularly, it relates to a primer pair, a probe and a related kit for detecting neisseria gonorrhoeae nucleic acid based on RDA fluorescence detection technology.
Background
Neisseria gonorrhoeae (Neisseria gonorrhoeae, NG), commonly known as gonococcus, is a gram-negative diplococcus, a major pathogen of human common Sexually Transmitted Diseases (STD), and is primarily lodged in leukocytes of purulent secretions of acute urethritis and vaginitis. The human being is the only natural host of neisseria gonorrhoeae, and the bacteria cause suppurative inflammation of the urogenital tract after infecting the human being, for example, symptoms such as hyposexuality, erection incoordination, impotence, premature ejaculation, neurasthenia and the like are easy to appear, and infertility and the like can be possibly induced.
Gonorrhea is widely prevalent in the world, and the WHO recently estimated about 7830 ten thousand new cases of gonorrhea worldwide each year in 2017. In China, the gonorrhea is the fifth in the incidence of the legal infectious diseases of the class B, and becomes the important prevention and treatment of the class B infectious disease specified in the national infectious disease prevention and treatment method of the people's republic of China. It has been found that female gonorrhea is more frequent (0.08%) than male (0.02%) and that about 60% of female gonorrhoeae are recessive infected or infected. The risk of gonorrhea is increased due to the fact that a large number of asymptomatic infected women exist, meanwhile, the timely treatment time is delayed, complications are more likely to be caused, and bad consequences such as infertility and ectopic pregnancy are caused. Therefore, early screening of female gonorrhea patients in pre-pregnancy physical examination is of great importance in preventing neonatal gonorrhea and in executing a prenatal and postnatal care policy.
The etiology detection method of neisseria gonorrhoeae infection mainly comprises a smear detection method and a cell culture method of NG, but the method has higher misdiagnosis and missed diagnosis rate and relatively lower positive detection rate. The molecular biological detection method of neisseria gonorrhoeae is mostly based on PCR, and uses fluorescent marked probes for real-time detection, and the detection needs to rely on a PCR instrument or an expensive real-time quantitative PCR instrument and other various matched equipment, and the cost and the application range of special PCR laboratories and professional operators are limited. With the silent rise of in vitro isothermal amplification of nucleic acids, limitations of conventional amplification techniques have changed, and in the last decade, isothermal nucleic acid amplification techniques, such as LAMP (loop-mediated nucleic acid amplification technique), HDA (helicase-dependent isothermal nucleic acid amplification technique), etc., have been rapidly developed to amplify target nucleic acids under isothermal conditions. The techniques can achieve efficient nucleic acid amplification by only maintaining a constant reaction temperature with a temperature control device, thereby eliminating the dependence on a PCR instrument for precisely controlling temperature changes. If nucleic acid amplification can be achieved at lower temperatures, even at ambient temperature, the nucleic acid amplification technique will be further simplified and a wider range of applications of such techniques will be facilitated.
Disclosure of Invention
The invention aims to overcome the defects and the shortcomings of the existing neisseria gonorrhoeae detection technology, researches and obtains the Neisseria Gonorrhoeae (NG) RDA fluorescence method detection kit, realizes rapid detection of neisseria gonorrhoeae, only needs 20-30min from sample processing to result completion in the whole process of detecting NG, greatly shortens the conventional detection time, and improves the detection efficiency.
The object of the present invention is to provide a target sequence, a primer pair and a probe for detecting neisseria gonorrhoeae after optimization.
The nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2.
In this patent we designed RDA fluorescent label probes using two schemes, the first scheme is: the conserved sequence of 25-35bp is selected as a probe sequence, a luminous group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF). The second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. Through series experimental comparison, the two probe designs are suitable for RDA fluorescence detection methods, and have no obvious difference in detection sensitivity and specificity.
Preferably, the probe with the nucleotide sequence of SEQ ID NO.1 is provided with a luminous group marked at the 5 'end and a quenching group marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), wherein the specific information is as follows:
NG-P1（SEQ ID NO .1）：
5’- FAM-ACCCG[THF]CCGTTGCGTTTCGGAATGCCGAAG -BHQ1-3′
preferably, the nucleotide sequence of the probe is SEQ ID NO.2, the 30 th base T of the 5 'end of the probe marks FAM or other luminescent groups, the 32 th base is replaced by tetrahydrofuran residue (THF), the 34 th base marks BHQ1 or other quenching groups, and the 3' end of the probe is subjected to C3-spacer blocking modification, wherein the specific information is as follows:
NG-P2（SEQ ID NO .2）： 5’-GTCCKCGGCAACGGTATAGACCCGCCCGT[FAM-dT]G[THF]G[BHQ1-dT]TTCGGAATGCCGAAG[C3-spacer] -3’
the nucleotide sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4, the target sequence is shown as SEQ ID NO. 5, and the specific information is as follows:
NG-F1（SEQ ID NO .3）： 5’- GGCTCGGCATYGTCCGCGGCAACGGTATAG-3’；
NG-R1（SEQ ID NO .4）： 5’-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3’。
it is another object of the present invention to provide a kit for detecting neisseria gonorrhoeae based on isothermal amplification technology.
The kit comprises a nucleic acid extraction reagent, a isothermal amplification reaction module, a positive control, a negative control, the probe and the primer pair.
Preferably, the isothermal amplification reaction module is a freeze-dried powder reagent of isothermal amplification reaction mixed reagent.
Preferably, the isothermal amplification reaction mixture is an RPA or Recombinase-dependent amplification technique (RDA) isothermal amplification reaction mixture.
It is another object of the present invention to provide a kit for detecting neisseria gonorrhoeae based on the Recombinase-dependent amplification technique (recabinase-dependent amplification, RDA).
