CN109486973A - A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique - Google Patents
A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique Download PDFInfo
- Publication number
- CN109486973A CN109486973A CN201811523814.8A CN201811523814A CN109486973A CN 109486973 A CN109486973 A CN 109486973A CN 201811523814 A CN201811523814 A CN 201811523814A CN 109486973 A CN109486973 A CN 109486973A
- Authority
- CN
- China
- Prior art keywords
- reaction
- sample
- neisseria gonorrhoeae
- primer
- rpa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biological detection, are related to a kind of detection method of pathogenic microorganism, in particular to a kind of method for visualizing that NEISSERIA GONORRHOEAE is quickly detected with recombinase polymerase isothermal amplification technique.This method is developed the color using recombinase polymerase isothermal amplification technique binding fluorescent dyes, and the rapid amplifying of Neisseria gonorrhea nucleic acid can be realized without using heat circulating equipments such as PCR instruments, observes by the naked eye the variation qualification result of reaction system color.Related reagent provided by the invention can quickly detect the NEISSERIA GONORRHOEAE in sample by the simple process to sample to be tested, have many advantages, such as easy to operate, high specificity, can determine that result by naked eyes, be suitable for clinical diagnosis and personal early screening.
Description
Technical field
The invention belongs to technical field of molecular biological detection, are related to a kind of detection method of pathogenic microorganism, especially relate to
And a kind of method for visualizing that NEISSERIA GONORRHOEAE is quickly detected with recombinase polymerase isothermal amplification technique.It can be used for clinical diagnosis
With personal early screening etc..
Background technique
Stranguria syndrome is to report that case load occupies the 5th Common STD, the whole nation in 2017 in China's Class A and B infectious diseases
Stranguria syndrome reported cases number be more than 130,000.NEISSERIA GONORRHOEAE (Neisseria gonorrhoeae, NG) is the cause of disease of stranguria syndrome
Bacterium, stranguria syndrome does not have effective vaccine at present, it has also become important global public health problem.As at the beginning of infection due to Neisseria gonorrhoeae
Phase, caused symptom are not obvious, if obtaining timely diagnosis and treatment will lead to serious disease of the genitourinary system, therefore timely
The infection for diagnosing gonococcus has important meaning for epidemic situation control, epidemiological surveillance and the disease treatment of infectious disease.
Traditional method for cultivation of bacteria is still the goldstandard of NEISSERIA GONORRHOEAE clinical detection, but this method operation difficulty
Greatly, time-consuming, and haves the shortcomings that recall rate is low, is easy to cause and fails to pinpoint a disease in diagnosis and mistaken diagnosis.In addition, with NEISSERIA GONORRHOEAE drug resistance
Property rise year by year, but also NEISSERIA GONORRHOEAE culture is increasingly difficult.In past 20 years, Molecular Detection has been widely used
In the detection of NEISSERIA GONORRHOEAE.It is compared with the traditional method, molecular detection technology is quicker, sensitive and accurate.Currently, on the market
Also there are many commercial reagents box or system based on nucleic acid amplification, the detection for NEISSERIA GONORRHOEAE.But these platforms are still deposited
It is higher in many defects, such as testing cost, need to need to have received using specific special instrument the professional people of professional training
Member operates, and needs to complete detection in the laboratory of profession.
Recombinase polymeric enzymatic amplification (Recombinase polymerase amplification, RPA) is that this year is next emerging
A kind of isothermal amplification risen, the nucleic acid detection technique of PCR can be substituted by being known as, and since the advent of the world has succeeded
Applied to multiple fields such as medical diagnosis, bio-safety, food safety and agriculture detection GMOs.RPA technology is with T4 phagocytosis
Body nucleic acid replication mechanism is principle, utilizes the specific bond of the cooperative achievement primer and template of recombinase and single strand binding protein.
Under constant temperature conditions, recombinase and single-stranded nucleotide (primer) combine, and form the complex of enzyme and primer, and enzymatic positions primer
Onto the homologous target sequence of DNA double chain template, and under the assistance of single-stranded DNA binding protein, unwinding template DNA, then in DNA
The synthetic reaction for starting DNA under the action of polymerase, loops back and forth like this, and target sequence forms exponential amplification.
