CN109055502A

CN109055502A - A kind of detection method of invasive infections with fungi, detection kit and application

Info

Publication number: CN109055502A
Application number: CN201810899103.4A
Authority: CN
Inventors: 王荣芳; 陈昊; 钱震斌
Original assignee: DiaSys Diagnostic Systems (Shanghai) Co Ltd
Current assignee: DiaSys Diagnostic Systems (Shanghai) Co Ltd
Priority date: 2018-08-08
Filing date: 2018-08-08
Publication date: 2018-12-21
Anticipated expiration: 2038-08-08
Also published as: CN109055502B

Abstract

The invention proposes one kind to be based on fungi dissociative DNA (cell free DNA, cfDNA the quick identification with multi-plex PCR diagnosis detecting method of invasive infections with fungi), the present invention can be identified by clinical common and high-incidence Candida albicans (Candida albicans), candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), candida krusei (Candida krusei), invasive infection caused by Candida glabrata (Candida glabrata) and aspergillus fumigatus (Aspergillus fumigtus).The present invention designs amplimer according to the characterizing gene group section of each fungi genus and species, the detection fluorescence probe of strain can be distinguished according to amplified fragments design, real-time fluorescence PCR (real time PCR) is carried out to sample to be tested, combines the advantage identification fungi strain of the high sensitivity of nest-type PRC and the high specific of multi-fluorescence hybridization probe PCR and more targets.The invention also provides be used for invasive infections with fungi PCR diagnostic kit and its application.

Description

A kind of detection method of invasive infections with fungi, detection kit and application

Technical field

The invention belongs to technical field of biomedical detection, are related to a kind of invasive infections with fungi rapid detection method, tool Body is related to one kind based on fungi dissociative DNA (cfDNA) to clinical common and high-incidence fungus-caused invasive infection, using more The method of weight round pcr progress identification diagnosis and application and detection kit.

Background technique

In recent years, as aging of population accelerates, the disease incidences such as tumour and immune deficiency rise, and solid organ and make Hemocytoblast transplanting is fast-developing and the large-scale use of antibiotic and immunosuppressor, studies of invasive fungal infections disease incidence by Year increases.But current diagnosis method is limited, can not early stage Accurate Diagnosis, be easy to affect best occasion for the treatment adversely, lead to clinical prognosis Difference, the death rate are high.

The etiological diagnosis method of studies of invasive fungal infections includes conventional method and Bacterial biodiversity.Conventional method includes fungi Microscopy, culture and histopathological examination.Though fungus microscope examination and histopathological examination can reflect the parasitism of fungi in the tissue Form, but can not determine Species of Pathogens；Fungal culture is goldstandard, and selects drug according to drug susceptibility, but time-consuming, Sensibility is low, it may be necessary to repeatedly culture, it is also possible to can not cultivate at all, easily forfeiture golden hour.Bacterial biodiversity That is Serologic detection, including GM test and G test.Though GM test can be used as the foundation of diagnosis Aspergillosis, sensitivity Sometimes can be down to 50%, and influence factor is more, false positive rate is up to 18%.Though G tests the diagnosis for being put into studies of invasive fungal infections Standard, but pathogenic species can not be identified, it is impossible to be used in the detection of zygomycete and Cryptococcus infections, and false positive with higher. Therefore, fungal infection detection technique clinical at present has that time-consuming, poor repeatability, false positive rate are higher and cannot accurate area It is not able to satisfy clinical demand the problems such as dividing strain.Fast and accurately disease fungus detection method examines clinical early stage for development Disconnected and accurate treatment is of great significance.

Molecular biology method mainly reaches the double of detection and identification by detecting the specific gene sequence of disease fungus Weight purpose.Perspective study early in Florent in 2006 etc. confirms that PCR-ELISA technology is examined in Aspergillosis early stage Value in disconnected, the PCR positive can be 5~19.5 days positive earlier than clinical sign, Imageology or culture, earlier than GM test 17 It.Fluorescent quantitative PCR technique can identify the zygomycete and other filamentous fungis that histopathological examination is difficult to differentiate between, and sensitive Property and specificity can reach 100%.It can be seen that comparing other technologies, the molecular biology method of based on PCR technology has The advantages such as easy, quick, sensitive.Compared to the detection of other pathogenic microorganisms, fungal nucleic acid detection mainly has following technologies difficult Point: (1) the fungal spore pollution being easily widely present in the environment in experimental implementation is led since PCR detection sensitivity is high Cause mistaken diagnosis；(2) fungal cell wall is firmer, it is difficult to be cracked by conventional technical means, cause to test complicated, error rate rising and inspection Cost is surveyed to improve；(3) since invasive infections with fungi early stage pathogen quantity is not easy to be detected less.Therefore, research and development can overcome These technological difficulties are suitable for the inexorable trend that clinical diagnostic kit is fungal molecule diagnosis development.

Extracellular dissociative DNA (cell free DNA, cfDNA) detection is the hot fields of current noninvasive in-vitro diagnosis, mainly It is intensively applied in the early diagnosis of the genetic diseases such as prenatal genetic screening and tumour, has more methodological study report, but It there is no the report detected using fungi cfDNA so far.

Summary of the invention

The present invention innovatively utilizes fungi cfDNA combination round pcr to realize diagnosis and drug resistance strain to fungal infection Identification.A kind of detection method of invasive infections with fungi proposed by the present invention, comprising: enriching and purifying sample to be tested (such as periphery Blood serum etc.) in fungi dissociative DNA (cell free DNA, cfDNA) segment, then directly carry out species-specific genes pack One-step method nido+fluorogenic hybridization probe multiplex PCR Testing and appraisal of section, that is, the foundation conserved region fungi rDNA (5.8S, 18S, Fungi Genus-specific primers 28S) are designed, design fungi species specificdetection fluorescence probe according to the area amplified fragments Zhong ITS, Real-time fluorescence quantitative PCR is carried out to the sample to be tested, by PCR multiple reaction to that may be present true in the sample to be tested Bacterium strain is distinguished and is identified.The present invention is a kind of invading based on fungal cell's dissociative DNA (cell free DNA, cfDNA) Quick, the multiple one-step method nest-type PRC identification diagnosis method of attacking property fungal infection.

In the present invention, the detection target of the method is fungi dissociative DNA segment (the cell free in clinical sample DNA,cfDNA)。

The method of the invention is under the premise of using the characteristic of the higher sensitivity of nest-type PRC, using optimized general Nested primer and specific probe combination and reaction condition setting, the conventional need nest-type PRC that multiple multitube is completed step by step is anti- Step single tube completion should be merged into, realizes the combination of detection sensitivity and operation simplification.