The Recombinase-dependent amplification technique (Recombinase-dependent amplification, RDA) is realized by the following technical scheme:
according to the invention, a biological informatics method is utilized to carry out analysis simulation and high-throughput virtual screening on a batch of protein structures, and a large number of biological experiments prove that a new recombinase combination with high stability is finally found. Specifically, the invention develops a novel recombinase composition which is a recombinase KX and an auxiliary protein KY, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, the amino acid sequence of the recombinase KX is shown as SEQ ID NO.7, the nucleotide sequence of the auxiliary protein KY is shown as SEQ ID NO.8, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 9.
The recombinase KX can be used for replacing the recombinase UvsX or RecA in the RPA reaction, and the KY protein can be used for replacing the UvsY protein in the RPA reaction.
The sequence homology of the recombinase KX with the T4UvsX protein is 50% (201/395). Based on the recombinase combination, the team develops a novel detection method and detection system of a recombinase-dependent amplification (RDA) technology with high stability and high specificity. The preparation process of the recombinase KX is simple, the yield and the stability are greatly improved, and the mass production cost is low. And the amplification technology based on the recombinase combination development has the advantages of short required primer (18-30 bp), low requirement on the length of a target sequence and wide applicability. Furthermore, the technology has good detection specificity and high sensitivity on the nucleic acid target sequence, can realize high-sensitivity and high-precision rapid molecular detection under the constant temperature condition of 25-42 ℃, has low detection cost, is convenient and quick to operate, and has wide application prospect.
The recombinant enzyme KX and protein KY are derived from Escherichia phage phT A phage, escherichia phage phT A belongs to the genus Slopekvirus in the subfamily of Tevenvirinae belonging to the family Myoviridae.
The recombinant enzymes KX and protein KY can realize a large amount of soluble expression in escherichia coli.
In particular as an alternative, the preparation method comprises the following steps:
s1, introducing a target gene expression fragment into an expression vector to obtain a recombinant expression vector;
s2, transferring the recombinant expression vector into an expression bacterium to obtain a recombinant engineering bacterium;
s3, carrying out induction culture on the recombinant engineering bacteria, enriching the engineering bacteria, carrying out ultrasonic crushing, and centrifuging to obtain unpurified recombinant enzyme;
s4, purifying the unpurified recombinase through chromatography to obtain the recombinase KX. The purified recombinant enzyme KX does not have the phenomenon of coagulation or precipitation at low temperature.
The target gene expression fragment in the step S1 contains a nucleic acid sequence shown as SEQ ID NO.6, the 5 'end of the target gene expression fragment is provided with a BamHI enzyme cutting site adhesive end, and the 3' end of the target gene expression fragment is provided with a Sall enzyme cutting site adhesive end.
Preferably, the expression vector in step S1 is a pET-28a vector.
Preferably, the expressing bacterium in step S2 is escherichia coli.
The preparation process is simple, the yield and the stability are greatly improved, and the mass production cost is low.
Preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: recombinant enzymes KX, KY protein, gp32 protein, strand displacement DNA polymerase, exonuclease, creatine kinase, creatine phosphate, tris-buffer, potassium acetate or sodium acetate, PEG20000 or PEG35000, DTT, dNTPs, dATP, the probe, the primer pair, and magnesium acetate. Preferably, the reaction system further comprises a detection template, such as a sample DNA or RNA to be detected.
Preferably, the reaction conditions of the reaction system are 25-42 ℃ for 10-60min.
More preferably, the reaction conditions of the reaction system are 39 ℃ for 30min.
The reaction principle of the recombinase-dependent amplification (RDA) reaction system is as follows: (1) A recombinase-primer complex formed by combining recombinase with a specific primer of 18-30bp in a reaction system, and searching a target site in a double-stranded DNA template; (2) After the recombinase-primer complex recognizes the template specific sequence, localization occurs and strand exchange is initiated, and the single-stranded binding protein is then bound to the D-Loop structure formed by the displaced DNA strand; (3) The dATP conformation in a recombinase-primer complex hydrolysis system is changed, the 3 'end of a primer is exposed after the recombinase is dissociated and is recognized by DNA polymerase, and the DNA polymerase starts DNA synthesis at the 3' end of the primer according to a template sequence; (4) The DNA polymerase has a strand displacement function, and the double-helix DNA structure of the template is continuously unwound while the primer is extended, and the DNA synthesis process is continuously carried out; (5) The two primers are amplified to form a complete amplicon; (6) In the reaction system, dATP is hydrolyzed into recombinase to be changed into dATP, and phosphocreatine can transfer the phosphate group of the phosphocreatine into dATP molecules under the catalysis of creatine kinase to form dATP, so that the level of the dATP in the reaction system is recovered. The above process is repeated continuously, and finally, the efficient amplification of the nucleic acid is realized.
A kit for detecting Neisseria Gonorrhoeae (NG) based on a recombinase-dependent amplification technology (RDA) is constructed based on the reaction system, and comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, a positive control and a negative control, and the probe and the primer.
Preferably, the RDA isothermal amplification reaction module is a freeze-dried powder reagent of RDA isothermal amplification reaction mixed reagent.
Preferably, the RDA isothermal amplification reaction module comprises recombinase KX 60-600 ng/mu L, KY protein 16-192 ng/mu L, single-stranded binding protein gp32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, tris buffer 20-100mM, PEG2.5% -10%, potassium acetate or sodium acetate 0-150mM, dATP 1-5mM, dNTPs 150-600nM each, DTT 1-12mM, probe 150nM-600nM, and primer pair 150-600nM.
Preferably, the Tris-buffer is Tris-tricine.
Preferably, the concentration of Tris-tricine is 100mM.
The nucleic acid extraction reagent comprises Buffer A and Buffer B. Buffer A is sample lysate and contains Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton; buffer B contains Tris Buffer system, potassium chloride and magnesium chloride; the positive control was a target gene plasmid containing Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid.
It is still another object of the present invention to provide a method for detecting neisseria gonorrhoeae which is based on the recombinase-dependent amplification technique.