RPA technology is as a kind of new isothermal amplification technology, although having short reaction time, high sensitivity, easy to operate
Etc. unique superiority, but there are some defects and deficiency, the most important context of detection shown for product.RPA is produced
Object carry out agarose gel electrophoresis detection when, need to carry out product purification because the components such as reaction system buffer will affect it is solidifying
The judgement of glue imaging results；The real time fluorescent quantitative RPA technology detected using exo probe, amplified reaction and result interpretation
It needs to increase testing cost using fluorescence detecting system；And the Sidestream chromatography RPA detection skill detected in conjunction with nfo probe
Art, RPA amplified production need to dilute, and otherwise reaction substrate can interfere the antibody on test paper, are easy in the detection process
Aerosol Pollution is generated, false positive results are caused.
Summary of the invention
The object of the present invention is to provide the RPA for quickly detecting NEISSERIA GONORRHOEAE of a species specificity and high sensitivity to examine
Survey primer special.
RPA provided by the present invention for quickly detecting NEISSERIA GONORRHOEAE detects primer special, is that selection inter-species is special
And the target gene of gene conservative in planting as detection.First from GenBank database (https: //
Www.ncbi.nlm.nih.gov/genbank/ generation of each NEISSERIA GONORRHOEAE of downloading by complete annotation as reference sequences in)
Table pnca gene sequence, by the nr database of reference sequences and NCBI carry out nucleic acid sequence BLAST (https: //
Blast.ncbi.nlm.nih.gov/Blast.cgi), downloading compares obtaining as a result, obtaining more detection target-gene sequences.
Multiple Sequence Alignment is carried out using the Pairwise/Multiple Align program that Geneious R10 software carries, determines stranguria syndrome
The conservative region of Neisseria target gene.According to the conserved sequence of selected target gene, designed for quickly detection stranguria syndrome Neisser
The RPA of bacterium detects primer special.
NEISSERIA GONORRHOEAE RPA, which is quickly detected, uses primer, which is a set of NEISSERIA GONORRHOEAE characteristic primer sets, shares two
Primer sets are covered, wherein a set of primer sets are made of two primers, one is forward primer, and one is reverse primer；Two sets of primers
Group is respectively (1) primer sets one as shown in SEQ ID NO.1 and SEQ ID NO.2, or (2) such as SEQ ID NO.3 and SEQ
Primer sets two shown in ID NO.4.
This two sets of primer sets can effectively expand the target fragment on NEISSERIA GONORRHOEAE, and sequence is respectively as follows:
Primer sets one:
SEQ ID NO.1:CCGGAACTGGTTTCATCTGATTACTTTCCAGCGT (forward primer)
SEQ ID NO.2:CAGCAAAGCCATTGATCCTTGGGACAGCAATAA (reverse primer)
Primer sets two:
SEQ ID NO.3:CCGGAACTGGTTTCATCTGATTACTTTCCAGCG (forward primer)
SEQ ID NO.4:GTTGGGGTAACAGGGAATCCTTTATCGGCTTGG (reverse primer)
A second object of the present invention is to provide a kind of methods for detecting NEISSERIA GONORRHOEAE.
Specifically, a kind of recombinase polymerase isothermal amplification technique quickly detects the method for visualizing of NEISSERIA GONORRHOEAE.
Recombinase polymerase isothermal amplification technique provided by the present invention quickly detects the method for visualizing of NEISSERIA GONORRHOEAE,
The following steps are included:
1, the rapidly extracting that reagent completes sample genomic dna is slightly proposed using sample；
2, it using the genomic DNA of sample to be tested as template, is carried out under the guidance of above-mentioned primer special group by PRA technology
Specific amplification；
3, the interpretation of result is carried out after reaction: saturated fluorescence dyestuff EvaGreen is added in reaction solution, in purple
Under outer lamp, judge that testing result, green indicate there is special nucleic acid sequence, i.e. sample in reaction according to the color change of reaction solution
In there are NEISSERIA GONORRHOEAE, interpretation is the positive；Without special nucleic acid sequence in colourless expression reaction, i.e., stranguria syndrome is not present in sample
Neisseria, interpretation are feminine gender.
In the method for visualizing of above-mentioned quick detection NEISSERIA GONORRHOEAE, reagent Lysis is slightly mentioned in the step 1
Buffer is that 100ml TE buffer (Tris 10mM, EDTA are dissolved in by 5.0g Chelex-100 and 1.0ml TritonX-100
1mM) it is formulated；Sample to be tested in the step 1 includes secretion or urine；Sample genomic dna in the step 1
Rapid extracting method includes: to be added slightly to mention reagent Lysis buffer and be diluted sample into sample to be tested, is mixed, room temperature
1min is placed, (preferred 100 DEG C) heating 10min complete sample genomic dna 95-100 DEG C in metal bath or water-bath
It extracts.