Wherein, the fungi includes Candida albicans (Candida albicans), candida tropicalis (Candida Tropicalis), Candida parapsilosis (Candida parapsilosis), candida krusei (Candida krusei), Candida glabrata (Candida glabrata), it is arbitrary one or more of in aspergillus fumigatus (Aspergillus fumigtus) Combination.

The present invention innovatively utilizes fungi cfDNA combination round pcr to realize that the diagnosis to fungal infection detects, innovative point It include: firstly, extracellular dissociative DNA (cfDNA) detection method is applied to fungal infection detection field by the present invention, in enrichment sample After middle fungi cfDNA segment, directly progress species-specific genes group segment detection, thus avoid the fungi (spore) of external source Interference, mistaken diagnosis caused by having prevented therefore.Secondly, simplifying operating process because being not necessarily to cell cracking and reducing technology and want A possibility that asking, further avoiding the pollution such as external source fungi, improves the specificity and reliability of detection；People has been saved simultaneously Power reduces testing cost.Also, the present invention also uses nido+multi-fluorescence hybridization probe PCR (Nest-PCR+ Multiplex-PCR strategy) carries out, its main feature is that by the nested amplification round pcr (Nest-RCR) with higher sensitivity It is combined with the fluorogenic hybridization probe technology compared with high specific and more targets；By the nest-type PRC (Nest-PCR) of optimization and The use in conjunction of multi-fluorescence hybridization probe PCR, pointedly overcomes in sample that fungi cfDNA content is relatively small number of to ask Topic, the sensitivity for improving detection in turn ensure the specificity of result.Further, Optimal improvements nido of the present invention+multiple Fluorogenic hybridization probe PCR reaction condition completes one step of total overall reaction, avoids midway sample-adding introducing operating mistake and outside is dirty The possibility of dye, and then improve the confidence level of result.

The invention proposes based on fungi dissociative DNA, the foundation conserved region fungi rDNA (5.8S, 18S, 28S) and ITS Area, to be present in the clinical samples such as serum, blood plasma and organ perfusion liquid by the clinically most common invasive infection fungi: Candida albicans (Candida albicans), candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), candida krusei (Candida krusei), Candida glabrata (Candida Glabrata), aspergillus fumigatus (Aspergillus fumigtus) carries out identification with multi-plex PCR diagnosis detecting method.

The present invention is according to fungi Candida albicans (Candida albicans), candida tropicalis (Candida Tropicalis), the conserved region rDNA (5.8S, 18S, 28S) Candida parapsilosis (Candida parapsilosis) and Specificity amplification primer and specific detection fluorescence probe is arranged in the area ITS.The fungi specificity nido PCR primer includes as follows The primer of sequence combines, that is, the primer sets of the conserved region rDNA (5.8S, 18S, 28S) amplimer are combined into:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 1-2,5 ' -3 ' sequences: GTCCTACCTGATTTGAGG (SEQ ID NO.4).

Combined with aforementioned primer it is corresponding, when containing as follows correspond to Candida albicans (Candida albicans), heat Fungi kind with Candida (Candida tropicalis), Candida parapsilosis (Candida parapsilosis) is special When different detection fluorescence probe, then the method for the invention accurately can detect and distinguish specific specific strain in sample to be tested.That is, Fungi species specificdetection fluorescence probe is arbitrary one or more of combination of following sequence:

Candida albicans (Candida albicans) 5 ' -3 ' sequences: TACCGCCGCAAGCAAT (SEQ ID NO.5)；

Candida tropicalis (Candida tropicalis) 5 ' -3 ' sequences: TGAAATAAATTGTGGTGGCC (SEQ ID NO.6)；And/or

Candida parapsilosis (Candida parapsilosis) 5 ' -3 ' sequences: TGGAGTTTGTACCAATGAGT (SEQ ID NO.7)。

Using the method for the invention, accurately it can detect and determine by Candida albicans (Candida from clinical sample Albicans), candida tropicalis (Candida tropicalis) and Candida parapsilosis (Candida Parapsilosis one of), fungal infection caused by two or three any combination, and detect and determine and infected Specific strain.

In the method for the present invention, according to fungi candida krusei (Candida krusei), Candida glabrata (Candida Glabrata), the conserved region rDNA (5.8S, 18S, 28S) aspergillus fumigatus (Aspergillus fumigtus) and the setting of the area ITS are special Specific amplification primers and specific detection fluorescence probe.Fungi specificity nido PCR primer includes the primer combination of following sequence, That is, the combination of the conserved region rDNA (5.8S, 18S, 28S) amplimer are as follows:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 2-2,5 ' -3 ' sequences: TTCCTACCTGATTTGAGG (SEQ ID NO.8)；

Downstream primer 2-3,5 ' -3 ' sequences: CCCTACCTGATTTGAGG (SEQ ID NO.9)；

Upstream primer 2-4,5 ' -3 ' sequences: TCCCTACCTGATCCGAGG (SEQ ID NO.10)；

Downstream primer 2-5,5 ' -3 ' sequences: CATGCCTGTCCGAGCGT (SEQ ID NO.11).

Combined with aforementioned primer it is corresponding, when corresponding to candida krusei (Candida krusei), light containing following The fungi species specificdetection fluorescence of sliding candida albicans (Candida glabrata), aspergillus fumigatus (Aspergillus fumigtus) is visited When needle, it accurately can detect and distinguish specific specific strain whether has been infected in sample to be tested using the method for the invention；That is, Fungi species specificdetection fluorescence probe is arbitrary one or more of combination of following sequence:

Candida krusei (Candida krusei) 5 ' -3 ' sequences: CGTGCGCAGAGTTGGG (SEQ ID NO.12)；

Candida glabrata (Candida glabrata) 5 ' -3 ' sequences: TGTCTGCCCAGCACGCA (SEQ ID NO.13)；

Aspergillus fumigatus (Aspergillus fumigtus) 5 ' -3 ' sequences: CCTACAGAGCAGGTGACAAAG (SEQ ID NO.14)。

The method through the invention, can accurately from clinical sample detect and determine the sample in whether infect by gram Soft candida albicans (Candida krusei), Candida glabrata (Candida glabrata) and aspergillus fumigatus (Aspergillus Fumigtus) any one, infection caused by two kinds and/or three kinds of any combinations, and detect determine infected it is specific Strain.