The detection method comprises the following steps: extracting nucleic acid of a sample to be detected, carrying out real-time fluorescence RDA reaction in the presence of a primer pair, a probe and RDA freeze-dried powder reagent of neisseria gonorrhoeae, buffer A and Buffer B by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO.2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 15 minutes.
Preferably, the method further comprises the following steps:
1) Sample processing
Shaking and mixing 20 μL of Buffer A and 5 μL of positive control/negative control/sample to be detected (swab sample), and standing at room temperature for 10-15min; neisseria gonorrhoeae DNA can be detected.
2) System preparation and detection
Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA isothermal amplification reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the fluorescent signal is collected every minute after 1 minute and 30 cycles at 39 ℃ and the detection is completed after 30 minutes;
3) Result determination
The result is interpreted based on the Time (Tt) at which the fluorescence value generated by the reaction system reaches the Threshold value.
(1) Positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The invention has the following beneficial effects:
1. the kit provided by the invention is used for detecting the neisseria gonorrhoeae DNA in human genitourinary secretions and urine, has the characteristics of simplicity in operation, rapidness and sensitivity, provides an effective technical means for on-site rapid detection and screening of the neisseria gonorrhoeae, and has important significance in clinical detection of the neisseria gonorrhoeae.
2. The kit provided by the invention adopts an RDA isothermal amplification detection method, can realize effective amplification of target genes at 37-42 ℃, does not need temperature change, and does not need complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 1 copies/. Mu.l.
3. In the RDA method, the recombinase KX protein and KY protein have high specificity to the target sequence in the amplification process, and only the primer sequence and the template sequence are completely complementary to start the amplification, so that the specificity of the amplification is greatly improved, and the high-efficiency constant-temperature nucleic acid amplification without background is realized.
Drawings
FIG. 1 is a graph showing the results of ATP hydrolysis activities of 4 proteins in the recombinase screening of example 1 of the present invention.
FIG. 2 is an agarose gel diagram of a isothermal amplification reaction of 4 proteins in the recombinase screen of example 1 of the invention.
FIG. 3 is a three-dimensional structure of KX protein in example 1 of the present invention.
FIG. 4 is a three-dimensional block diagram of the KY protein heptamer in example 1 of the present invention.
FIG. 5 is a graph showing the results of the RDA fluorescence assay kit according to example 1 of the present invention.
FIG. 6 is a graph showing the sensitivity test results of the RDA fluorescence assay kit according to example 2 of the present invention.
FIG. 7 is a graph showing the results of the specific test of the RDA fluorescence assay kit according to example 3 of the present invention.
FIG. 8 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 9 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 10 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 11 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
Detailed Description
The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. It will be apparent to those skilled in the art that various changes, modifications, substitutions, combinations, and simplifications can be made without departing from the spirit and principles of the invention and these are intended to be equivalent arrangements.
Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art. Reagents and materials used in the following examples are commercially available unless otherwise specified.
Unless otherwise indicated, the immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA, etc., employed by this invention are within the skill of the art. See Sambrook (Sambrook), friech (Fritsch) and manitis (Maniatis), molecular cloning: laboratory Manual (MOLEC. Mu.M LAR CLONING: A LABORATORY MANUAL), edit 2 (1989); current generation Manual of molecular BIOLOGY (CURRENT PROTOCOLS IN MOLEC μm LAR BIOLOGY) (F.M.Ausubel et al, editions of F.M.Ausubel et al, (1987)); series (academic publishing company) of methods in enzymology (METHODS IN ENZYMOLOGY): PCR2 practical methods (PCR 2:A PRACTICAL APPROACH) (M.J. MaxParson (M.J. MacPherson), B.D. Black (B.D. Hames) and G.R. Taylor (G.R. Taylor) editions (1995)), harlow and Lane editions (1988) antibodies: laboratory Manual (ANTIBODIES, A LABORATORY MANUAL), animal cell culture (ANIMAL CELL C. Mu.M LTURE) (R.I. Fu Lei Xieni (R.I. Freshney) eds. (1987)).
Example 1 establishment of a method for detecting Neisseria Gonorrhoeae (NG) RDA fluorescence assay kit
(1) Acquisition of recombinant enzyme KX and KY proteins
The reported recombinase UvsX has poor stability, is difficult to produce in mass production and store for a long time, and in order to solve the problem, the research and development team finally finds a new recombinase KX and auxiliary protein KY thereof by analyzing and simulating a large quantity of protein structures by using a bioinformatics method.
In this embodiment, the research and development team maps the information of key functional sites in the recombinase structure, such as DNA binding sites, ATP hydrolysis sites, etc., to the three-dimensional protein structure to obtain the information of secondary structure and information of tertiary structure, and constructs a data model for screening the recombinase protein structure by integrating the functional residues, the secondary structure features and the space distance of tertiary structure of the primary structure sequence. Through searching templates matched with the recombinase protein in the primary structure from SwissProt, PDB data, 312 protein sequences are primarily screened out, secondary structure and tertiary structure comparison are respectively carried out, similarity scores are calculated, ranking is carried out according to the similarity scores, and 15 proteins suspected to have the recombinase activity are simulated and screened out.
The 15 proteins are respectively constructed into recombinant protein expression vectors, and after being respectively expressed and purified, the ability of the recombinant protein expression vectors to hydrolyze ATP is detected, wherein 4 proteins have ATP hydrolysis activity and are KX, X-1, X-2 and X-3 proteins respectively. In the experiment, firefly luciferase ATP bioluminescence detection kit is used, and the experiment is carried out strictly according to the operation of the specification, and the result is shown in FIG. 1.
The method comprises the steps of preparing 4 proteins with ATP hydrolytic activity into a constant-temperature amplification system for amplification reaction, wherein the result is shown in figure 2, N is a negative control, P is a positive control amplified by adding T4UvsX, and 1-4 proteins are KX, X-1, X-2 and X-3 respectively, wherein only KX protein has amplification activity. The KX protein is derived from Escherichia phage phT A phage, and the three-dimensional structure diagram is shown in FIG. 3.