RPA reaction system total volume in the step 2 is 27 μ l, and concentration is the forward and reverse primer each 1.5 of 10 μm of ol/L
14.75 μ l of μ l, RPA reaction buffer, sample genomic dna 2 μ l, fluorescent dye EvaGreen 2 μ l, MgOAc (magnesium acetate)
1.25 μ l, ddH2O complements to 27 μ l.
RPA amplified reaction program in the step 2 are as follows: 37-39 DEG C of constant temperature, 15-20min in metal bath or water-bath.
Preferably, the RPA amplified reaction program in the step 2 are as follows: after 37 DEG C of isothermal reaction 5min, take out, run up and down
It mixes for several times, then isothermal reaction 10min.
After reaction, reaction tube is placed under ultraviolet lamp, testing result is judged according to the color change of reaction solution, green
Indicate that anti-sample to be tested NEISSERIA GONORRHOEAE is positive；Colourless expression sample to be tested NEISSERIA GONORRHOEAE is negative.
Third object of the present invention is to provide a kind of kits for detecting NEISSERIA GONORRHOEAE.
It include above-mentioned any primer sets in kit of the present invention.
Specifically, kit of the present invention, including any primer sets, sampling pipe, reagent Lysis buffer is slightly mentioned,
Reactive component, positive control and negative control, wherein the positive control is the genomic DNA of NEISSERIA GONORRHOEAE, the feminine gender
Control is ddH2O。
Preferably, kit of the present invention include: specimen collection tube, slightly mention reagent Lysis buffer, concentration is
Forward and reverse primer, RPA reaction buffer, fluorescent dye EvaGreen, MgOAc, positive control and the feminine gender of 10 μm of ol/L
Control.
It is another object of the present invention to provide any primer sets of the present invention in the kit of detection NEISSERIA GONORRHOEAE
Application.
It is described it is another object of the present invention to provide application of the kit of the present invention in detection NEISSERIA GONORRHOEAE
Using the following steps are included:
1, the rapidly extracting that reagent completes sample genomic dna is slightly proposed using sample；
2, it using the genomic DNA of sample to be tested as template, is carried out under the guidance of above-mentioned primer special group by PRA technology
Specific amplification；
3, the interpretation of result is carried out after reaction: saturated fluorescence dyestuff EvaGreen is added in reaction solution, in purple
Under outer lamp, judge that testing result, green indicate there is special nucleic acid sequence, i.e. sample in reaction according to the color change of reaction solution
In there are NEISSERIA GONORRHOEAE, interpretation is the positive；Without special nucleic acid sequence in colourless expression reaction, i.e., stranguria syndrome is not present in sample
Neisseria, interpretation are feminine gender.
Preferably, the application the following steps are included:
1) patient's secretion or urine specimen are collected；
2) for urine specimen, after 8,000rpm are centrifuged 10min, supernatant is abandoned, is added into specimen collection tube and slightly mentions in right amount
Reagent Lysis buffer；For the swab sample of secretion, it is added into specimen collection tube and slightly mentions reagent Lysis in right amount
Buffer, stirring, is immersed in 5min in Lysis buffer for swab；
3) specimen collection tube is placed in metal bath or water-bath, 95 DEG C of heating 10min are stored at room temperature, and complete sample base
Because of the extraction of group DNA；
4) sample genomic dna is obtained as template using above-mentioned steps, carry out under any a set of guidance of two sets of primer sets
RPA amplified reaction, wherein the reaction system of 27 μ l includes: forward and reverse primer each 1.5 μ l, the RPA reaction that concentration is 10 μm of ol/L
14.75 μ l of buffer, sample genomic dna 2 μ l, fluorescent dye EvaGreen 2 μ l, MgOAc1.25 μ l, ddH2O is complemented to
27 μ l detect reaction while primer positive control and negative control reaction tube every time；
5) reaction tube is placed in metal bath or water-bath, after 37 DEG C of isothermal reaction 5min, takes out, turn upside down and mix number
It is secondary, then isothermal reaction 10min；
6) interpretation of result is carried out after reaction, in the UV lamp, detection knot is judged according to the color change of reaction solution
Fruit, green indicate there is special nucleic acid sequence in reaction, i.e., there are NEISSERIA GONORRHOEAE in sample, interpretation is the positive；Colourless expression
Without special nucleic acid sequence in reaction, i.e., NEISSERIA GONORRHOEAE is not present in sample, interpretation is feminine gender.
Method of the invention, it is possible to specifically detect NEISSERIA GONORRHOEAE, and with other pathogens no cross reaction.With it is existing
Other technologies of detection NEISSERIA GONORRHOEAE are compared with similar technique, and technical solution of the present invention has the following advantages: firstly, with traditional
PCR or other molecular detection technologies are compared, and how recombinase polymerase isothermal amplification technique provided by the invention quickly detects stranguria syndrome
The method for visualizing of plucked instrument bacterium can carry out (the also achievable detection reaction of a human temperature) under constant temperature conditions, not need costly
The heat circulating equipments such as PCR instrument, do not limited by lab space；Secondly, detection method provided by the invention is under constant temperature conditions
Realize quick, the special amplification to Neisseria gonorrhea nucleic acid, entire testing process extracts result interpretation energy from sample nucleic acid
It is completed in 30min, there is good operability, far faster than round pcr or other isothermal amplification methods；Finally, sentencing in result
Aspect is read, existing similar RPA detection method uncaps after must amplified production being purified or be expanded and dyestuff is added
Result evaluation is carried out, not only increases laboratory operating procedures, but also different degrees of cross contamination is come to detection product band.The present invention exists
It configures in reaction system, is directly added into the EvaGreen dyestuff small to amplified reaction annoyance level, pass through naked eyes after reaction
The variation qualification result for observing color realizes entire reaction and carries out in sealed tube, avoids false positive results well
Occur.
Detailed description of the invention
Fig. 1 is the visualization result schematic diagram of quick detection NEISSERIA GONORRHOEAE.
Specific embodiment
Embodiment is to be based on being implemented under the premise of the present invention, gives detailed embodiment and specifically operated
Journey.For explaining only the invention, but protection scope of the present invention is unlimited for the specific embodiments described herein and operating process
In following embodiments.Separately below with regard to hospital's clinical diagnosis embodiment and the embodiment and tool of individual patients screening embodiment
Body operating process is described below.
Embodiment 1, hospital clinical diagnosis
1) patient's secretion or urine specimen are collected using the specimen collection tube that kit provides.
2) for urine specimen, after 8,000rpm are centrifuged 10min, supernatant is abandoned, is added into specimen collection tube and slightly mentions in right amount
Reagent Lysis buffer；For the swab sample of secretion, it is added into specimen collection tube and slightly mentions reagent Lysis in right amount
Buffer, stirring, is immersed in 5min in Lysis buffer for swab.
3) specimen collection tube is placed in metal bath or water-bath, 95 DEG C of heating 10min are stored at room temperature, and complete sample base
Because of the extraction of group DNA.(extraction that above step can complete genomic DNA with other nucleic acid extraction kits or method)
4) sample genomic dna is obtained as template using above-mentioned steps, carry out under any a set of guidance of two sets of primer sets
RPA amplified reaction.Wherein the reaction system of 27 μ l includes: forward and reverse primer each 1.5 μ l, the RPA reaction that concentration is 10 μm of ol/L
14.75 μ l of buffer, sample genomic dna 2 μ l, fluorescent dye EvaGreen 2 μ l, MgOAc (magnesium acetate) 1.25 μ l,
ddH2O complements to 27 μ l.It is each to detect reaction while primer positive control and negative control reaction tube.
5) reaction tube is placed in metal bath or water-bath, after 37 DEG C of isothermal reaction 5min, takes out, turn upside down and mix number
It is secondary, then isothermal reaction 10min.
6) interpretation of result is carried out after reaction, in the UV lamp, detection knot is judged according to the color change of reaction solution
Fruit, green indicate there is special nucleic acid sequence in reaction, i.e., there are NEISSERIA GONORRHOEAE in sample, interpretation is the positive；Colourless expression
Without special nucleic acid sequence in reaction, i.e., NEISSERIA GONORRHOEAE is not present in sample, interpretation is feminine gender.
Embodiment 2, individual patients screening embodiment:
1) patient's secretion or urine specimen are collected using the specimen collection tube that kit provides.
2) it for urine specimen, is added into specimen collection tube and slightly mentions reagent Lysis buffer with urine equivalent；For
The swab sample of secretion is added into specimen collection tube and slightly mentions reagent Lysis buffer in right amount, stirs, swab is immersed in
5min in Lysis buffer.
3) specimen collection tube is placed in boiling water bath, heats 10min, is stored at room temperature, completes mentioning for sample genomic dna
It takes.
4) sample genomic dna is obtained as template using above-mentioned steps, carry out under any a set of guidance of two sets of primer sets
RPA amplified reaction.Wherein the reaction system of 27 μ l includes: forward and reverse primer each 1.5 μ l, the RPA reaction that concentration is 10 μm of ol/L
14.75 μ l of buffer, sample genomic dna 2 μ l, fluorescent dye EvaGreen 2 μ l, MgOAc (magnesium acetate) 1.25 μ l,
ddH2O complements to 27 μ l.It is each to detect reaction while primer positive control and negative control reaction tube.
5) reaction tube is held in hand, after body temperature isothermal reaction 5min, turns upside down mixing for several times, then constant temperature
React 10min.
6) interpretation for carrying out result after reaction, under the light of ultraviolet flashlight, according to the color change of reaction solution
Judge that testing result, green indicate there is special nucleic acid sequence in reaction, i.e., there are NEISSERIA GONORRHOEAE in sample, interpretation is sun
Property；Without special nucleic acid sequence in colourless expression reaction, i.e., NEISSERIA GONORRHOEAE is not present in sample, interpretation is feminine gender.
Sequence table
<110>Institute of Pathogen Biology, Chinese Academy of Medical Sciences
<120>a kind of method for visualizing that NEISSERIA GONORRHOEAE is quickly detected using recombinase polymerase isothermal amplification technique
<130>
<160> 4
<210> 1
<211> 34
<212> DNA
<213>NEISSERIA GONORRHOEAE (Neisseria Gonorrhoeae)
<400> 1
ccggaactgg tttcatctga ttactttcca gcgt
<210> 2
<211> 33
<212> DNA
<213>NEISSERIA GONORRHOEAE (Neisseria Gonorrhoeae)
<400> 2
cagcaaagcc attgatcctt gggacagcaa taa
<210> 3
<211> 33
<212> DNA
<213>NEISSERIA GONORRHOEAE (Neisseria Gonorrhoeae)
<400> 3
ccggaactgg tttcatctga ttactttcca gcg
<210> 4
<211> 33
<212> DNA
<213>NEISSERIA GONORRHOEAE (Neisseria Gonorrhoeae)
<400> 4
gttggggtaa cagggaatcc tttatcggct tgg
Claims (10)
1. the primer for detecting NEISSERIA GONORRHOEAE, which is a set of NEISSERIA GONORRHOEAE characteristic primer sets, shares two sets and draws
Object group, wherein a set of primer sets are made of two primers, one is forward primer, and one is reverse primer；Two sets of primer components
Not Wei (1) primer sets as shown in SEQ ID NO.1 and SEQ ID NO.2, or (2) such as SEQ ID NO.3 and SEQ ID NO.4
Shown primer sets.
2. application of any primer sets described in claim 1 in the kit of detection NEISSERIA GONORRHOEAE.
3. a kind of kit for detecting NEISSERIA GONORRHOEAE, which is characterized in that include described in claim 1 in the kit
One primer sets.
4. kit according to claim 3, which is characterized in that including any primer sets described in claim 1, sampling
Pipe, slightly mention reagent Lysis buffer, reactive component, positive control and negative control, wherein the positive control be stranguria syndrome how
The genomic DNA of plucked instrument bacterium, the negative control are ddH2O。
5. kit according to claim 3, which is characterized in that including specimen collection tube, slightly mention reagent Lysis
Buffer, forward and reverse primer, RPA reaction buffer, the fluorescent dye EvaGreen, MgOAc, sun that concentration is 10 μm of ol/L
Property control and negative control.
6. a kind of method for detecting NEISSERIA GONORRHOEAE, comprising the following steps:
1) rapidly extracting that reagent completes sample genomic dna is slightly proposed using sample；
2) it using the genomic DNA of sample to be tested as template, is carried out specifically under the guidance of above-mentioned primer special group by PRA technology
Property amplification；
3) interpretation of result is carried out after reaction: saturated fluorescence dyestuff EvaGreen is added in reaction solution, in ultraviolet lamp
Under, judge that testing result, green indicate there is special nucleic acid sequence in reaction, i.e., deposit in sample according to the color change of reaction solution
In NEISSERIA GONORRHOEAE, interpretation is the positive；Without special nucleic acid sequence in colourless expression reaction, i.e., stranguria syndrome Neisser is not present in sample
Bacterium, interpretation are feminine gender.