Specifically, the fungi bacterium for the most common invasive infection of clinic that the invention proposes a kind of based on fungi dissociative DNA The nido of kind+multi-fluorescence hybridization probe PCR detection, specifically detection is present in the clinics such as serum, blood plasma and organ perfusion liquid In sample by Candida albicans (Candida albicans), candida tropicalis (Candida tropicalis), close flat Sliding Candida (Candida parapsilosis), candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and aspergillus fumigatus (Aspergillus fumigtus).By the conserved region rDNA (5.8S, 18S, Specificity amplification primer 28S) is set, strain specific detection fluorescence probe is designed according to the area ITS, sample to be tested is carried out glimmering in real time Light PCR (real-time PCR) detection.Candida albicans (Candida is distinguished by two single tube multiple reaction identifications Albicans), candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida Parapsilosis), candida krusei (Candida krusei), Candida glabrata (Candida glabrata), aspergillus fumigatus (Aspergillus fumigtus)。

Wherein, described for identifying Candida albicans (Candida albicans), candida tropicalis (Candida Tropicalis), Candida parapsilosis (Candida parapsilosis) primer are as follows:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 1-2,5 ' -3 ' sequences: the combination of GTCCTACCTGATTTGAGG (SEQ ID NO.4).

The specific detection fluorescence probe (5' mark fluorescent group, 3' mark quenching group) are as follows:

Candida tropicalis (Candida tropicalis) 5 ' -3 ' sequences: TGAAATAAATTGTGGTGGCC (SEQ ID NO.6)；With

Candida parapsilosis (Candida parapsilosis) 5 ' -3 ' sequences: TGGAGTTTGTACCAATGAGT It is arbitrary one or more of in (SEQ ID NO.7).

Further, two on the probe sequence are terminally chemically modified are as follows:

The end 5': FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, Cy5 or more fluorescent dye groups In any three kinds of dyestuffs combination；With,

The end 3': BHQ1 or BHQ2 or 3IABkFQ or 3IAbRQSp quenching group, with the above-mentioned end three selected kind 5' fluorescent base Any combination of group；

Preferably, 3 ' ends are modified using MGB.

Wherein, described to be used for candida krusei (Candida krusei), Candida glabrata (Candida glabrata), Aspergillus fumigatus (Aspergillus fumigtus) primer are as follows:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 2-2,5 ' -3 ' sequences: TTCCTACCTGATTTGAGG (SEQ ID NO.8)；

Downstream primer 2-3,5 ' -3 ' sequences: CCCTACCTGATTTGAGG (SEQ ID NO.9)；

Upstream primer 2-4,5 ' -3 ' sequences: TCCCTACCTGATCCGAGG (SEQ ID NO.10)；With

Downstream primer 2-5,5 ' -3 ' sequences: CATGCCTGTCCGAGCGT (SEQ ID NO.11)；Combination.

Wherein, the specific detection fluorescence probe (5' mark fluorescent group, 3' mark quenching group) are as follows:

Aspergillus fumigatus (Aspergillus fumigtus) 5 ' -3 ' sequences: CCTACAGAGCAGGTGACAAAG (SEQ ID NO.14 arbitrary one or more combination in).

Preferably, 3 ' ends are modified using MGB.

The multi-PCR detection method of invasive infections with fungi proposed by the present invention, includes the following steps:

1) sample cfDNA enriching and purifying: can be used paramagnetic particle method or select our company (Diasys) and the QIAGEN now sold etc. The whole blood small fragment DNA extraction agent box of company.

2) fluorescent PCR expands: preparing PCR reaction system according to PCR operating process, has and probe matching sense channel On fluorescent PCR instrument on expand according to total denaturation, circulation (containing denaturation, annealing, extend step or extend step containing denaturation, annealing) Increase and detects.

Preferably, the fluorescent PCR amplification is three fluorescence PCR amplification: preparing PCR reactant according to PCR operating process System (containing denaturation, annealing, extends on the fluorescent PCR instrument on probe matching sense channel according to total denaturation, circulation having Step contains denaturation, annealing extension step) amplification simultaneously three colour synchronisations detection.

Wherein, in the real-time fluorescence quantitative PCR, for annealing temperature between 55-67 DEG C, pcr amplified fragment length is 50- 500bp；Primer final concentration range is between 0.5-0.05uM.The final concentration range of each probe are as follows: 1nM-15nM.

Preferably, in the real-time fluorescence quantitative PCR, annealing temperature is set as two stages, and a stage annealing temperature is Between 65 DEG C -61 DEG C, recurring number is 3-10 circulation, and two-step anneal temperature is recurring number 38-45 between 63 DEG C -57 DEG C A circulation.

Preferably, in the real-time fluorescence quantitative PCR, pcr amplified fragment length is 100-350bp.

Preferably, in the real-time fluorescence quantitative PCR, amplifying genom DNA concentration range is between 0.08-0.02uM.

Preferably, in the real-time fluorescence quantitative PCR, the final concentration range of each probe are as follows: 2nM-10nM.

3) interpretation of result and judgement: the Ct value arrived according to every part of sample in each Air conduct measurement marks base by specific probe Group determines its specific fungi strain type.

The invention also provides a kind of for detecting the detection kit of invasive infections with fungi.Before the kit includes The fungi Genus-specific primers and fungi species specificdetection fluorescence probe stated.

Further, the kit includes pcr amplification reaction reagent；Wherein, the RCR amplification reaction reagent includes PCR reaction reagent mix (mixed liquor), PCR primer probe mix-1 (primer and probe mixed liquor 1), PCR primer probe mix-2 (primer and probe mixed liquor 2).

Further, the kit includes: containing the positive plasmid mark for being located at each fungi strain kind specific section of rDNA Quasi- product.

Further, the kit includes: PCR reaction buffer system, Hot-start Taq enzyme.

The invention also provides the applications of the detection kit of the detection invasive infections with fungi, propose one kind and are based on Application in the reagent of the invasive infections with fungi rapid detection method of fungi dissociative DNA (cell free DNA, cfDNA).Institute State in application includes that fungi Genus-specific primers above-mentioned and fungi species specificdetection fluorescence probe, the kit can be used for Invasive fungi is distinguished and is identified.

It further include the two terminally chemically modified of the probe sequence further in the kit and its application, comprising: The end 5': FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, any three in Cy5 or more fluorescent dye groups The combination of kind dyestuff；The end 3': BHQ1 or BHQ2 or 3IABkFQ or 3IAbRQSp quenching group, with the above-mentioned end three selected kind 5' Any combination of fluorophor.

Specifically, proposed by the present invention includes the kit system for being directed to clinically relevant sample.For example, kit (48 people Part) mainly form as shown in following table -1:

- 1 invasive fungi detection kit of table mainly forms

PCR reaction reagent mix main component includes: 2X buffer+dNTPs+Mg⁺⁺+hot-start Taq；

PCR primer probe mix main component includes: upstream and downstream primer+TaqMan probe；

Positive control 1: containing the plasmid for being mixed with Candida albicans, candida tropicalis and Candida parapsilosis segment；

Positive control 2: containing being mixed with candida krusei, the plasmid of Candida glabrata and aspergillus fumigatus segment；

Negative control: empty plasmid.

Applicable Real Time PCR amplification instrument:

Applied Biosystems 7900HT/7300/7500 Real-Time PCR System、7500 Fast Real-Time PCR System、StepOnePlus^TM Real-Time PCR System(Applied Biosystems)、(Roche Diagnostics)、CFXTouch^TM(Bio-Rad)。

Reagent transport and condition of storage:

The transport of this kit can carry out under 2~8 DEG C of environment.When storage, -20 DEG C of preservations must be set.

Validity period: this kit validity period is 12 months, is used before the deadline.

Kit principle:

Kit has used Hot-start Taq enzyme to carry out PCR amplification, hydrolyzes TaqMan by Taq enzyme in reaction solution and visits The fluorescence intensity change of needle release achievees the purpose that detect PCR product amplification.With fungi rDNA containing conserved region (5.8S, 18S, 28S) and the fungal gene group sequence in the area ITS carry out PCR amplification, realized using TaqMan probe to the identification area of each strain Point.Archaeal dna polymerase in kit is due to having used Hot-start Taq enzyme, thus the non-specific amplification under inhibiting room temperature, Greatly improve the accuracy rate of PCR amplification.

TaqMan multi-fluorescence detection method:

It is issued after being hydrolyzed after being hybridized by FAM, VIC/ROX and the CY5 TaqMan probe marked with target fragment by Taq enzyme glimmering Light reaches detection, identification, distinguishes specific fungi strain (Candida albicans, heat by the specific fluorescence in detection reaction system Band Candida, smooth Candida, candida krusei, Candida glabrata, aspergillus fumigatus) purpose.

Kit feature:

It, can be quickly and accurately to human serum, blood plasma, filling suitable for a variety of routine Real-Time PCR reaction platforms In washing lotion by Candida albicans, candida tropicalis, smooth Candida, candida krusei, Candida glabrata and aspergillus fumigatus Caused invasive infection is detected, is analyzed, and determines specific infection bacteria species.When PCR reaction solution is prepared, mix in the reaction system Enter primed probe, Real-Time PCR reaction can be carried out by adding template, simple to operate.Archaeal dna polymerase uses Hot-start archaeal dna polymerase, with company, solely self-developed Buffer system is combined, and has high amplification efficiency, high amplification spirit The characteristics of sensitivity and high specific amplification.

Beneficial effect of the present invention further include: in methodology, examined using one-step method nido+multi-fluorescence hybridization probe PCR It surveys, it can be achieved that immediate observation testing result.Short detection time is 1.5~3 hours, easy to operate, is conducive to extensive in practice It promotes and applies.Extracellular dissociative DNA (cfDNA) detection method is applied to fungal infection detection neck for the first time by kit of the invention Domain directly carries out the detection of species-specific genes group segment in enrichment sample after fungi cfDNA segment, develop a kind of without cell The disease fungus kit for detecting nucleic acid of cracking and nucleic acid extraction.Its advantage are as follows: the fungi (spore) in 1. environment ties detection Fruit does not influence, and effectively reduces misdiagnosis rate, improves detection reliability；2. simplifying detecting step, operate simpler quick； 3. reducing testing cost.Kit of the invention uses nido+multi-fluorescence hybridization probe PCR (Nest-PCR+Mutiplex- PCR strategy) carries out.Its main feature is that by nested amplification round pcr (Nest-RCR) with higher sensitivity and higher special The fluorogenic hybridization probe technology of degree combines.Firstly, specific aim overcomes cfDNA and contains using the feature of nest-type PRC high sensitivity Measure relatively fewer problem.Secondly, Optimal improvements nido+multi-fluorescence hybridization probe PCR reaction condition, total overall reaction is combined into One step is completed, and the high sensitivity of nest-type PRC had both been taken into account, and is in turn avoided midway and is loaded the possibility for introducing mistake, improves result Confidence level.

Detailed description of the invention

Fig. 1 is the schematic diagram of expression middle probe of the present invention, the respective design object section of primer.

Fig. 2 is the fungi strain multiple PCR primer probe specific implementation schematic diagram for indicating to identify in the present invention, with reality The special Multiple detection TaqMan probe position (area ITS) of line mark, nest-type PRC primer (arrow mark) amplification region position (5.8s,28s,18s).Nested PCR amplification is realized by the different annealing temperatures in two stages in primary first-order equation.

Fig. 3 be indicate various concentration in the present invention (weak sun, in weak sun, in strong sun, strong sun) positive colony plasmid amplification is bent Line (TaqMan probe).Wherein, Fig. 3 A indicates Candida albicans positive plasmid amplification curve (wherein, abscissa reaction cycle number It is 5,10,15,20,25,30,35；Ordinate relative fluorescence are as follows: 0.099,0.899,1.699,2.499,3.299,4.099, 4.899,5.699,6.499,7.299,8.099)；Fig. 3 B indicates candida tropicalis positive plasmid amplification curve (wherein, horizontal seat Marking reaction cycle number is 5,10,15,20,25,30,35；Ordinate relative fluorescence are as follows: 0.242,0.942,1.642,2.342, 3.042,3.742,4.442,5.142,5.842,6.542,7.242)；Fig. 3 C indicates the amplification of Candida parapsilosis positive plasmid (wherein, abscissa reaction cycle number is 5,10,15,20,25,30,35 to curve；Ordinate relative fluorescence are as follows: -0.118, 0.582、1.282、1.982、2.682、3.382、4.082、4.782、5.482、6.182、6.882、7.582)。

Fig. 4 be indicate various concentration in the present invention (weak sun, in weak sun, in strong sun, strong sun) positive colony plasmid amplification is bent Line (TaqMan probe).Wherein, Fig. 4 A indicates candida krusei positive plasmid amplification curve (wherein, abscissa reaction cycle number It is 5,10,15,20,25,30,35；Ordinate relative fluorescence are as follows: 0.394,1.194,1.994,2.794,3.594,4.394, 5.194,5.994,6.794,7.594,8.394)；Fig. 4 B indicates Candida glabrata positive plasmid amplification curve (wherein, abscissa Reaction cycle number is 5,10,15,20,25,30,35；Ordinate relative fluorescence are as follows: 0.216,0.916,1.616,2.316, 3.016,3.716,4.416,5.116,5.816,6.516,7.216)；Fig. 4 C indicates aspergillus fumigatus positive plasmid amplification curve (its In, abscissa reaction cycle number is 5,10,15,20,25,30,35；Ordinate relative fluorescence are as follows: -0.151,0.549, 1.249、1.949、2.649、3.349、4.049、4.749、5.449、6.149、6.849、7.549)。

Specific embodiment

In conjunction with following specific embodiments and attached drawing/table, the present invention is described in further detail, in protection of the invention Appearance is not limited to following embodiment.Without departing from the spirit and scope of the invention, those skilled in the art it is conceivable that Variation and advantage are all included in the present invention, and using appended claims as protection scope.Implement mistake of the invention Journey, condition, reagent, experimental method etc., in addition to what is specifically mentioned below, be this field universal knowledege and it is known often Know, there are no special restrictions to content by the present invention.

Embodiment 1:

With positive plasmid sample verifying to the method for the present invention

In the present embodiment, PCR detection, verifying the method for the present invention reaction are carried out to each positive bacteria kind plasmid with the method for the present invention System can be by single tube multiple reaction, and disposable unique identification goes out Candida albicans, candida tropicalis, smooth vacation silk ferment respectively Female or candida krusei, Candida glabrata, aspergillus fumigatus and without the reaction that intersects.Above-mentioned each strain is contained in each secondary response Each strain positive plasmid is configured to sample to be detected (plasmid concentration 10 by positive plasmid afterwards alone or in combination²Copy/μ L).

One, implementation method:

1. preparing the positive plasmid of strain

1.1. design of primers: respectively refer to reported each strain rDNA sequence (comprising 5.8s, 18s, the area 28s and ITS) The primer sequence of each strain positive plasmid of design construction:

Candida albicans:

The sequence of upstream primer 5 ' -3 ': GGTGTTGAGCAATACGACTTGG (SEQ ID NO.15)

The sequence of downstream primer 5 ' -3 ': AGACCTAAGCCATTGTCAAAGC (SEQ ID NO.16)

Candida tropicalis:

The sequence of upstream primer 5 ' -3 ': TGGTATTCCAAAGGGCATGC (SEQ ID NO.17)

The sequence of downstream primer 5 ' -3 ': CCACGTTAAATTCTTTCAAACAAA (SEQ ID NO.18)

Smooth Candida:

The sequence of upstream primer 5 ' -3 ': ATTGCGCCCTTAGGGCATG (SEQ ID NO.19)

The sequence of downstream primer 5 ' -3 ': TCCATTAGTTTATACTCCGCCTT (SEQ ID NO.20)

Candida krusei:

The sequence of upstream primer 5 ' -3 ': CTGTTTGAGCGTCGTTTCCA (SEQ ID NO.21)

The sequence of downstream primer 5 ' -3 ': TCCTACCTGATTTGAGGTCGAG (SEQ ID NO.22)

Candida glabrata:

The sequence of upstream primer 5 ' -3 ': CCATATCAGTATGTGGGACACGA (SEQ ID NO.23)

The sequence of downstream primer 5 ' -3 ': ATCCCTCCCTAGATCAACACC (SEQ ID NO.24)

Aspergillus fumigatus:

The sequence of upstream primer 5 ' -3 ': ATTGCGCCCTTAGGGCATG (SEQ ID NO.25)

The sequence of downstream primer 5 ' -3 ': TCCATTAGTTTATACTCCGCCTT (SEQ ID NO.26).

1.2. each strain rDNA sequence (including 5.8s, 18s, the area 28s and ITS) is cloned using following PCR reaction system:

PCR reaction system is added in 200 μ L trace P CR reaction tubes:

Reaction condition is 94 DEG C of total denaturation 8 minutes, 35 circulations (94 DEG C 25 seconds, 62 DEG C 20 seconds, 72 DEG C 35 seconds).

1.3.PCR product cloning: the PCR fragment amplified is polymerize after the recycling of PCR product QIAquick Gel Extraction Kit with T4DNA Enzyme (T4DNA polymerase, NEB BioLabs company) filling-in end, then through agarose gel electrophoresis, target fragment is used Plastic recovery kit recovery purifying is then inserted into the site EcoRV on pBluesecriptII SK (+) carrier, in detail side Method is shown in document (Sambrooks, " molecular cloning handbook "), and finally connection product is transformed into DH5 α bacterial strain, with PCR method come Screening positive clone.

1.4. determined dna sequence, sequencing result and GenBank sequences or public reporting sequence one are carried out to positive colony It causes.

1.Real-time PCR reaction system are as follows:

2. reaction condition sets (standard two-step method)

95 DEG C of total denaturation 5 minutes, 5 circulations (94 DEG C 15 seconds, 63 DEG C 15 seconds, 72 DEG C 25 seconds), 38 recycle (94 DEG C 15 Second, 60 DEG C 15 seconds, 72 DEG C 25 seconds).

Two, testing result:

PCR determines whether to be consistent with the positive sample strain being added according to each channel fluorescence signal Ct value after reaction It closes, when augmentation detection signal (Ct≤35), is then determined as positive signal, prove system of the present invention to each strain of detection with this Validity.Each experimental result is as shown in table -2:

- 2 reaction tube of table is added with C.albicans, after C.tropicalis, C.parapsilosis is the probes of target Result is determined to the detection of each positive plasmid ("+" contains positive plasmid, the no positive plasmid of "-")

- 3 reaction tube of table is added using C.krusei (FAM), C.glabrata (ROX), A.fumigatus as the probe of target The detection of each positive plasmid ("+" contains positive plasmid, the no positive plasmid of "-") is determined afterwards

Above-mentioned table -2 in table -3, when augmentation detection signal (Ct≤35), is then determined as positive signal: each strain is corresponding Signal path are as follows: C.albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei(FAM),C.glabrata(ROX),A.fumigatus(Cy5).The positive of corresponding strain is added in "+" signal in table Plasmid, "-" illustrate the positive plasmid without corresponding strain.Only when and when having probe could after corresponding to positive plasmid addition in each reaction Corresponding signal path is detected as the positive, illustrates that system of the present invention specificity is good, can each fungi strain of unique identification, and nothing Cross reaction.Multiple detection system of the invention can be arbitrary in resolution disposable while accurate compared in low target-concentrations and detection Each strain combination, and do not occur any mistake, such as false positive and false negative.To sum up, this example demonstrates that, detection architecture of the present invention Specificity and sensitivity reach design requirement, can be used as quickly, it is convenient diagnosis invasive infections with fungi because type effective tool.