In the same way we screened the helper protein KY derived from the Escherichia phage phT a phage for the recombinase KX, the three-dimensional structure of which is shown in figure 4. Wherein the auxiliary protein KY needs to play an active role in the form of heptamers.
Finally obtaining the recombinase KX for RDA amplification, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 7; the nucleotide sequence of the recombinase KY is shown as SEQ ID NO.8, and the amino acid sequence is shown as SEQ ID NO. 9.
(2) Neisseria gonorrhoeae detection primers and probe design and screening
The neisseria gonorrhoeae complete gene sequences were searched by NCBI (www.ncbi.nlm.nih.gov), homology alignment and sequence analysis were performed using Clone manager software and BLAST, from which sequences conserved within the species of the pathogen, interspecies variation were selected as target regions. After comparing and analyzing the whole genome sequences of multiple neisseria gonorrhoeae, finally selecting a conserved region as a target gene (reference sequence GenBank accession number: CP 020415.2), and designing RDA detection primers and probes by using the target fragment. The DNA plasmid, primer and probe sequence of target gene are synthesized by Shanghai JieRui bioengineering Co.Ltd. The highly conserved sequences of neisseria gonorrhoeae were screened as follows:
SEQ ID NO .5：
ACGGATAAAACCGCCCGCGTCCAACTTGCCGCGGCTGCCCGGGCTATCGGCATAAACAATACCGTCCGGCATGATTTTCTTTTTGACGGCAGGGAGCAACGTTTCAGGCTCGGCATCGTCCGCGGCAACGGTATAGACCCGCCCGTTGCGTTTCGGAATGCCGAAGACAACCGCTTTTCCTGCCGCGCCGCGACCGCGTCTGCCTTTACGCCGTACGCCGAAACAGCTTCCGCCCGGCCCGGCGGGGCGCTCGAAAACCTCATCGGCAGCCAAGGCCAAACGATGGTTGGTAACCGTGCGGATTTTACGGTAAAACAGTGCCGC
in the embodiment, the design is carried out by adopting the RDA technology primer design principle, the lengths of an upstream primer and a downstream primer are 18-30bp, 3 primers are respectively designed according to the conserved sequence of neisseria gonorrhoeae, and the sequences of the primers are as follows:
the upstream primer NG-F1:5 '-GGCTCGGCATYGTCCGCGGCAACGGTATAG-3'
The upstream primer NG-F2:5 '-AGGGRGYAACGTTTCAGGCTCGGCAT-3'
Upstream primer NG-F3:5 '-GGGCTATCGGYATAAACAATACCGTCC-3'
Downstream primer NG-R1: 5'-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3'
Downstream primer NG-R2: 5 '-TTCGGCGKRCGGCGTAAAGGCRGACGCGG-3'
Downstream primer NG-R3:5 '-CCGCACGGTTRCCAACCATCGTTTGGCC-3'
The 3 pairs of primers were paired pairwise to form 9 combinations for optimal primer combination screening.
Combination 1: NG-F1 and NG-R1; combination 2: NG-F1 and NG-R2 in combination 3: NG-F1 and NG-R3
Combination 4: NG-F2 and NG-R1; combination 5: NG-F2 and NG-R2 combination 6: NG-F2 and NG-R3
Combination 7: NG-F3 and NG-R1; combination 8: NG-F3 and NG-R2 combination 9: NG-F3 and NG-R3
Through a series of experimental screens and evaluations, combination 1 (NG-F1 and NG-R1) was determined as the optimal primer set, specifically:
NG-F1（SEQ ID NO .3）： 5’- GGCTCGGCATYGTCCGCGGCAACGGTATAG-3’；
NG-R1（SEQ ID NO .4）： 5’-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3’。
in the RDA fluorescence detection technique, two schemes are used to design the RDA fluorescence labeling probe, the first scheme is as follows: the target region is selected to be a 25-35bp conserved sequence, a 5 '-end is marked with a luminescent group, a 3' -end is marked with a quenching group, any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), the nucleotide sequence is a probe of SEQ ID NO.1 in the embodiment, the 5 '-end is marked with the luminescent group, the 3' -end is marked with the quenching group, any position of 5-position bases is replaced by tetrahydrofuran residue (THF), and the specific information is as follows:
NG-P1（SEQ ID NO .1）：
5’- FAM-ACCCG[THF]CCGTTGCGTTTCGGAATGCCGAAG -BHQ1-3′
the second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. In the probe with the nucleotide sequence of SEQ ID NO.2, the 30 th base T of the 5 'end is marked with FAM or other luminescent groups, the 32 nd base is replaced by tetrahydrofuran residue (THF), the 34 th base is marked with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, which has the following specific information:
NG-P2（SEQ ID NO .2）： 5’-GTCCKCGGCAACGGTATAGACCCGCCCGT[FAM-dT]G[THF]G[BHQ1-dT]TTCGGAATGCCGAAG[C3-spacer] -3’
through series experimental comparison, the two probe designs are both suitable for RDA fluorescence detection methods, and have NO obvious difference in detection sensitivity and specificity, wherein the target conserved sequence required by the first probe design is shorter, the requirement on the nucleic acid sequence is low, and in the subsequent examples of the patent, the first probe NG-P1 (SEQ ID NO. 1) is used as a detection probe to prepare an RDA isothermal amplification reaction system.
(3) Establishment of Neisseria Gonorrhoeae (NG) RDA detection method
The patent constructs a kit for detecting Neisseria Gonorrhoeae (NG) based on a recombinase dependent amplification technology (RDA), which comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, a positive control and a negative control, wherein the nucleic acid extraction reagent comprises Buffer A and Buffer B, the Buffer A is sample lysate and contains a Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton, and the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; optimal allocation ratio of a reaction system in the RDA isothermal amplification reaction module is shown in table 1, and the optimal allocation ratio comprises the fluorescent labeled probe and the primer; the positive control was a target gene plasmid containing Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid.
