CN103937884A - Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit - Google Patents
Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit Download PDFInfo
- Publication number
- CN103937884A CN103937884A CN201410123428.5A CN201410123428A CN103937884A CN 103937884 A CN103937884 A CN 103937884A CN 201410123428 A CN201410123428 A CN 201410123428A CN 103937884 A CN103937884 A CN 103937884A
- Authority
- CN
- China
- Prior art keywords
- mycobacterium tuberculosis
- isothermal amplification
- mediated isothermal
- loop
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses a high-sensitivity, high-specificity loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and an application method of the kit. The kit is composed of a loop-mediated isothermal amplification reaction premixed solution, a positive quality control material and a negative quality control material. A group of primers is composed of an F3 outer primer of which the sequence is CGTGAGGGCATCGAGGT, a B3 outer primer of which the sequence is ACACATAGGTGAGGTCTGCT, an FIP inner primer of which the sequence is CGTGGTCCTGCGGGCTTTG-GCCAGATGCACCGTCG and a BIP inner primer of which the sequence is ATCGCTGATCCGGCCACAG-CCCACAGCCGGTTAGGT. The application method of the kit is characterized in that real-time fluorescence rapid detection of the mycobacterium tuberculosis can be realized at the molecular level by use of a loop-mediated isothermal amplification detection system.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a set of loop-mediated isothermal amplification (LAMP) primer group, test kit and using method thereof for detection of mycobacterium tuberculosis, belong to mycobacterium tuberculosis detection field.
Background technology
Tuberculosis (Tuberculosis) is a kind of chronic respiratory transmissible disease of serious harm human health, and its pathogenic agent is mycobacterium tuberculosis (Mycobacterium tuberculosis).Estimate that according to WHO the whole world approximately has 2,000,000,000 people to infect, wherein 5%～10% can develop into active tuberculosis, annual new case reaches 800～1,0,000,000, approximately 3,000,000 people's death.Although the eighties in 20th century tuberculosis rate decrease, start again in recent years resume combustion, global epidemic situation is in rising trend, and due to the appearance of resistance and multi-drug resistant bacterial strain, has formed serious health threat in some country.The delay of diagnostic result, had both postponed the antituberculosis therapy time, had extended again infection infective stage.Therefore, in the urgent need to quick, special, responsive mycobacterium tuberculosis laboratory detection method, to control its propagation.
At present, the laboratory detection method of mycobacterium tuberculosis mainly contain direct smear culture method, smear for microscopic examination method, serological method, taking polymerase chain reaction (PCR) technology as basic molecular biology method etc.Wherein, tubercule bacillus is cultivated and is considered to the gold standard that mycobacterium tuberculosis detects, and the length but it expends time in, needs 6-8 time-of-week, and needs a certain amount of bacterial concentration just can detect positive findings, and application is restricted; Smear for microscopic examination is easy and simple to handle, and expense is cheap, but positive rate is subject to the impact of the factor such as specimen quality, treatment process, but is only characterized as foundation with resistance to acid, therefore should not serve as the foundation of mycobacterium tuberculosis species specificity qualification; Serological method is with low cost, but requires the monoclonal antibody of high quality high stability, otherwise can cause accuracy inadequate, therefore can only serve as auxiliary detection means; Polymerase chain reaction (PCR) technology because of its sensitivity and specificity better, successfully for the detection of clinical samples, but the heat circulating equipment that round pcr needs is expensive, and be prone to false negative, false positive, the problems such as crossed contamination, make its application have certain limitation.