Embodiment 2:

Strain idenfication test is carried out with the in-vitro culture model infected by known strain

In the present embodiment, with in-vitro simulated (PBMC) the culture supernatant sample of fungi strain is determined, PCR system of the present invention is tested Whether system can distinguish strain using free fungal DNA, and not influenced by non-detection target strain.By this embodiment, further Confirm that kit of the present invention is suitable for distinguishing identification detection to fungi strain based on fungi dissociative DNA segment, and to body Systemic characteristic is shown in the detection of outer simulated infection sample and repeatability is good, without being influenced by other interference factors.

One, implementation method:

1. supernatant is taken after centrifugation for the culture solution of known strain, it is limited with Qiagen or desai diagnostic system (Shanghai) Company's blood DNA extraction agent box extracts DNA.

2.real-time PCR reaction system are as follows:

3. reaction condition is set

Two, testing result:

When augmentation detection signal (Ct≤35), be then determined as positive signal: each strain corresponds to signal path are as follows: C.albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata(ROX),A.fumigatus(Cy5).PCR determines screening according to each channel fluorescence signal Ct value after reaction Specific strain in sample.

- 4 pairs of in-vitro culture models of table carry out strain idenfication testing result

This embodiment sample totally 30, through single blind experiment, the liquid supernatant of Spore cultivation containing Candida albicans 22 people of sample The independent recall rate of experiment respectively is 100%；And other interference factors are without influence.System is special in the in-vitro simulated infection sample of this system The opposite sex, repeatability are good.

As shown in table -4, "-" signal is without amplified signal or Ct > 35 in table.The total 30 determining strains of the present embodiment In vitro culture analog sample is accorded with after comparing with the obtained result of kit and method of the invention with known sequencing result Conjunction rate has reached 100%.It follows that the present invention is based on the multiplex PCR mirror that cracking fungi is detected using fungi dissociative DNA segment Determine method, the Fungal identification that can be used in authentic specimen.

Embodiment 3:

Strain idenfication test is carried out with the animal fungal invasion infection model serum infected by known strain

In the present embodiment, determined whether to pass through originally using the animal infection modal serum sample for determining fungi strain infection The infection bacteria species of methodology identification In vivo infection model of the invention.Further confirm that kit of the present invention is suitable by the embodiment Identification detection is distinguished to fungi strain for gene fungal DNA segment of dissociating, and in the inspection to internal simulated infection sample Show systemic characteristic in survey and repeatability be good, without by other interference factors without influencing.

One, implementation method:

1. white by tail vein injection for the mouse of different disposal (immunosuppressor is handled or handled without immunosupress) The fungus culture medium of color candida albicans strain, takes blood after certain intervals number of days, prepares serum sample, then uses Qiagen or desai Diagnostic system (Shanghai) Co., Ltd. blood DNA extraction agent box extracts DNA.

2.real-time PCR reaction system are as follows:

3. reaction condition is set

Two, testing result:

When augmentation detection signal (Ct≤35), be then determined as positive signal: each strain corresponds to signal path are as follows: C.albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC) and C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy5), PCR determine screening according to each channel fluorescence signal Ct value after reaction Specific strain in sample.

Table -5 carries out strain idenfication test result with fungi known strain infected animal model

In above-mentioned table -5, left-hand line condition entry is "Yes"/" addition ", left-hand line condition in "-" schematic table in "+" schematic table Item is "No"/" being added without ".There is the white of illness sign mouse to read after the detectable inoculation of mouse nuclei test display system The infection of pearl bacterium.Negative mice non-false positive signal.And infection but physical health mouse also no positive signal.System independently weighs twice Multiple test result is consistent.Illustrate that this system can be used for the strain idenfication detection of clinical aggressiveness fungal infection sample.

Embodiment 4:

It is being infected with the unknown fungi strain of each department of the hospital selected at random and doubtful through the fungi that G testing inspection is the positive Like the serum sample of infected patient, the method for the present invention is verified, and is compared with the methodology of G testing inspection

In the present embodiment, using patients serum's sample of each department's suspected fungal infections of hospital, all sample G testing inspections Have been determined as the positive.By this embodiment, further confirm that the present invention is based on the multiplex PCR strains of free fungal DNA segment Distinguish the confirmation that identification detection method is applicable to the diagnosis and infection bacteria species that detect to people's invasive infections with fungi.And it is tried with G Detection carries out clinical correlation comparison.

One, implementation method:

1. the serum sample collected using hospital's different department, and the measured value of sample G detection is recorded, with Qiagen or moral The blood DNA extraction agent box for matching (diagnosis) Shanghai Co., Ltd extracts DNA.

2.real-time PCR reaction system are as follows:

3. reaction condition is set

Two, testing result:

When augmentation detection signal (Ct≤35), be then determined as positive signal: each strain corresponds to signal path are as follows: C.albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata(ROX),A.fumigatus(Cy5).PCR determines screening after reaction, according to each channel fluorescence signal Ct value Specific strain in sample.

Each department's pattern detection result of -6 pairs of the table hospitals selected at random

Small lot clinical sample (N=7) test display, the method for the present invention can be free using fungi in human serum sample DNA fragmentation carries out strain idenfication diagnostic test to invasive infections with fungi patient.Have compared with G testing inspection result certain Correlation (70%), compare G method for testing and detecting, the detection time of the method for the present invention is shorter, and can confirm that specific infectious bacteria Kind, treatment guidance can be provided for the strain rational use of medicines to the later period.

Embodiment 5:

Fungi infected with the unknown fungi strain of the In-patient selected at random and by G or GM experiment test is doubted Like infected patient serum sample to the confirmatory detection of the method for the present invention and and the methods comparison that detects of G and GM

In the present embodiment, using the inpatient's serum sample selected at random, the serum sample is suspected fungal infections (strain is unknown), and the serum sample is tested using G or GM test.By this embodiment, this hair is further confirmed The bright multiplex PCR strain based on free fungal DNA segment is distinguished identification detection method and is applicable to people's invasive fungi sense The confirmation of detection, the diagnosis and infection bacteria species of dye.And compared with G and GM detection carries out clinical correlation.

One, implementation method:

1. the serum sample is suspected fungal infections (bacterium using the serum sample for the inpatient that hospital selects at random Kind is unknown), and the serum sample is tested using G or GM test, record the measured value of sample G or GM testing inspection； Then, DNA is extracted using the blood DNA extraction agent box that Qiagen or desai diagnose (Shanghai) Co., Ltd..