TABLE 1 RDA isothermal amplification reaction module reaction system ratios
Sequence number Component (A) Concentration of content
1 Tris-tricine（PH 7.9） 100mM
2 Potassium acetate 50mM
3 PEG20000 or PEG35000 5%
4 DTT 2mM
5 dNTPs 200nM each
6 dATP 2mM
7 Creatine kinase (Creatine kinase) 0.2mg/ml
8 Creatine phosphate (Creatine phosphate) 50mM
9 Strand-displacing DNA polymerase 50ng/ul
10 gp32 protein 300 ng/ul
11 Recombinant enzyme KX 120 ng/ul
12 Helper protein KY 60ng/ul
13 Exonuclease 50U
14 Upstream primer 500nM
15 Downstream primer 500nM
16 Fluorescent-labeled probe 300nM
17 Magnesium acetate 14mM
The reaction conditions of the reaction system are as follows: reacting at 25-42 deg.C for 10-60min.
The optimal reaction conditions are as follows: the reaction was carried out at 37℃for 30min.
In this example, 4 collected samples of genital tract secretions positive for neisseria gonorrhoeae DNA were all verified by fluorescent quantitative PCR and tested using the RDA fluorescence detection kit of this patent.
The specific operation is as follows:
step one, sample processing. Shaking and mixing 20 μL of Buffer A and 5 μL of positive control/negative control/secretion sample to be detected, and standing at room temperature for 10-15min;
and step two, preparing and detecting the system. Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the fluorescent signal is collected every minute after 1 minute and 30 cycles at 39 ℃ and the detection can be completed after 30 minutes;
and step three, judging the result.
(1) Positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The detection results are shown in table 2 and fig. 5, and the positive control and the negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, and is the content of effective result', and Tt value of each sample is less than 25min, and positive is judged.
The results show that the detection method of the RDA fluorescence detection kit established in the embodiment can detect the neisseria gonorrhoeae DNA in human genital urinary tract secretion.
Table 2 establishment of the method for detecting the kit
Negative control Positive control NG-1 NG-2 NG-3 NG-4
Tt value - 04:07 04:54 07:47 05:19 09:43
Example 2 RDA fluorescence detection reagent sensitivity test
The positive control was a plasmid containing the target gene of Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid. The specific operation is as follows:
step one, diluting positive control plasmid to 10-3 c, and then diluting 10-fold gradient to 10-2 c, 10-1 c and 10-0 c respectively.
And step two, sample processing. Taking 5 mu L of plasmids with each concentration in the step one into an EP tube, simultaneously taking 5 mu L of negative control into another EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39 ℃ for 1 minute, 30 cycles, where fluorescent signals were collected;
and step four, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 3 and FIG. 6. The negative control Tt value is NA, and accords with the content that no amplification curve appears in the judging standard or the Tt value is more than or equal to 25 min. 10 < 3c, 10 < 2c, 10 < 1c, 10 < 0c have Tt values <25min, and the 10 < 3c, 10 < 2c, 10 < 1c, 10 < 0c results are positive according to the result determination criteria.
That is, the sensitivity of the RDA fluorescence detection kit reaches a single copy.
TABLE 3 sensitivity test results
Negative control 10^3 10^2 10^1 10^0
Tt value - 06:15 07:37 09:45 14:45
Example 3 RDA fluorescence assay reagent specificity test
Samples of 6 cases of 3 cases of neisseria gonorrhoeae (Neisseria gonorrhoeae, NG), 1 case of chlamydia trachomatis (Chlamydia trachomatis, CT), 1 case of ureaplasma urealyticum (Ureaplasma urealyticum, UU), and 1 case of human papillomavirus 18 (Human Papilloma Virus, HPV 18) which were confirmed to be positive for the corresponding pathogen by fluorescence quantitative PCR were collected clinically, and the specificity of the kit was checked.
The specific operation is as follows:
step one, sample processing. Taking 5 mu L of each positive sample in an EP tube, simultaneously taking 5 mu L of each positive control and negative control of the kit in a new EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39. 1 min at C, 30 cycles, where fluorescent signals were collected;
and step four, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 4 and FIG. 7. Positive control and negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25mn, which is the content of effective result. The Tt values of the NG samples are smaller than 25min, and positive is judged; CT, UU, HPV without amplification curve, negative.
That is, RDA fluorescence detects positive and negative for other pathogens only when the target pathogen is neisseria gonorrhoeae.
TABLE 4 specificity test results
Sample name Tt value Sample name Tt value
Negative control - NG-3 05:55
Positive control 04:05 CT -
NG-1 06:03 UU -
NG-2 05:33 HPV -
Example 4 stability test of RDA fluorescence detection kit
The liquid reagent needs to be stored at low temperature and can not be repeatedly frozen and thawed. The kit is characterized in that the RDA fluorescence reaction module is dried into a powdery reagent in vacuum, the freeze-dried powdery reagent can be stored at normal temperature, the cost of cold chain transportation and low-temperature storage is saved, and the operation is simpler. The stability of the RDA fluorescence detection kit was verified in this example.
The specific operation is as follows:
eight-tube containing lyophilized reagents were sealed in aluminum foil bags containing a desiccant and stored in a 37 ℃ incubator. Reagent was taken and tested on days 0, 30, 90, 180, respectively.
Step one, sample processing. Taking 5 mu L of positive control and negative control of the kit respectively in an EP tube, adding 20 mu L of Buffer A respectively, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and step two, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39. 1 min at C, 30 cycles, where fluorescent signals were collected;
and step three, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 5 and FIG. 8, FIG. 9, FIG. 10, and FIG. 11. The freeze-dried powder of the reagent of the RDA fluorescence reaction module stored for 0 day, 30 day, 90 day and 180 day is tested, each Tt value is smaller than 25min, and the detection results of the reagent in the kit in the patent after freeze-drying are positive in 0 day, 30 day, 90 day and 180 day according to the result judgment standard. The reagent in the kit can be stably stored for at least 3 months at 37 ℃ after being freeze-dried.