Japanese scholars doctor Notomi has invented a kind of brand-new nucleic acid amplification technologies in 2000---ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology, be characterized in 4 special primers of 6 zone design for target gene, utilize a kind of strand displacement archaeal dna polymerase (Bst DNA polymerase) in isothermal condition (65 DEG C of left and right) insulation dozens of minutes simultaneously, can complete nucleic acid amplification reaction.The method amplification efficiency is high, does not need the thermally denature of template, long-time temperature cycle, the loaded down with trivial details process such as electrophoresis, ultraviolet visualization.The appearance of this technology has solved many difficult problems of the molecular Biological Detection technology based on nucleic acid, makes it become possibility as fast diagnosis method.The method adds fluorescent indicator in amplified reaction forward direction system, can be directly by naked-eye observation result, there is the advantages such as quick, easy, high specific, high sensitivity, be particularly suitable for field quick detection, be widely used in the detection of the microorganisms such as bacterium, virus and parasite.But setting up sensitive, the special loop-mediated isothermal amplification detection method of tuberculosis branch bar needs first for its distinctive insertion sequence IS6110 design Auele Specific Primer.
Summary of the invention
Main purpose of the present invention is to provide a set of for mycobacterium tuberculosis ring mediated isothermal amplification detection primer sets, design primer with the specificity insertion sequence IS6110 that extensively exists in mycobacterium tuberculosis chromogene group for target sequence, every group of primer comprises a pair of outer primer and a pair of inner primer.Each primer in primer sets can be mixed with primer sets solution by a certain percentage, for the preparation of mycobacterium tuberculosis quick detection kit, wherein the concentration ratio of inner primer and outer primer determines that method is, be 2 by the concentration ratio of inner primer and outer primer respectively: 1-12: 1 preparation primer sets solution, form ring mediated isothermal amplification detection reaction system, use ring mediated isothermal amplification detection system to realize the fluorescent signal in isothermal duplication Real-Time Monitoring reaction tubes, in 30min, can obtain isothermal duplication curve, according to the best proportion that obtains the definite inside and outside primer pair concentration of the time of fluorescent signal and the usage quantity of sample to be measured, preferred proportion is 8: 1.
Another object of the present invention is to provide a kind of mycobacterium tuberculosis loop-mediated isothermal amplification detection kit, mainly formed by mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer group solution, loop-mediated isothermal amplification premixed liquid, positive quality control product and negative quality control product, it is characterized in that, the rapid detection of mycobacterium tuberculosis can be realized, mycobacterium tuberculosis and non-tuberculous mycobacteria can be differentiated.This test kit is suitable for sample type sputum, inoculum, serum etc.
Described loop-mediated isothermal amplification premixed liquid can be to make amplified production send a kind of commercial kit Isothermal Master mix of fluorescent signal or other test kits of equivalence, by Bst polysaccharase, dNTP, trimethyl-glycine, MgSO
4form with buffered soln.In test kit, also introduce one group of positive quality control product and negative quality control product simultaneously, positive quality control product is the recombinant plasmid being built by mycobacterium tuberculosis IS6110 fragment synthetic, its concentration is 1ng/ μ L, and negative quality control product is not containing the genomic medium solution of mycobacterium tuberculosis IS6110.
The present invention also provides a kind of using method for mycobacterium tuberculosis loop-mediated isothermal amplification detection kit, it is characterized in that, each reaction tubes is done as a whole, add mycobacterium tuberculosis loop-mediated isothermal amplification system, use ring mediated isothermal amplification detection system to realize the fluorescent signal in synchronous isothermal duplication Real-Time Monitoring reaction tubes, obtain isothermal duplication curve and solubility curve.
The cumulative volume of described mycobacterium tuberculosis loop-mediated isothermal amplification system is 25 μ L, comprising loop-mediated isothermal amplification (LAMP) primer group solution 4 μ L, loop-mediated isothermal amplification premixed liquid 15 μ L, the each 5 μ L of sample to be tested or positive quality control product or negative quality control product, aseptic deionized water 1 μ L; The amplification program of ring mediated isothermal amplification detection system is: 1. 63～65 DEG C, and 60min, 2. 98 DEG C-80 DEG C, 0.05 DEG C/s, 10min; The analysis of amplification and decision method are:
(1) what the amplification curve platform fluorescent value that ring mediated isothermal amplification detection system records was single sharp peak higher than 5 times of background noise signals and solubility curve is judged to be positive findings, amplification curve platform fluorescent value is lower than the negative findings that is judged to be of 5 times of background noise signals, and amplification curve platform fluorescent value is higher than 5 times of background noise signals but solubility curve is not nonspecific cross interference signal that is judged to be of single sharp peak.
(2) the positive result of positive quality control product reaction tubes, the negative result of negative quality control product reaction tubes be considered as efficiency test, otherwise invalidate the test need re-start.
(3) the negative result of sample to be tested reaction tubes, does not detect mycobacterium tuberculosis; The positive result of sample to be tested reaction tubes is m tuberculosis infection.
A kind of using method for mycobacterium tuberculosis loop-mediated isothermal amplification kit, also comprise the inspection of sensitivity, its method is, by the positive quality control product (1ng/ μ L) of every kind of mycobacterium tuberculosis IS6110 of aseptic deionized water water dilution, concentration gradient is 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L, 1fg/ μ L, carry out sensitivity experiment, by the fluorescent signal in ring mediated isothermal amplification detection system isothermal duplication Real-Time Monitoring reaction tubes, and compare sensitivity with normal PCR method.
Brief description of the drawings
Fig. 1 mycobacterium tuberculosis ring mediated isothermal amplification detection method temperature of reaction optimum result figure.
(a) real-time fluorescence amplification curve, (b) real-time fluorescence solubility curve
The inside and outside primer concentration ratio optimization of Fig. 2 mycobacterium tuberculosis ring mediated isothermal amplification detection method result figure.
Fig. 3 mycobacterium tuberculosis ring mediated isothermal amplification detection method primer specificity experimental result.
(a) real-time fluorescence amplification curve, (b) real-time fluorescence solubility curve
Fig. 4 mycobacterium tuberculosis ring mediated isothermal amplification detection method sensitivity experiments result.
The clinical tuberculosis patient sputum specimen of Fig. 5 DNA circle mediated isothermality amplification detection method experimental result
Reference numeral
In Fig. 1, to be respectively temperature of reaction be the mycobacterium tuberculosis DNA of 60 DEG C～67 DEG C to the 1-8 of a.
Inside and outside 1-6 in Fig. 2 is respectively, primer concentration ratio is the mycobacterium tuberculosis DNA of 2: 1,4: 1,6: 1,8: 1,10: 1,12: 1,7 negative contrast figure.
In Fig. 31 is mycobacterium tuberculosis DNA, and 2-6 is respectively intestinal bacteria, Salmonellas, streptococcus aureus, the red DNA that increases listeria bacteria, Shigellae, 7 negative contrasts.
1-8 in Fig. 4 is the ring mediated isothermal amplification result of mycobacterium tuberculosis DNA profiling concentration while being respectively 1ng, 0.1ng, 10pg, 1pg, 100fg, 10fg, 1ng.
1-7 in Fig. 5 is respectively 7 parts of tubercular's sputum specimen DNA, 8 negative contrasts
Specific implementation method
Below as an example of the specific implementation method of mycobacterium tuberculosis example and by reference to the accompanying drawings, the present invention is further elaborated, advantage and disadvantage of the present invention will be more clear along with description.But these embodiment are only exemplary; scope of the present invention is not formed to any restriction; what those skilled in the art should understand that is; can the details of technical solution of the present invention and form be modified or be replaced lower without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.
Embodiment
1. test materials and method
1.1 test materials
Mycobacterium tuberculosis H37Rv, the DNA extraction thing that is diagnosed as clinically tuberculosis patient sputum specimen provide by Beijing Tuberculosis Control Institute, and 5 kinds of non-tuberculous mycobacterias (intestinal bacteria, Salmonellas, streptococcus aureus, red increase listeria bacteria, Shigellae) are provided by Beijing Administration for Entry-Exit Inspection and Quarantine.
1.2 design of primers
The gene order of downloading and obtain Mycobacterium tuberculosis H37Rv IS6110 from the gene database (http://www.ncbi.nlm.nih.gov/) of U.S. NCBI is as target sequence, use online software PrimerExplorerV4 (http://primerexplorer.jp/e/) design loop-mediated isothermal amplification (LAMP) primer group, comprise a pair of outer primer (F3, B3) and a pair of inner primer (FIP, BIP), its primer sequence is:
The genomic extraction of 1.3 mycobacterium tuberculosis
(1) get inoculum 1-5ml, centrifugal 1 minute of 10,000rpm, supernatant exhausts as far as possible;
(2) add N,O-Diacetylmuramidase, 37 DEG C of broken wall treatment of spending the night;
(3) Xiang Guanzhong adds 20 μ L Proteinase K solution, mixes;
(4) add 220 μ L damping fluid GB, concussion 15s, places 10min for 70 DEG C, and solution strain is limpid, brief centrifugal to remove the globule covering in tube wall;
(5) add 220 μ L dehydrated alcohols in, fully vibration mixes 155, now may occur flocks, brief centrifugal to remove the globule covering in tube wall;
(6) solution of previous step gained and flocks are all added in an adsorption column CB3 (adsorption column is put into collection tube), the centrifugal 30s of 12,000rpm, outwells waste liquid, and adsorption column CB3 is put into centrifuge tube;
(7) in adsorption column CB3, add 500 μ L damping fluid GD, 12,000rpm is centrifugal 305, outwells waste liquid, and adsorption column CB3 is put into centrifuge tube;
(8) in adsorption column CB3, add 500 μ L rinsing liquid PW, the centrifugal 30s of 12,000rpm, outwells waste liquid, and adsorption column CB3 is put into centrifuge tube;
(9) repetitive operation step (8);
(10) adsorption column CB3 is put back in centrifuge tube, the centrifugal 2min of 12,000rpm, outwells waste liquid, adsorption column CB3 is placed in to room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in adsorption column material;
(11) adsorption column CB3 is proceeded in a clean centrifuge tube, to the unsettled dropping in the middle part 50-200 μ L damping fluid TE of adsorption film, room temperature is placed 2-5min, and the centrifugal 2min of 12,000rpm, collects solution in centrifuge tube;
(12) the centrifugal solution obtaining is joined in adsorption column CB3 again, room temperature is placed 2-5min, and the centrifugal 2min of 12,000rpm, collects solution in centrifuge tube, is template DNA to be checked.Measure bacterial concentration by ultraviolet spectrophotometry.
1.4 loop-mediated isothermal amplification
The cumulative volume of loop-mediated isothermal amplification system is 25 μ L, comprises primer mixed solution 4 μ L, reaction premixed liquid 15 μ L, response sample 5 μ L, aseptic deionized water 1 μ L, in the test of negative control with aseptic deionized water surrogate response sample.Add after sample, can select any one in following two kinds of methods to carry out loop-mediated isothermal amplification.
(1) reaction tubes is placed in to ring mediated isothermal amplification detection system, amplification program is set is: 1. 65 DEG C, 60min, 2. 98 DEG C-80 DEG C, 0.05 DEG C/s, 10min, the fluorescent signal in system Real-Time Monitoring reaction tubes, judges test-results by the isothermal duplication curve and the solubility curve that obtain.
(2) reaction tubes is placed in to thermostat water bath or other constant temperature systems, amplification program is set is: 1. 65 DEG C, 60min, 2. 80 DEG C, 10mmin, judges test-results by the band of gel electrophoresis.
The optimum result of 1.5 ring mediated isothermal amplification detection method temperature of reaction
Match well making thing mixed solution according to the best primer concentration obtaining in 1.5, add loop-mediated isothermal amplification system, set successively the temperature of reaction of ring mediated isothermal amplification for being respectively 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, 66 DEG C, 67 DEG C effect 60min, 98 DEG C-80 DEG C, 0.05 DEG C/s, 10min, according to time and the solubility curve judged result of ring mediated isothermal amplification detection system acquisition fluorescent signal.
The optimization of inside and outside primer concentration ratio in 1.6 primer mixed solutions
It is 2 in inside and outside primer concentration ratio respectively: 1-12: 1 preparation primer mixed solution, add loop-mediated isothermal amplification system, use ring mediated isothermal amplification detection system to realize the fluorescent signal in isothermal duplication Real-Time Monitoring reaction tubes, according to obtaining the time of fluorescent signal and the best proportion of the definite interior outer primer mole number of sample usage quantity to be measured.
The specific test of 1.7 primer mixed solutions
Respectively taking the genomic dna of 5 kinds of non-tuberculous mycobacterias as template, carry out the detection of real-time fluorescence system with mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer mixed solution, replace plasmid template as negative control using aseptic deionized water, the specificity of inspection primer mixed solution simultaneously.
1.8 sensitivity test
The mycobacterium tuberculosis genomic dna of measuring concentration is carried out to 10 times of gradient dilutions (1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L, 1fg/ μ L) successively, by ring mediated isothermal amplification detection system, above-mentioned each concentration DNA is detected respectively.
1.9 detections of application ring mediated isothermal amplification method to clinical samples
The cumulative volume of loop-mediated isothermal amplification system is 25 μ L, comprises primer mixed solution 4 μ L, reaction premixed liquid 15 μ L, sputum specimen DNA extraction thing 5 μ L, aseptic deionized water 1 μ L, in the test of negative control with aseptic deionized water surrogate response sample.Add after sample, can select any one in following two kinds of methods to carry out loop-mediated isothermal amplification.
(1) reaction tubes is placed in to ring mediated isothermal amplification detection system, amplification program is set is: 1. 65 DEG C, 60min, 2. 98 DEG C-80 DEG C, 0.05 DEG C/s, 10min, the fluorescent signal in system Real-Time Monitoring reaction tubes, judges test-results by the isothermal duplication curve and the solubility curve that obtain.
(2) reaction tubes is placed in to thermostat water bath or other constant temperature systems, amplification program is set is: 1. 65 DEG C, 60min, 2. 80 DEG C, 10min, judges test-results by the band of gel electrophoresis.
2. test-results
The optimum result of 2.1 ring mediated isothermal amplification detection method temperature of reaction
By above experimental procedure, other condition inconvenience, setting gradually ring mediated isothermal amplification real-time fluorescence temperature of reaction is 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, and as shown in Figure 3, the preferred temperature that judges accordingly amplified reaction is 64 DEG C to experimental result.
The optimum result of inside and outside primer concentration ratio in 2.2 primer mixed solutions
It is 2 in inside and outside primer mole number ratio respectively: 1-12: 1 preparation primer mixed solution, add loop-mediated isothermal amplification system, use ring mediated isothermal amplification detection system to realize the fluorescent signal in isothermal duplication Real-Time Monitoring reaction tubes, result is as Fig. 1 (concentration ratio of outer primer in being respectively in primer mixed solution for 2: 1,4: 1,6: 1,8: 1,10: 1,12: 1), comprehensive time and the using amount of reagent consideration that obtains turbidity signal, the preferred proportion of inside and outside primer mole number is 8: 1.
2.3 ring mediated isothermal amplification detection method primer specificity experimental results
Respectively taking the genomic dna of 5 kinds of non-tuberculous mycobacterias as template, carry out respectively the detection of ring mediated isothermal amplification system with mycobacterium tuberculosis loop-mediated isothermal amplification primer mixed solution, simultaneously using aseptic deionized water as negative control, the test-results that ring mediated isothermal amplification detects as Fig. 3 (a) and (b), only have the template DNA of mycobacterium tuberculosis to occur amplified signal, and solubility curve is single sharp peak, illustrate that the specificity of mycobacterium tuberculosis loop-mediated isothermal amplification primer mixed solution is good.
2.4 ring mediated isothermal amplification detection method primer sensitivity experiments results
The mycobacterium tuberculosis genomic dna of measuring concentration is carried out to 10 times of gradient dilutions (1ng/ μ L, 100p μ/μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L, 1fg/ μ L) successively, by ring mediated isothermal amplification detection system, above-mentioned each concentration DNA is detected respectively.
Result, as Fig. 4, finally still can have faint amplified signal in the time of 10-7 (1fg/ μ L) dilution gradient, can reach the susceptibility of 1fg/ μ L.
2.5 ring mediated isothermal amplification detection methods detect the experimental result of clinical samples
Taking the DNA extraction thing that is diagnosed as clinically tuberculosis patient sputum specimen as template, carry out respectively the detection of ring mediated isothermal amplification system with mycobacterium tuberculosis loop-mediated isothermal amplification primer mixed solution, simultaneously using aseptic deionized water as negative control, the test-results that ring mediated isothermal amplification detects is as Fig. 5, all there is amplified signal in the DNA of 7 parts of sputum specimens, illustrates that the present invention can be applicable to clinical mycobacterium tuberculosis detection field.
Claims (5)
1. the loop-mediated isothermal amplification (LAMP) primer group detecting for mycobacterium tuberculosis, described primer sets is taking the distinctive insertion sequence IS6110 of mycobacterium tuberculosis as target sequence, based on loop-mediated isothermal amplification technique structure, it is characterized in that, loop-mediated isothermal amplification while can be used for mycobacterium tuberculosis rapid detection, can differentiate mycobacterium tuberculosis and non-tubercule bacillus fast.
Described mycobacterium tuberculosis ring mediated isothermal amplification real-time fluorescence primer sets, is characterized in that, is made up of a pair of outer primer (F3, B3) and a pair of inner primer (FIP, BIP), and its primer sequence is:
2. mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer group as claimed in claim 1, is characterized in that, the method detecting for mycobacterium tuberculosis comprises:
(1) real-time fluorescence detection method, is characterized in that, fluorescent signal when reaction in real-time detection reaction pipe obtains isothermal duplication curve and solubility curve, and then judges detected result;
(2) real-time turbidity detection method, turbidity signal in Real-Time Monitoring reaction tubes when reaction, obtains isothermal duplication curve, and then judges detected result;
(3) uv irradiating fluorescence detection irradiates reaction solution in reaction tubes after amplified reaction under UV-light, the test positive result of the fluorescence that takes on a red color, the negative result of detection not taking on a red color;
(4) direct fluorescence appearance method, it is characterized in that, in amplified reaction forward reaction pipe, add fluorexon as fluorescent indicator, can pass through the direct result of determination of naked eyes, the greeny positive result of reaction solution in reaction tubes, not greeny negative result;
(5) detected through gel electrophoresis method, is characterized in that, has the positive result of feature trapezoid-shaped strips person, without the negative result of feature trapezoid-shaped strips person when the rear reaction solution electrophoresis of reaction;
(6) micro-total analysis method, it is characterized in that, sample dissociation, nucleic acid extraction purifying, isothermal duplication and detection are all integrated on micro-total analysis system and automatically complete, result decision method comprises aforesaid real-time fluorescence detection method, real-time turbidity detection method, uv irradiating fluorescence detection, direct fluorescence appearance method, detected through gel electrophoresis method, this micro-total analysis system is driven by micro diaphragm pump (valve), by unlatching and the closed driving control that realizes microfluid sample of time variable control micro diaphragm pump (valve).
3. a mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer group as claimed in claim 1 is for the test kit of mycobacterium tuberculosis rapid detection, mainly formed by mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer group solution, loop-mediated isothermal amplification premixed liquid, positive quality control product and negative quality control product, it is characterized in that, adopt real-time fluorescence detection method and gel electrophoresis, realize the rapid detection of mycobacterium tuberculosis, can differentiate that mycobacterium tuberculosis is in non-tuberculous mycobacteria; Described mycobacterium tuberculosis loop-mediated isothermal amplification (LAMP) primer group solution, is characterized in that, be by inner primer wherein and outer primer in 2: 1-12: 1 ratio is mixed with, preferred proportion is 8: 1; Described loop-mediated isothermal amplification premixed liquid, is characterized in that, by Bst polysaccharase, dNTP, trimethyl-glycine, MgSO
4, buffered soln and colouring reagents form; Described mycobacterium tuberculosis positive quality control product, is characterized in that, can be the recombinant plasmid being built by mycobacterium tuberculosis IS6110 synthetic fragment, and its concentration is 1ng/ μ L; The negative quality control product of described mycobacterium tuberculosis, is characterized in that, not containing mycobacterium tuberculosis IS6110 genomic fragment.
4. a mycobacterium tuberculosis quick detection kit as claimed in claim 3, it is characterized in that, each reaction tubes is done as a whole, each overall 25 μ L systems, add respectively the loop-mediated isothermal amplification (LAMP) primer group solution 4 μ L of mycobacterium tuberculosis, various loop-mediated isothermal amplification premixed liquid 15 μ L, the each 5 μ L of sample to be tested or positive quality control product or negative quality control product, aseptic deionized water 1 μ L; Described real-time fluorescence detection method, it is characterized in that, use ring mediated isothermal amplification real-time fluorescence detection system to realize the fluorescent signal in synchronous isothermal duplication real-time detection reaction pipe, obtain isothermal duplication curve and solubility curve, the amplification program of real-time fluorescence detection system is: 1. 63-65 DEG C, 60min, 2. 98 DEG C-80 DEG C, 0.05 DEG C/s, 10min; Described gel electrophoresis, is characterized in that, after reaction by reaction solution in 1% sepharose, voltage 90V, electric current 400mA, electrophoresis time 30min, has the positive result of feature trapezoid-shaped strips person, without the negative result of feature trapezoid-shaped strips person after electrophoresis finishes.
5. a using method for mycobacterium tuberculosis quick detection kit as claimed in claim 4, is characterized in that, the decision method of described real-time fluorescence detection method is:
(1) utilize ring mediated isothermal amplification real-time fluorescence detection system to record amplification curve, while there is platform, its fluorescent value is judged to be positive findings while being single sharp peak higher than 5 times of background noise signals and solubility curve, its fluorescent value is higher than 5 times of background noise signals but solubility curve is judged to be nonspecific cross interference signal while being not single sharp peak; Its fluorescent value is judged to be negative findings during lower than 5 times of background noise signals;
(2) be considered as efficiency test when the positive result of positive quality control product reaction tubes and the negative result of negative quality control product reaction tubes, otherwise invalidate the test need re-start;
(3) in the time of the negative result of sample to be tested reaction tubes, mycobacterium tuberculosis do not detected; The positive result of sample to be tested reaction tubes is m tuberculosis infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410123428.5A CN103937884A (en) | 2014-03-28 | 2014-03-28 | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410123428.5A CN103937884A (en) | 2014-03-28 | 2014-03-28 | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103937884A true CN103937884A (en) | 2014-07-23 |
Family
ID=51185751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410123428.5A Pending CN103937884A (en) | 2014-03-28 | 2014-03-28 | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937884A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774961A (en) * | 2015-04-29 | 2015-07-15 | 郭旭光 | Primer, kit and method for detecting streptococcus agalactiae |
| CN107815491A (en) * | 2017-11-21 | 2018-03-20 | 弗罗朗（北京）生物科技有限公司 | A kind of kit and its application method of quick single-minded detection Mycobacterium tuberculosis |
| CN112501324A (en) * | 2020-11-26 | 2021-03-16 | 广州迪澳生物科技有限公司 | Primer and kit for detecting mycobacterium tuberculosis complex and nontuberculous mycobacterium complex based on loop-mediated isothermal amplification |
| CN113817849A (en) * | 2021-09-07 | 2021-12-21 | 厦门飞朔生物技术有限公司 | Primer group for detecting mycobacteria based on nucleic acid mass spectrometry technology and application thereof |
| CN115961060A (en) * | 2022-08-22 | 2023-04-14 | 中国海洋大学 | Primer probe group, kit, method and application for isothermal amplification detection of mycobacterium tuberculosis based on nanogold |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399901A (en) * | 2011-12-21 | 2012-04-04 | 中国人民解放军疾病预防控制所 | Loop-mediated isothermal amplification (LAMP) detection method for mycobacterium tuberculosis, and special primer and kit thereof |
| CN103667425A (en) * | 2012-08-30 | 2014-03-26 | 益生生技开发股份有限公司 | Method and kit for detecting tubercle bacillus |
-
2014
- 2014-03-28 CN CN201410123428.5A patent/CN103937884A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399901A (en) * | 2011-12-21 | 2012-04-04 | 中国人民解放军疾病预防控制所 | Loop-mediated isothermal amplification (LAMP) detection method for mycobacterium tuberculosis, and special primer and kit thereof |
| CN103667425A (en) * | 2012-08-30 | 2014-03-26 | 益生生技开发股份有限公司 | Method and kit for detecting tubercle bacillus |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774961A (en) * | 2015-04-29 | 2015-07-15 | 郭旭光 | Primer, kit and method for detecting streptococcus agalactiae |
| CN107815491A (en) * | 2017-11-21 | 2018-03-20 | 弗罗朗（北京）生物科技有限公司 | A kind of kit and its application method of quick single-minded detection Mycobacterium tuberculosis |
| CN107815491B (en) * | 2017-11-21 | 2020-12-29 | 弗罗朗（北京）生物科技有限公司 | Kit for rapidly and specifically detecting mycobacterium tuberculosis and use method thereof |
| CN112501324A (en) * | 2020-11-26 | 2021-03-16 | 广州迪澳生物科技有限公司 | Primer and kit for detecting mycobacterium tuberculosis complex and nontuberculous mycobacterium complex based on loop-mediated isothermal amplification |
| CN113817849A (en) * | 2021-09-07 | 2021-12-21 | 厦门飞朔生物技术有限公司 | Primer group for detecting mycobacteria based on nucleic acid mass spectrometry technology and application thereof |
| CN115961060A (en) * | 2022-08-22 | 2023-04-14 | 中国海洋大学 | Primer probe group, kit, method and application for isothermal amplification detection of mycobacterium tuberculosis based on nanogold |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
| Li et al. | Rapid detection of Brucella spp. and elimination of carryover using multiple cross displacement amplification coupled with nanoparticles-based lateral flow biosensor | |
| CN102533959A (en) | Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis | |
| CN103725798B (en) | For detecting primer, test kit, the detection method of hemorrhagic fever with renal syndrome virus with RT-LAMP method | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| CN106520984A (en) | Pseudomonas aeruginosa nucleic acid fluorescent PCR (polymerase chain reaction) detection kit and detection method | |
| CN110283935A (en) | A kind of African swine fever virus LAMP detection kit and its application | |
| Kamachi et al. | Laboratory-based surveillance of pertussis using multitarget real-time PCR in Japan: evidence for Bordetella pertussis infection in preteens and teens | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN108913792A (en) | Primer and probe and its kit and method based on digital pcr technology detection Streptococcus suis | |
| CN101676405A (en) | Mycobacterium tuberculosis fluorescence quantitative PCR detection method and kit thereof | |
| Lu et al. | A rapid multiplex nucleic acid detection system of airborne fungi by an integrated DNA release device and microfluidic chip | |
| CN107365684B (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| CN101020929A (en) | Kit and process for PCR amplification detecting type 2 pig streptococcus virulence gene | |
| RU2621864C1 (en) | Method for brucellosis pathogen species identification by pcr method with hybridization-fluorescent results accounting in real time | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN103667425A (en) | Method and kit for detecting tubercle bacillus | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN104830848A (en) | Reverse dot blot hybridization kit for detection of mycobacterium tuberculosis and usage method thereof | |
| Mu et al. | Detection of Brucella S2 vaccine strain by a loop-mediated isothermal amplification (LAMP) method | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN106520986A (en) | Quintuple PCR (polymerase chain reaction) detection method capable of detecting multiple pathogens simultaneously | |
| CN111778343A (en) | Primer pair and kit for detecting Brucella S2 vaccine strain and application of primer pair and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140723 |