2.real-time PCR reaction system are as follows:

3. reaction condition is set

Two, testing result:

- 7 pairs of the table each strain accountings of In-patient pattern detection result selected at random

	Each strain accounting % (sample number=45) of test sample
		C.albicans	87.2
C.tropicalis	2.1
		C.parapsilosis	2.1
C.krusei	2.1
		C.glabrata	2.1
Aspergillus fumigatus	38.3

- 8 pairs of the table In-patient sample PCR detections selected at random and G or GM test coincidence rate

	Sample number	PCR tests coincidence rate %
			GM is positive	20	75(15/20)
GM is negative	5	80(4/5)
			G is positive	14	92.9(13/14)
G is negative	6	33.3(2/6)

It is obtained by above-mentioned table -7 statistics, is not considering clinical effectiveness referring to before, PCR method is being used only, judgement is more than 80% Identification is Candida albicans (C.albicans) in sample, and it is sexy that this result meets documented invasion in open source literature Contaminate the characteristic distributions of fungi strain.In table -8, GM negative, positive equal coincidence rate > 70%, testing specific height with GM has It closes.G test portion positive rate is higher (comparing with actual clinical medical record information), and concrete reason may be interpreted as PCR methodology itself High sensitivity.The above results show the method for the present invention and existing G, and GM detection method has certain correlation, but sensitivity is more Height, and can confirm the specific strain of infection, thus early stage and immunotherapy targeted autoantibody according to strain specific aim medication, to fungal infection Directive significance is great.

Protection content of the invention is not limited to above embodiments.Under the spirit and scope without departing substantially from present inventive concept, Various changes and advantages that will be apparent to those skilled in the art are all included in the present invention, and are with appended claims Protection scope.

SEQUENCE LISTING

<110>DiaSys Diagnostic Systems (Shanghai) Co., Ltd.

<120>a kind of detection method of invasive infections with fungi, detection kit and application

<160> 26

<170> PatentIn version 3.3

<210> 1

<211> 18

<212> DNA

<213>artificial sequence

<400> 1

tgaagaacgc agcgaaat 18

<210> 2

<211> 18

<212> DNA

<213>artificial sequence

<400> 2

atatgcttaa gttcagcg 18

<210> 3

<211> 16

<212> DNA

<213>artificial sequence

<400> 3

catgcctgtt tgagcg 16

<210> 4

<211> 18

<212> DNA

<213>artificial sequence

<400> 4

gtcctacctg atttgagg 18

<210> 5

<211> 16

<212> DNA

<213>artificial sequence

<400> 5

taccgccgca agcaat 16

<210> 6

<211> 20

<212> DNA

<213>artificial sequence

<400> 6

tgaaataaat tgtggtggcc 20

<210> 7

<211> 20

<212> DNA

<213>artificial sequence

<400> 7

tggagtttgt accaatgagt 20

<210> 8

<211> 18

<212> DNA

<213>artificial sequence

<400> 8

ttcctacctg atttgagg 18

<210> 9

<211> 17

<212> DNA

<213>artificial sequence

<400> 9

ccctacctga tttgagg 17

<210> 10

<211> 18

<212> DNA

<213>artificial sequence

<400> 10

tccctacctg atccgagg 18

<210> 11

<211> 17

<212> DNA

<213>artificial sequence

<400> 11

catgcctgtc cgagcgt 17

<210> 12

<211> 16

<212> DNA

<213>artificial sequence

<400> 12

cgtgcgcaga gttggg 16

<210> 13

<211> 17

<212> DNA

<213>artificial sequence

<400> 13

tgtctgccca gcacgca 17

<210> 14

<211> 21

<212> DNA

<213>artificial sequence

<400> 14

cctacagagc aggtgacaaa g 21

<210> 15

<211> 22

<212> DNA

<213>artificial sequence

<400> 15

ggtgttgagc aatacgactt gg 22

<210> 16

<211> 22

<212> DNA

<213>artificial sequence

<400> 16

agacctaagc cattgtcaaa gc 22

<210> 17

<211> 20

<212> DNA

<213>artificial sequence

<400> 17

tggtattcca aagggcatgc 20

<210> 18

<211> 24

<212> DNA

<213>artificial sequence

<400> 18

ccacgttaaa ttctttcaaa caaa 24

<210> 19

<211> 19

<212> DNA

<213>artificial sequence

<400> 19

attgcgccct tagggcatg 19

<210> 20

<211> 23

<212> DNA

<213>artificial sequence

<400> 20

tccattagtt tatactccgc ctt 23

<210> 21

<211> 20

<212> DNA

<213>artificial sequence

<400> 21

ctgtttgagc gtcgtttcca 20

<210> 22

<211> 22

<212> DNA

<213>artificial sequence

<400> 22

tcctacctga tttgaggtcg ag 22

<210> 23

<211> 23

<212> DNA

<213>artificial sequence

<400> 23

ccatatcagt atgtgggaca cga 23

<210> 24

<211> 21

<212> DNA

<213>artificial sequence

<400> 24

atccctccct agatcaacac c 21

<210> 25

<211> 19

<212> DNA

<213>artificial sequence

<400> 25

attgcgccct tagggcatg 19

<210> 26

<211> 23

<212> DNA

<213>artificial sequence

<400> 26

tccattagtt tatactccgc ctt 23

Claims

1. a kind of detection method of invasive infections with fungi, which is characterized in that the method is, true in enriching and purifying sample to be tested Then bacterium dissociative DNA segment directly carries out one-step method nido+multi-fluorescence hybridization probe PCR of species-specific genes group segment (Nest-PCR+Multiplex-PCR) it detects, that is, according to fungi rDNA conserved region 5.8S, it is special that 18S, 28S design fungi Property nest-type PRC primer, according to the area amplified fragments Zhong ITS design fungi species specificity detect fluorescence probe, it is more by PCR It reacts again and the sample to be tested fungi strain is distinguished and identified.

2. the method as described in claim 1, which is characterized in that the fungi is Candida albicans Candida albicans, Candida tropicalis Candida tropicalis, Candida parapsilosis Candida parapsilosis, candida krusei It is arbitrary in Candida krusei, Candida glabrata Candida glabrata, aspergillus fumigatus Aspergillus fumigtus One or more of combinations.

3. the method as described in claim 1, which is characterized in that the detection target of the method is the fungi trip in clinical sample From DNA fragmentation.

4. the method as described in claim 1, which is characterized in that under the premise of using the characteristic of the higher sensitivity of nest-type PRC, A step single tube is merged into the nest-type PRC reaction that multiple multitube is completed step by step of conventional need to complete.