TABLE 5 preservation stability at 37℃
Day 0 For 30 days 90 days 180 days
Negative control - - - -
Positive control 05:44 06:01 06:28 06:38
The above examples illustrate the ability to rapidly detect neisseria gonorrhoeae using the RDA technique of the present invention, with simple and convenient operation, and effective amplification of target genes at 37-42 ℃ without the need for temperature changes and complex instrumentation. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 1 copies/. Mu.l. In the RDA method, the recombinase KX protein and KY protein have high specificity to the target sequence in the amplification process, and only the primer sequence and the template sequence are completely complementary to start the amplification, so that the specificity of the amplification is greatly improved, and the high-efficiency constant-temperature nucleic acid amplification without background is realized.
The above description is only exemplary of the present invention and should not be taken as limiting the invention, but rather should be construed in breadth and spirit of the present invention
And any modifications, equivalent substitutions, improvements, etc. made within the principles are intended to be included within the scope of the present invention.
Sequence listing
<110> Guangzhou Pushili Hua technology Co., ltd
<120> RDA method and kit for rapid detection of Neisseria gonorrhoeae
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 1)
<400> 1
acccgcccgt tgcgtttcgg aatgccgaag 30
<210> 2
<211> 49
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 2)
<400> 2
gtcckcggca acggtataga cccgcccgtt gcgtttcgga atgccgaag 49
<210> 3
<211> 30
<212> DNA
<213> primer sequence (SEQ ID NO. 3)
<400> 3
ggctcggcat ygtccgcggc aacggtatag 30
<210> 4
<211> 30
<212> DNA
<213> primer sequence (SEQ ID NO. 4)
<400> 4
ccaaccatcg tttggccttg gctgccgatg 30
<210> 5
<211> 324
<212> DNA
<213> target sequence (SEQ ID NO. 5)
<400> 5
acggataaaa ccgcccgcgt ccaacttgcc gcggctgccc gggctatcgg cataaacaat 60
accgtccggc atgattttct ttttgacggc agggagcaac gtttcaggct cggcatcgtc 120
cgcggcaacg gtatagaccc gcccgttgcg tttcggaatg ccgaagacaa ccgcttttcc 180
tgccgcgccg cgaccgcgtc tgcctttacg ccgtacgccg aaacagcttc cgcccggccc 240
ggcggggcgc tcgaaaacct catcggcagc caaggccaaa cgatggttgg taaccgtgcg 300
gattttacgg taaaacagtg ccgc 324
<210> 6
<211> 1158
<212> DNA
<213> recombinase KX nucleotide sequence (SEQ ID NO. 6)
<400> 6
atgtcaaaca aagcactact aaaaaaactg atcaaaaact cgaatagcca aactgcatct 60
gtactttctg aaagcgacgt attcaacaat attaccatca cgcgaacccg tgtgccgatt 120
ctgaatctgg cgttgtccgg tgcgtttaac ggtggcctaa cttctggtct tacccttttc 180
gctggcccgt ccaaacactt caaatccaac ttaggtttgc ttactgtagc ggcgtatctc 240
aaaacgtatg aagatgctgt gtgcctgttc tacgattcag aaaaaggtgt tactaaatcc 300
tatctgaaat caatgggtgt tgatccggat cgtgttgtgt atactcgtat cacgacggtc 360
gagcagttgc gtaatgacgt tgtaagccag cttaacgcgc ttgaacgcgg tgataaggtg 420
attgtattcg ttgactcagt aggcaacacg gcaagtaaaa aagaacttgc tgacgcgctt 480
tctgataacg ataaacagga tatgacgcga gcaaaagcat taaaaggtat gttccgtatg 540
gttacgcctt atctggctga cctggatatc ccgatggttt gtatctgtca tacctatgac 600
acacaagaaa tgtacagcaa gaaagttatt tctggtggta ctggtttaat gtattccgct 660
gatactgcga tcatcctggg taaacaacag gtgaaagaag gtactgaggt ggtaggttat 720
gatttcatca tgaatatcga aaaatctcga ttcgtgaaag agaaatcaaa attcccgctg 780
catgttacct atgaaggcgg tattagtatg tattctggcc ttttggatct ggcaatggaa 840
atgaactttg tacagaccgt aaccaaaggc tggcgcaacc gcgctttcct gaataccgag 900
actggcgaac tcgaagttga agaaaagaaa tggcgtgagt cagaaacaaa tagcgttgaa 960
ttctggcgtc ctctgtttac tcatcaacca ttcttgaaag ctatcgaaga aaagtataag 1020
atcccagatc gtgaaatcag tgatggttcc gcgctggaag atttatacag cactgatagc 1080
atcccagatc ctgatctgga tgatgacgat atcccagaat catttgatga tatcgaagaa 1140
aacgacgaaa ttttataa 1158
<210> 7
<211> 385
<212> PRT
<213> recombinase KX amino acid sequence (SEQ ID NO. 7)
<400> 7
Met Ser Asn Lys Ala Leu Leu Lys Lys Leu Ile Lys Asn Ser Asn Ser
1 5 10 15
Gln Thr Ala Ser Val Leu Ser Glu Ser Asp Val Phe Asn Asn Ile Thr
20 25 30
Ile Thr Arg Thr Arg Val Pro Ile Leu Asn Leu Ala Leu Ser Gly Ala
35 40 45
Phe Asn Gly Gly Leu Thr Ser Gly Leu Thr Leu Phe Ala Gly Pro Ser
50 55 60
Lys His Phe Lys Ser Asn Leu Gly Leu Leu Thr Val Ala Ala Tyr Leu
65 70 75 80
Lys Thr Tyr Glu Asp Ala Val Cys Leu Phe Tyr Asp Ser Glu Lys Gly
85 90 95