7. according to the method described in claim 6, it is characterized in that, in step 1 slightly mention reagent Lysis buffer be by
5.0g Chelex-100 and 1.0ml TritonX-100 are dissolved in 100ml TE buffer (Tris 10mM, EDTA 1mM) preparation
It forms；Sample to be tested in the step 1 includes secretion or urine；The rapidly extracting of sample genomic dna in the step 1
Method includes: to be added slightly to mention reagent Lysis buffer and be diluted sample into sample to be tested, mixes, is placed at room temperature for
1min, (preferred 100 DEG C) heating 10min complete the extraction of sample genomic dna 95-100 DEG C in metal bath or water-bath.
8. dense according to the method described in claim 6, it is characterized in that, RPA reaction system total volume in step 2 is 27 μ l
Degree is forward and reverse primer each 14.75 μ l of 1.5 μ l, RPA reaction buffer of 10 μm of ol/L, 2 μ l of sample genomic dna, fluorescence
Dyestuff EvaGreen 2 μ l, MgOAc (magnesium acetate) 1.25 μ l, ddH2O complements to 27 μ l；
RPA amplified reaction program in the step 2 are as follows: 37-39 DEG C of constant temperature, 15-20min in metal bath or water-bath.
9. according to the method described in claim 6, it is characterized in that, RPA amplified reaction program in step 2 are as follows: 37 DEG C of constant temperature
It after reacting 5min, takes out, turns upside down mixing for several times, then isothermal reaction 10min.
10. according to the method described in claim 6, characterized by comprising the following steps:
1) patient's secretion or urine specimen are collected；
2) for urine specimen, after 8,000rpm are centrifuged 10min, supernatant is abandoned, is added into specimen collection tube and slightly mentions reagent in right amount
Lysis buffer；For the swab sample of secretion, it is added into specimen collection tube and slightly mentions reagent Lysis buffer in right amount,
Stirring, is immersed in 5min in Lysis buffer for swab；
3) specimen collection tube is placed in metal bath or water-bath, 95 DEG C of heating 10min are stored at room temperature, and complete sample genome
The extraction of DNA；
4) sample genomic dna is obtained as template using above-mentioned steps, RPA expansion is carried out under any a set of guidance of two sets of primer sets
Increase reaction, wherein the reaction system of 27 μ l includes: forward and reverse primer each 1.5 μ l, RPA the reaction buffering that concentration is 10 μm of ol/L
14.75 μ l of liquid, sample genomic dna 2 μ l, fluorescent dye EvaGreen 2 μ l, MgOAc1.25 μ l, ddH2O complements to 27 μ l,
It is each to detect reaction while primer positive control and negative control reaction tube；
5) reaction tube is placed in metal bath or water-bath, after 37 DEG C of isothermal reaction 5min, is taken out, turn upside down mixing for several times, then
Isothermal reaction 10min；
6) interpretation for carrying out result after reaction judges testing result according to the color change of reaction solution in the UV lamp, green
Color table, which shows in reaction, special nucleic acid sequence, i.e., there are NEISSERIA GONORRHOEAE in sample, interpretation is the positive；In colourless expression reaction
Without special nucleic acid sequence, i.e., NEISSERIA GONORRHOEAE is not present in sample, interpretation is feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811523814.8A CN109486973A (en) | 2018-12-13 | 2018-12-13 | A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811523814.8A CN109486973A (en) | 2018-12-13 | 2018-12-13 | A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109486973A true CN109486973A (en) | 2019-03-19 |
Family
ID=65710067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811523814.8A Pending CN109486973A (en) | 2018-12-13 | 2018-12-13 | A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486973A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334594A (en) * | 2020-04-03 | 2020-06-26 | 青岛科技大学 | Visual detection platform of nucleic acid amplification paper base |
| CN112301105A (en) * | 2020-02-06 | 2021-02-02 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting neisseria gonorrhoeae |
| CN112725476A (en) * | 2021-01-07 | 2021-04-30 | 武汉艾迪康医学检验所有限公司 | Primer and kit for detecting N gonorrhoeae |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016042333A1 (en) * | 2014-09-17 | 2016-03-24 | Atlas Genetics Limited | Detection method for neisseria gonorrhoeae |
| CN108315450A (en) * | 2018-03-20 | 2018-07-24 | 石河子大学 | The quickly primer of the close chlamydiosis of detection miscarriage and the kit constituted |
| CN108359717A (en) * | 2018-05-11 | 2018-08-03 | 上海市农业科学院 | A kind of direct expansion RPA visualization of presence detection methods |
| CN108841996A (en) * | 2018-04-19 | 2018-11-20 | 华南农业大学 | Newcastle disease novel visual recombinase polymerase room temperature amplification of nucleic acid test strips detection kit and application |
-
2018
- 2018-12-13 CN CN201811523814.8A patent/CN109486973A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016042333A1 (en) * | 2014-09-17 | 2016-03-24 | Atlas Genetics Limited | Detection method for neisseria gonorrhoeae |
| CN108315450A (en) * | 2018-03-20 | 2018-07-24 | 石河子大学 | The quickly primer of the close chlamydiosis of detection miscarriage and the kit constituted |
| CN108841996A (en) * | 2018-04-19 | 2018-11-20 | 华南农业大学 | Newcastle disease novel visual recombinase polymerase room temperature amplification of nucleic acid test strips detection kit and application |
| CN108359717A (en) * | 2018-05-11 | 2018-08-03 | 上海市农业科学院 | A kind of direct expansion RPA visualization of presence detection methods |
Non-Patent Citations (1)
| Title |
|---|
| SEBASTIAN KERSTING ET AL: "Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens", 《MICROCHIM ACTA》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112301105A (en) * | 2020-02-06 | 2021-02-02 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting neisseria gonorrhoeae |
| CN112301105B (en) * | 2020-02-06 | 2024-01-02 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting neisseria gonorrhoeae |
| CN111334594A (en) * | 2020-04-03 | 2020-06-26 | 青岛科技大学 | Visual detection platform of nucleic acid amplification paper base |
| CN111334594B (en) * | 2020-04-03 | 2021-06-22 | 青岛科技大学 | Non-diagnosis-purpose nucleic acid amplification paper-based visual detection method |
| CN112725476A (en) * | 2021-01-07 | 2021-04-30 | 武汉艾迪康医学检验所有限公司 | Primer and kit for detecting N gonorrhoeae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Go et al. | Evaluation and clinical validation of two field–deployable reverse transcription-insulated isothermal pcr assays for the detection of the middle east respiratory syndrome–coronavirus | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| CN109486973A (en) | A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN109055502A (en) | A kind of detection method of invasive infections with fungi, detection kit and application | |
| CN110453012B (en) | Universal primer, probe and detection method for detecting 24 genotypes of African swine fever virus by using RAA fluorescence method | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| CN108841996A (en) | Newcastle disease novel visual recombinase polymerase room temperature amplification of nucleic acid test strips detection kit and application | |
| CN106434996A (en) | Kit and method for detecting Acinetobacter baumannii DNA | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| CN103725798A (en) | Primer, kit and detection method of detecting haemorrhagic fever with renal syndrome virus by RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) method | |
| CN113416799A (en) | CDA primer group and kit for detecting African swine fever virus and application of CDA primer group and kit | |
| CN105734158A (en) | Fluorescent PCR (polymerase chain reaction) detection kit for babesia caballi disease | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
| Sun et al. | Rapid and sensitive detection of hepatitis C virus in clinical blood samples using reverse transcriptase polymerase spiral reaction | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| CN105543350B (en) | A kind of the LAMP detection primer group and detection method of gnathostoma siamense | |
| CN109971886A (en) | A kind of kit for detecting CPV nucleic acid, RPA primer pair, probe and method | |
| CN106939359A (en) | A kind of LAMP methods detect the primer sets and detection architecture of the common hypotypes of HPV | |
| CN105543346B (en) | A kind of Richettsia multiple fluorescence PCR detection method | |
| CN114540526A (en) | Primer, probe and method for typing detection of five input plasmodium | |
| CN106011314B (en) | It is a kind of for detecting LAMP primer group, kit and the detection method of pig parvoviral | |
| Peeridogaheh et al. | Evaluation of three DNA extraction methods for detection of brucella DNA in human serum samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190319 |
|
| RJ01 | Rejection of invention patent application after publication |