5. the method as described in claim 1, which is characterized in that the fungi specificity nido PCR primer includes following sequence The primer of column combines:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 1-2,5 ' -3 ' sequences: GTCCTACCTGATTTGAGG (SEQ ID NO.4)；

Combined with the primer it is corresponding, the fungi species specificdetection fluorescence probe be following sequence it is arbitrary one kind or it is several The combination of kind:

5 ' -3 ' sequence of strain specific detection fluorescence probe of Candida albicans (Candida albicans) are as follows: TACCGCCGCAAGCAAT(SEQ ID NO.5)；

5 ' -3 ' sequence of strain specific detection fluorescence probe of candida tropicalis (Candida tropicalis) are as follows: TGAAATAAATTGTGGTGGCC(SEQ ID NO.6)；

5 ' -3 ' sequence of strain specific detection fluorescence probe of Candida parapsilosis (Candida parapsilosis) are as follows: TGGAGTTTGTACCAATGAGT(SEQ ID NO.7)。

6. the method as described in claim 1, which is characterized in that the fungi specificity nido PCR primer includes following sequence The primer of column combines:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 2-2,5 ' -3 ' sequences: TTCCTACCTGATTTGAGG (SEQ ID NO.8)；

Downstream primer 2-3,5 ' -3 ' sequences: CCCTACCTGATTTGAGG (SEQ ID NO.9)；

Upstream primer 2-4,5 ' -3 ' sequences: TCCCTACCTGATCCGAGG (SEQ ID NO.10)；

Downstream primer 2-5,5 ' -3 ' sequences: CATGCCTGTCCGAGCGT (SEQ ID NO.11)；

5 ' -3 ' sequence of strain specific detection fluorescence probe of candida krusei (Candida krusei) are as follows: CGTGCGCAGAGTTGGG(SEQ ID NO.12)；

5 ' -3 ' sequence of strain specific detection fluorescence probe of Candida glabrata (Candida glabrata) are as follows: TGTCTGCCCAGCACGCA(SEQ ID NO.13)；

5 ' -3 ' sequence of strain specific detection fluorescence probe of aspergillus fumigatus (Aspergillus fumigtus) are as follows: CCTACAGAGCAGGTGACAAAG(SEQ ID NO.14)。

7. such as method described in claim 5 or 6, which is characterized in that in the fungi species specificdetection fluorescence probe sequence Two terminally chemically modified include:

The end 5': appoint using in FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, Cy5 fluorescent dye groups It anticipates the combined chemical modification of three kinds of dyestuffs；With,

The end 3': using the chemical modification of BHQ1 or BHQ2 or 3IABkFQ or 3IAbRQSp quenching group.

8. such as method described in claim 5 or 6, which is characterized in that the fungi species specificdetection fluorescence probe sequence is 3 ' MGB modification.

9. the method as described in claim 1, which is characterized in that described method includes following steps:

1) dissociative DNA in clinical sample is extracted and is enriched with；

2) Multiplex fluorescent PCR amplification is carried out to the dissociative DNA for extracting and being enriched with；

3) interpretation of result and judgement: the Ct value arrived according to every part of clinical sample in each Air conduct measurement marks base by specific probe Group determines the specific fungi strain type belonging to it.

10. method as claimed in claim 9, which is characterized in that in the multiplex PCR, annealing temperature between 55-67 DEG C, Pcr amplified fragment length is 50bp-500bp；Primer final concentration range is between 0.5-0.05uM；The final concentration model of each probe It encloses are as follows: 1nM-15nM.

11. a kind of fungi Genus-specific primers and fungi species specificdetection fluorescence for detecting invasive infections with fungi are visited Needle, which is characterized in that the fungi is fungi Candida albicans (Candida albicans), candida tropicalis (Candida Tropicalis), any one or a few combination of Candida parapsilosis (Candida parapsilosis)；Wherein, institute State the primer combination that fungi specificity nido PCR primer includes following sequence:

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 1-2,5 ' -3 ' sequences: GTCCTACCTGATTTGAGG (SEQ ID NO.4)；

Correspondingly, the fungi species specificdetection fluorescence probe is arbitrary one or more of combination of following sequence:

Candida tropicalis (Candida tropicalis) 5 ' -3 ' sequences: TGAAATAAATTGTGGTGGCC (SEQ ID NO.6)；

Candida parapsilosis (Candida parapsilosis) 5 ' -3 ' sequences: TGGAGTTTGTACCAATGAGT (SEQ ID NO.7)；

And/or

The fungi is candida krusei (Candida krusei), Candida glabrata (Candida glabrata), aspergillus fumigatus Any one or a few combination of (Aspergillus fumigtus)；Wherein, the fungi nest-type PRC specific primer packet Include the primer combination of following sequence；

1,5 ' -3 ' sequence of upstream primer: TGAAGAACGCAGCGAAAT (SEQ ID NO.1)；

1,5 ' -3 ' sequence of downstream primer: ATATGCTTAAGTTCAGCG (SEQ ID NO.2)；

Upstream primer 1-1,5 ' -3 ' sequences: CATGCCTGTTTGAGCG (SEQ ID NO.3)；

Downstream primer 2-2,5 ' -3 ' sequences: TTCCTACCTGATTTGAGG (SEQ ID NO.8)；

Downstream primer 2-3,5 ' -3 ' sequences: CCCTACCTGATTTGAGG (SEQ ID NO.9)；

Upstream primer 2-4,5 ' -3 ' sequences: TCCCTACCTGATCCGAGG (SEQ ID NO.10)；

Downstream primer 2-5,5 ' -3 ' sequences: CATGCCTGTCCGAGCGT (SEQ ID NO.11)；

12. the fungi Genus-specific primers and fungi kind as claimed in claim 11 for detecting invasive infections with fungi are special Detect fluorescence probe, which is characterized in that further comprise fungi species specificdetection fluorescence probe of the both ends through chemical modification；It is described Chemical modification includes: the end 5': using FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, Cy5 fluorescent dye The combined chemical modification of any three kinds of dyestuffs in group；With the end 3': using BHQ1 or BHQ2 or 3IABkFQ or 3IAbRQSp The chemical modification of quenching group.

13. a kind of for detecting the kit of invasive infections with fungi, which is characterized in that the kit includes such as claim Fungi Genus-specific primers described in 8 and fungi species specificdetection fluorescence probe.

14. kit as claimed in claim 13, which is characterized in that the kit includes: containing positioned at each fungi of rDNA The positive plasmid standard items of strain kind specific section.

15. a kind of application of kit according to claim 13 or 14 in invasive fungi is distinguished and identified.