Val Thr Lys Ser Tyr Leu Lys Ser Met Gly Val Asp Pro Asp Arg Val
100 105 110
Val Tyr Thr Arg Ile Thr Thr Val Glu Gln Leu Arg Asn Asp Val Val
115 120 125
Ser Gln Leu Asn Ala Leu Glu Arg Gly Asp Lys Val Ile Val Phe Val
130 135 140
Asp Ser Val Gly Asn Thr Ala Ser Lys Lys Glu Leu Ala Asp Ala Leu
145 150 155 160
Ser Asp Asn Asp Lys Gln Asp Met Thr Arg Ala Lys Ala Leu Lys Gly
165 170 175
Met Phe Arg Met Val Thr Pro Tyr Leu Ala Asp Leu Asp Ile Pro Met
180 185 190
Val Cys Ile Cys His Thr Tyr Asp Thr Gln Glu Met Tyr Ser Lys Lys
195 200 205
Val Ile Ser Gly Gly Thr Gly Leu Met Tyr Ser Ala Asp Thr Ala Ile
210 215 220
Ile Leu Gly Lys Gln Gln Val Lys Glu Gly Thr Glu Val Val Gly Tyr
225 230 235 240
Asp Phe Ile Met Asn Ile Glu Lys Ser Arg Phe Val Lys Glu Lys Ser
245 250 255
Lys Phe Pro Leu His Val Thr Tyr Glu Gly Gly Ile Ser Met Tyr Ser
260 265 270
Gly Leu Leu Asp Leu Ala Met Glu Met Asn Phe Val Gln Thr Val Thr
275 280 285
Lys Gly Trp Arg Asn Arg Ala Phe Leu Asn Thr Glu Thr Gly Glu Leu
290 295 300
Glu Val Glu Glu Lys Lys Trp Arg Glu Ser Glu Thr Asn Ser Val Glu
305 310 315 320
Phe Trp Arg Pro Leu Phe Thr His Gln Pro Phe Leu Lys Ala Ile Glu
325 330 335
Glu Lys Tyr Lys Ile Pro Asp Arg Glu Ile Ser Asp Gly Ser Ala Leu
340 345 350
Glu Asp Leu Tyr Ser Thr Asp Ser Ile Pro Asp Pro Asp Leu Asp Asp
355 360 365
Asp Asp Ile Pro Glu Ser Phe Asp Asp Ile Glu Glu Asn Asp Glu Ile
370 375 380
Leu
385
<210> 8
<211> 420
<212> DNA
<213> KY protein nucleotide sequence (SEQ ID NO. 8)
<400> 8
atgagtttga aattagaaga tctacaaaat gaacttgaaa aggatatgct gatagatccc 60
ctcaagttgc aatcagaatc agcggatatc ccgaagattt gggctaaatg gcttcgatac 120
cattcaaacg ctaagaaaaa attgatccaa cttcatgcga aaaaagaagc tgatgtgaag 180
gatcgtatgt tgtactacac cggaaggcat gacaaagaaa tgtgcgaagt ggtgtatact 240
gggactactg aaattaaaat cgcgatcgct ggggatccga aaattgtaga aaccaacaag 300
ctgatccagt attatgacat ggtggtagat ttcaccagca aagcactgga tatcgtcaaa 360
aacaaaggat actctatcaa aaacatgtta gagatccgta aattagaaag tggtgcataa 420
<210> 9
<211> 139
<212> PRT
<213> KY protein amino acid sequence (SEQ ID NO. 9)
<400> 9
Met Ser Leu Lys Leu Glu Asp Leu Gln Asn Glu Leu Glu Lys Asp Met
1 5 10 15
Leu Ile Asp Pro Leu Lys Leu Gln Ser Glu Ser Ala Asp Ile Pro Lys
20 25 30
Ile Trp Ala Lys Trp Leu Arg Tyr His Ser Asn Ala Lys Lys Lys Leu
35 40 45
Ile Gln Leu His Ala Lys Lys Glu Ala Asp Val Lys Asp Arg Met Leu
50 55 60
Tyr Tyr Thr Gly Arg His Asp Lys Glu Met Cys Glu Val Val Tyr Thr
65 70 75 80
Gly Thr Thr Glu Ile Lys Ile Ala Ile Ala Gly Asp Pro Lys Ile Val
85 90 95
Glu Thr Asn Lys Leu Ile Gln Tyr Tyr Asp Met Val Val Asp Phe Thr
100 105 110
Ser Lys Ala Leu Asp Ile Val Lys Asn Lys Gly Tyr Ser Ile Lys Asn
115 120 125
Met Leu Glu Ile Arg Lys Leu Glu Ser Gly Ala
130 135

Claims (4)

1. A kit for detecting neisseria gonorrhoeae for non-disease diagnostic purposes, comprising a nucleic acid extraction reagent, a isothermal amplification reaction module, a positive control, and a negative control;
the isothermal amplification reaction module is a freeze-dried powder reagent of RDA isothermal amplification reaction mixed reagent;
the freeze-dried powder reagent of the RDA isothermal amplification reaction mixed reagent comprises recombinase KX 60-600 ng/mu L, KY protein 16-192 ng/mu L, single-stranded binding protein gp32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, tris buffer 20-100mM, PEG 2.5-10%, potassium acetate or sodium acetate 0-150mM, dATP 1-5mM, dNTPs 150-600nM, DTT 1-12mM, probe 150nM-600nM and primer pair 150-600nM;
the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2; the nucleotide sequence of the probe is SEQ ID NO.1, the 5 'end of the probe is marked with a luminous group, the 3' end of the probe is marked with a quenching group, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF); the probe with the nucleotide sequence of SEQ ID NO.2 has a luminous group marked by a 30 th base T at the 5 'end, a tetrahydrofuran residue (THF) is substituted for a 32 th base, a quenching group is marked by a 34 th base, and C3-spacer blocking modification is carried out at the 3' end; the nucleotide sequences of the primer pairs are shown as SEQ ID NO.3 and SEQ ID NO. 4; the isothermal amplification reaction module comprises a recombinase KX protein with an amino acid sequence shown as SEQ ID NO.7 and a KY protein with an amino acid sequence shown as SEQ ID NO. 9.
2. The kit of claim 1, wherein the nucleic acid extraction reagent comprises Buffer a and Buffer B; the BufferA is sample lysate and contains a Tris-HCL buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton; the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the positive control is a plasmid containing a neisseria gonorrhoeae target gene, and the negative control is an empty vector pUC57 plasmid.
3. A detection method for detecting neisseria gonorrhoeae for the purpose of non-disease diagnosis based on the kit of claim 2, characterized by comprising the steps of:
extracting nucleic acid of a sample to be detected, carrying out real-time fluorescence RDA reaction by taking the nucleic acid of the sample to be detected as a template in the presence of RDA freeze-dried powder reagent, buffer A and Buffer B comprising a primer pair and a probe of the neisseria gonorrhoeae, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2; wherein the reaction temperature is 25-42 ℃ and the reaction time is more than 10 minutes.
4. The method according to claim 3, wherein the reaction temperature is 39℃and the reaction time is 30 minutes.
CN202010081197.1A 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae Active CN112301105B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010081197.1A CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010081197.1A CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Publications (2)

Publication Number Publication Date
CN112301105A CN112301105A (en) 2021-02-02
CN112301105B true CN112301105B (en) 2024-01-02

Family

ID=74336740

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010081197.1A Active CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Country Status (1)

Country Link
CN (1) CN112301105B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102666872A (en) * 2009-09-25 2012-09-12 艾利尔圣迭戈公司 Detection of nucleic acids in crude matrices
WO2017103269A1 (en) * 2015-12-18 2017-06-22 Selfdiagnostics Deutschland Gmbh Method for the detection of a sexually transmitted infectious pathogen
CN109486973A (en) * 2018-12-13 2019-03-19 中国医学科学院病原生物学研究所 A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique
CN110317861A (en) * 2019-07-18 2019-10-11 江苏宏微特斯医药科技有限公司 A kind of kit detecting pathogen
CN209974796U (en) * 2019-12-16 2020-01-21 广州普世利华科技有限公司 Quick detection device

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102666872A (en) * 2009-09-25 2012-09-12 艾利尔圣迭戈公司 Detection of nucleic acids in crude matrices
WO2017103269A1 (en) * 2015-12-18 2017-06-22 Selfdiagnostics Deutschland Gmbh Method for the detection of a sexually transmitted infectious pathogen
CN109486973A (en) * 2018-12-13 2019-03-19 中国医学科学院病原生物学研究所 A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique
CN110317861A (en) * 2019-07-18 2019-10-11 江苏宏微特斯医药科技有限公司 A kind of kit detecting pathogen
CN209974796U (en) * 2019-12-16 2020-01-21 广州普世利华科技有限公司 Quick detection device

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens;Sebastian Kersting 等;Microchim Acta;第181卷;摘要，表1,第1718-1722页 *
Nucleic Acid Amplification Testing for Neisseria gonorrhoeae An Ongoing Challenge;David M. Whiley 等;Journal of Molecular Diagnostics;第8卷(第1期);全文 *
重组酶聚合酶扩增技术的研究进展;孙魁 等;军事医学;第39卷(第10期);第803页3.1 *

Also Published As

Publication number Publication date
CN112301105A (en) 2021-02-02

Similar Documents

Publication Publication Date Title
CN112301154B (en) RDA method and kit for rapidly detecting respiratory syncytial virus
CN111549182B (en) Probe and kit for detecting SARS-CoV-2
CN111057783B (en) Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme constant-temperature rapid amplification technology and application thereof
CN111088404B (en) RDA method and kit for rapidly detecting coxsackievirus A16 and enterovirus 71
CN112301157B (en) RDA method and kit for rapidly detecting cat parvovirus (FPV)
CN111118219B (en) RDA method and kit for rapidly detecting influenza A virus
CN111187855B (en) RDA method and kit for rapidly detecting Feline Herpesvirus (FHV)
CN111154739B (en) Novel recombinase-dependent amplification method and kit
CN111910017A (en) Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application
CN113718045A (en) DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application
CN111286559A (en) Primer, probe and kit for detecting African swine fever virus
CN112301152B (en) Multiplex fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus
CN112301159B (en) RDA method and kit for rapidly detecting influenza B virus
CN112301156B (en) RDA method and kit for rapidly detecting human adenovirus
CN112301153B (en) RDA method and kit for rapidly detecting Canine Coronavirus (CCV)
CN112301158B (en) RDA method and kit for rapidly detecting Classical Swine Fever Virus (CSFV)
CN112301105B (en) RDA method and kit for rapidly detecting neisseria gonorrhoeae
CN112301104B (en) RDA method and kit for rapidly detecting chlamydia trachomatis
CN112301137B (en) RDA method and kit for rapidly detecting ureaplasma urealyticum
CN112301155B (en) RDA method and kit for rapidly detecting rotavirus
CN112301151B (en) RDA method and kit for rapidly detecting Canine Distemper Virus (CDV)
CN116254352A (en) CRISPR-based method and kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae
CN116287478B (en) Primer probe composition and kit for detecting multiple respiratory pathogens
CN114480684A (en) Mycoplasma hyopneumoniae nfo-RPA detection kit and preparation method thereof
CN111893197A (en) Multiplex fluorescence PCR kit and method for detecting common respiratory bacteria

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant