CN109055502B - Detection method, detection kit and application of invasive fungal infection - Google Patents
Detection method, detection kit and application of invasive fungal infection Download PDFInfo
- Publication number
- CN109055502B CN109055502B CN201810899103.4A CN201810899103A CN109055502B CN 109055502 B CN109055502 B CN 109055502B CN 201810899103 A CN201810899103 A CN 201810899103A CN 109055502 B CN109055502 B CN 109055502B
- Authority
- CN
- China
- Prior art keywords
- candida
- sequence
- seq
- fungus
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention provides a rapid multiplex PCR (polymerase chain reaction) identification and diagnosis detection method for invasive fungal infection based on free fungal DNA (cfDNA), which can identify invasive infection caused by clinically common and high-incidence Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus). The invention designs an amplification primer according to the characteristic genome segment of each fungus genus and species, designs a detection fluorescent probe capable of distinguishing strains according to the amplification fragment, carries out real-time fluorescent PCR (real time PCR) on a sample to be detected, and identifies the fungus strains by integrating the advantages of high sensitivity of nested PCR and high specificity and multi-target property of multiple fluorescent hybridization probe PCR. The invention also provides a PCR diagnostic kit for invasive fungal infection and application thereof.
Description
Technical Field
The invention belongs to the technical field of biomedical detection, relates to a rapid detection method for invasive fungal infection, and particularly relates to a method for identifying and diagnosing invasive infection caused by common and high-incidence fungi in clinic by adopting a multiple PCR (polymerase chain reaction) technology based on free DNA (cfDNA) of fungi, application and a detection kit.
Background
In recent years, with the accelerated aging of the population, the incidence of diseases such as tumors and immunodeficiency has increased, solid organ and hematopoietic stem cell transplantation has rapidly progressed, and the incidence of invasive mycosis has increased year by year with the large-scale use of antibiotics and immunosuppressants. However, the current diagnosis method is limited, the early accurate diagnosis cannot be realized, and the optimal treatment time is easy to be delayed, so that the clinical prognosis is poor, and the death rate is high.
Methods for the pathogenic diagnosis of invasive mycoses include traditional methods and non-culture methods. Traditional methods include fungal microscopy, culture and histopathological examination. Fungal microscopic examination and histopathological examination can reflect the parasitic form of fungi in tissues, but pathogenic bacteria species cannot be determined; fungal culture is a gold standard, and drugs are selected according to drug sensitivity, but the culture is long in time consumption and low in sensitivity, and the culture may be required for many times or not at all, so that the optimal treatment time is extremely easy to lose. Non-culture methods, i.e., serological assays, include GM assays and G assays. The GM test can be used as a basis for diagnosing invasive aspergillosis, but the sensitivity can be as low as 50 percent in some cases, and the influence factors are many, and the false positive rate is as high as 18 percent. The G test is listed as a diagnostic standard of invasive mycosis, but cannot identify pathogenic strains, cannot be used for detecting infection of zygococcus and cryptococcus and has higher false positive. Therefore, the current clinical fungal infection detection technology has the problems of long time consumption, poor repeatability, high false positive rate, incapability of accurately distinguishing strains and the like, and cannot meet the clinical requirements. The development of a rapid and accurate pathogenic fungus detection method has important significance for clinical early diagnosis and accurate treatment.
The molecular biology method mainly achieves the dual purposes of detection and identification by detecting the specific gene sequence of the pathogenic fungi. A prospective study of Florent and the like as early as 2006 proves the value of the PCR-ELISA technology in the early diagnosis of invasive aspergillosis, and PCR positive can be earlier than clinical signs, imaging change or culture positive for 5-19.5 days and earlier than GM test for 17 days. The fluorescent quantitative PCR technology can identify zygomycetes and other filamentous fungi which are difficult to distinguish by histopathological examination, and the sensitivity and the specificity can reach 100 percent. Therefore, compared with other technologies, the molecular biological method based on the PCR technology has the advantages of simplicity, convenience, rapidness, sensitivity and the like. Compared with the detection of other pathogenic microorganisms, the detection of the fungal nucleic acid mainly has the following technical difficulties that (1) the detection of the fungal nucleic acid is extremely easy to be polluted by fungal spores widely existing in the environment in the experimental operation, and misdiagnosis is caused due to high PCR detection sensitivity; (2) the fungal cell wall is firm and difficult to be cracked by a conventional technical means, so that the experiment is complicated, the error rate is increased, and the detection cost is increased; (3) the number of pathogenic bacteria in the early stage of invasive fungal infection is low and cannot be easily detected. Therefore, the development of a diagnostic kit suitable for clinical use, which can overcome these technical difficulties, is a necessary trend in the development of molecular diagnosis of fungi.
The detection of extracellular free DNA (cfDNA) is a hot spot field of the current noninvasive in vitro diagnosis, is mainly and intensively applied to prenatal genetic screening and early diagnosis of genetic diseases such as tumors and the like, has more methodological research reports, but has no report of applying the fungus cfDNA to detection so far.
Disclosure of Invention
The invention creatively utilizes the technology of combining the fungus cfDNA with the PCR technology to realize the diagnosis of the fungus infection and the identification of the drug-resistant strains. The invention provides a detection method of invasive fungal infection, which comprises the following steps: enriching and purifying fungus free DNA (cfDNA) fragments in a sample to be detected (such as peripheral blood serum and the like), and then directly carrying out one-step nested + fluorescent hybridization probe multiplex PCR detection and identification on species-specific genome fragments, namely, designing a fungus genus specific primer according to fungus rDNA conserved regions (5.8S, 18S and 28S), designing a fungus species specific detection fluorescent probe according to an ITS region in an amplified fragment, carrying out real-time fluorescent quantitative PCR on the sample to be detected, and distinguishing and identifying possible fungus species in the sample to be detected through PCR multiplex reaction. The invention relates to a rapid and multi-step nested PCR identification and diagnosis method for invasive fungal infection based on cell free DNA (cfDNA).
In the invention, the detection target of the method is fungus free DNA (cfDNA) in a clinical sample.
On the premise of utilizing the characteristic of higher sensitivity of the nested PCR, the method combines the conventional nested PCR reaction which needs to be finished by multiple steps and multiple tubes into one step and one single tube by utilizing the optimized combination of the universal nested primer and the specific probe and the setting of reaction conditions, thereby realizing the combination of detection sensitivity and simplified operation.
Wherein the fungi comprise any one or combination of Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus).
The invention innovatively utilizes the technology of combining the fungus cfDNA with the PCR technology to realize the diagnosis and detection of the fungus infection, and the innovation points comprise: firstly, the method for detecting the extracellular free DNA (cfDNA) is applied to the field of fungal infection detection, and species-specific genome fragment detection is directly carried out after fungus cfDNA fragments in a sample are enriched, so that the interference of exogenous fungi (spores) is avoided, and misdiagnosis caused by the interference is avoided. Secondly, cell lysis is not needed, so that the operation process is simplified, the technical requirements are reduced, the possibility of pollution caused by exogenous fungi and the like is further avoided, and the specificity and the reliability of detection are improved; meanwhile, the labor is saved, and the detection cost is reduced. In addition, the invention also adopts a strategy of nested + multiple fluorescent hybridization probe PCR (Nest-PCR + multiple-PCR), and is characterized in that a nested amplification PCR technology (Nest-RCR) with higher sensitivity is combined with a fluorescent hybridization probe technology with higher specificity and multi-target property; through the combined application of the optimized nested PCR (Nest-PCR) and the multiplex fluorescent hybridization probe PCR, the problem that the content of fungus cfDNA in a sample is relatively low is pertinently solved, the detection sensitivity is improved, and the specificity of a result is ensured. Furthermore, the invention optimizes and improves the reaction conditions of the nested + multiple fluorescent hybridization probe PCR, completes all reactions in one step, avoids the possibility of operation error and external pollution caused by midway sample adding, and further improves the reliability of the result.
The invention provides a method for treating the most common invasive fungus clinically in clinical samples such as serum, plasma, tissue lavage fluid and the like according to a fungus rDNA conserved region (5.8S, 18S, 28S) and an ITS region based on fungus free DNA: multiplex PCR identification and diagnostic detection methods were carried out on Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), Candida krusei (Candida krusei), Candida glabrata (Candida glabrata), and Aspergillus fumigatus (Aspergillus fumigatus).
The invention sets specific amplification primers and specific detection fluorescent probes according to rDNA conserved regions (5.8S, 18S and 28S) and ITS regions of fungi Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis) and Candida parapsilosis (Candida parapsilosis). The fungus genus specific nested PCR primer comprises a primer combination of the following sequences, namely, the primer combination of rDNA conserved region (5.8S, 18S, 28S) amplification primers is as follows:
upstream primer 1, 5 '-3' sequence: TGAAGAACGCAGCGAAAT (SEQ ID NO. 1);
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 1-2, 5 '-3' sequence: GTCCTACCTGATTTGAGG (SEQ ID NO. 4).
Corresponding to the primer combination, when the fluorescent probe for specifically detecting the fungal species corresponding to Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis) and Candida parapsilosis (Candida parapsilosis) is contained, the method can accurately detect and distinguish the specific species in the sample to be detected. Namely, the fungus species specific detection fluorescent probe is any one or combination of several of the following sequences:
candida albicans (Candida albicans)5 '-3' sequence: TACCGCCGCAAGCAAT (SEQ ID NO. 5);
candida tropicalis (Candida tropicalis)5 '-3' sequence: TGAAATAAATTGTGGTGGCC (SEQ ID NO. 6); and/or the presence of a gas in the gas,
candida parapsilosis (Candida parapsilosis)5 '-3' sequence: TGGAGTTTGTACCAATGAGT (SEQ ID NO. 7).
By adopting the method, the fungal infection caused by one, two or three of Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis) and Candida parapsilosis (Candida parapsilosis) can be accurately detected and determined from clinical samples, and the specific infected strain can be detected and determined.
In the method of the invention, specific amplification primers and specific detection fluorescent probes are arranged according to the fungi Candida krusei (Candida krusei), Candida glabrata (Candida glabrata), Aspergillus fumigatus (Aspergillus fumigatus) rDNA conserved regions (5.8S, 18S, 28S) and ITS regions. The fungus genus specific nested PCR primer comprises the following primer combination, namely, the combination of rDNA conserved region (5.8S, 18S, 28S) amplification primers is as follows:
upstream primer 1, 5 '-3' sequence: TGAAGAACGCAGCGAAAT (SEQ ID NO. 1);
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 2-2, 5 '-3' sequence: TTCCTACCTGATTTGAGG (SEQ ID NO. 8);
downstream primer 2-3, 5 '-3' sequence: CCCTACCTGATTTGAGG (SEQ ID NO. 9);
the upstream primer 2-4, 5 '-3' sequence: TCCCTACCTGATCCGAGG (SEQ ID NO. 10);
downstream primer 2-5, 5 '-3' sequence: CATGCCTGTCCGAGCGT (SEQ ID NO. 11).
Corresponding to the primer combination, when the fluorescent probe for specifically detecting the fungal species corresponding to Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus) is contained, whether a sample to be detected is infected with a specific strain or not can be accurately detected and distinguished by adopting the method; namely, the fungus species specific detection fluorescent probe is any one or combination of several of the following sequences:
c. krusei (Candida krusei)5 '-3' sequence: CGTGCGCAGAGTTGGG (SEQ ID NO. 12);
candida glabrata (Candida glabrata)5 '-3' sequence: TGTCTGCCCAGCACGCA (SEQ ID NO. 13);
aspergillus fumigatus (Aspergillus fumigatus) 5 '-3' sequence: CCTACAGAGCAGGTGACAAAG (SEQ ID NO. 14).
By the method of the present invention, it is possible to accurately detect and determine from a clinical sample whether the sample is infected with an infection caused by any one, two and/or any combination of Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus), and to detect and determine the specific species infected therewith.
Specifically, the invention provides nested + multiplex fluorescent hybridization probe PCR detection of fungal species based on the most common clinical invasive infection of fungal free DNA, specifically detecting Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus) in clinical samples such as serum, plasma and tissue lavage fluid. Specific amplification primers are arranged in rDNA conserved regions (5.8S, 18S and 28S), a strain specific detection fluorescent probe is designed according to an ITS region, and real-time fluorescent PCR (polymerase chain reaction) detection is carried out on a sample to be detected. Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis), Candida parapsilosis (Candida parapsilosis), Candida krusei (Candida krusei), Candida glabrata (Candida glabrata), and Aspergillus fumigatus (Aspergillus fumigatus) were identified and distinguished by two single-tube multiplex reactions.
Wherein the primers for identifying Candida albicans (Candida albicans), Candida tropicalis (Candida tropicalis) and Candida parapsilosis (Candida parapsilosis) are as follows:
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 1-2, 5 '-3' sequence: GTCCTACCTGATTTGAGG (SEQ ID NO. 4).
The specific detection fluorescent probe (5 'marked fluorescent group and 3' marked quenching group) is as follows:
candida albicans (Candida albicans)5 '-3' sequence: TACCGCCGCAAGCAAT (SEQ ID NO. 5);
candida tropicalis (Candida tropicalis)5 '-3' sequence: TGAAATAAATTGTGGTGGCC (SEQ ID NO. 6); and
candida parapsilosis (Candida parapsilosis)5 '-3' sequence: TGGAGTTTGTACCAATGAGT (SEQ ID NO. 7).
Further, the two chemical modifications on the probe sequence are:
5' end: any three dyes in FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red and Cy5 fluorescent dye groups; and (c) and (d),
3' end: BHQ1 or BHQ2 or 3IABKFQ or 3IAbRQSP quenching group, and any combination of the three selected 5' end fluorescent groups;
preferably, the 3' end is modified using MGB.
Wherein the primers for Candida krusei (Candida krusei), Candida glabrata (Candida glabrata) and Aspergillus fumigatus (Aspergillus fumigatus) are as follows:
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 2-2, 5 '-3' sequence: TTCCTACCTGATTTGAGG (SEQ ID NO. 8);
downstream primer 2-3, 5 '-3' sequence: CCCTACCTGATTTGAGG (SEQ ID NO. 9);
the upstream primer 2-4, 5 '-3' sequence: TCCCTACCTGATCCGAGG (SEQ ID NO. 10); and
downstream primer 2-5, 5 '-3' sequence: CATGCCTGTCCGAGCGT (SEQ ID NO. 11); combinations of (a) and (b).
Wherein, the specific detection fluorescent probe (5 'marked fluorescent group, 3' marked quenching group) is as follows:
candida krusei (Candida krusei)5 '-3' sequence: CGTGCGCAGAGTTGGG (SEQ ID NO. 12);
candida glabrata (Candida glabrata)5 '-3' sequence: TGTCTGCCCAGCACGCA (SEQ ID NO. 13);
aspergillus fumigatus (Aspergillus fumigatus) 5 '-3' sequence: CCTACAGAGCAGGTGACAAAG (SEQ ID NO. 14).
Further, the two ends of the probe sequence are chemically modified as follows:
5' end: any three dyes in FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red and Cy5 fluorescent dye groups; and the combination of (a) and (b),
3' end: BHQ1 or BHQ2 or 3IABKFQ or 3IAbRQSP quenching group, and any combination of the three selected 5' end fluorescent groups;
preferably, the 3' end is modified using MGB.
The multiple PCR detection method for invasive fungal infection provided by the invention comprises the following steps:
1) enriching and purifying sample cfDNA: a whole blood small fragment DNA extraction kit from companies such as Diasys and QIAGEN available on the market can be used.
2) Fluorescent PCR amplification: and (3) preparing a PCR reaction system according to the PCR operation flow, and amplifying and detecting according to total denaturation and circulation (including denaturation, annealing and extension steps or including denaturation and annealing extension steps) on a fluorescent PCR instrument with a detection channel matched with the probe.
Preferably, the fluorescent PCR amplification is a three-color fluorescent PCR amplification: preparing a PCR reaction system according to the PCR operation flow, amplifying according to total denaturation and circulation (including denaturation, annealing and extension steps or including denaturation and annealing extension steps) on a fluorescent PCR instrument on a detection channel matched with the probe, and synchronously detecting by three colors.
In the real-time fluorescent quantitative PCR, the annealing temperature is between 55 and 67 ℃, and the length of a PCR amplified fragment is between 50 and 500 bp; the final concentration range of the primers is between 0.5 and 0.05 uM. The final concentration range for each probe was: 1nM to 15 nM.
Preferably, in the real-time fluorescent quantitative PCR, the annealing temperature is set to be two stages, the first-stage annealing temperature is 65-61 ℃, the cycle number is 3-10 cycles, the second-stage annealing temperature is 63-57 ℃, and the cycle number is 38-45 cycles.
Preferably, in the real-time fluorescence quantitative PCR, the length of the PCR amplification fragment is 100-350 bp.
Preferably, in the real-time fluorescence quantitative PCR, the concentration of the amplified genome DNA ranges from 0.08 uM to 0.02 uM.
Preferably, in the real-time fluorescent quantitative PCR, the final concentration range of each probe is: 2nM to 10 nM.
3) Analyzing and judging results: and judging the specific fungus strain type through specific probe marking groups according to the Ct value detected by each sample in each channel.
The invention also provides a detection kit for detecting invasive fungal infection. The kit comprises the fungus genus specific primer and a fungus species specific detection fluorescent probe.
Further, the kit comprises PCR amplification reaction reagents; the RCR amplification reaction reagent comprises a PCR reaction reagent mix (mixed solution), a PCR primer probe mix-1 (primer and probe mixed solution 1) and a PCR primer probe mix-2 (primer and probe mixed solution 2).
Further, the kit comprises: contains positive plasmid standard substance located in specific section of rDNA fungus strain.
Further, the kit comprises: PCR reaction buffer system, Hot-start Taq enzyme.
The invention also provides application of the detection kit for detecting the invasive fungal infection, and provides application of a reagent of a rapid detection method for the invasive fungal infection based on free DNA (cell free DNA, cfDNA) of fungi. The application comprises the fungus genus specific primer and the fungus species specific detection fluorescent probe, and the kit can be used for distinguishing and identifying invasive fungi.
In the kit and the application thereof, the kit further comprises chemical modifications at two ends of the probe sequence, and the chemical modifications comprise: 5' end: any three dyes in FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red and Cy5 fluorescent dye groups; 3' end: BHQ1 or BHQ2 or 3IABKFQ or 3IAbRQSP quenching group, and any combination of the three 5' end fluorescent groups selected above.
In particular, the invention provides a kit system aiming at clinically relevant samples. For example, the main composition of the kit (48 persons) is shown in the following Table-1:
TABLE-1 invasive fungus detection kit
The PCR reaction reagent mix mainly comprises the following components: 2X buffer solution + dNTPs + Mg ++ +hot-start Taq；
The PCR primer probe mix mainly comprises the following components: upstream and downstream primers + TaqMan probes;
positive control 1: a plasmid containing a mixture of fragments of Candida albicans, Candida tropicalis and Candida parapsilosis;
positive control 2: a plasmid containing a mixture of fragments of Candida krusei, Candida glabrata and Aspergillus fumigatus;
negative control: an empty plasmid.
A suitable Real Time PCR amplifer:
Applied Biosystems 7900HT/7300/7500 Real-Time PCR System、7500 Fast Real-Time PCR System、StepOnePlus TM Real-Time PCR System(Applied Biosystems)、
(Roche Diagnostics)、CFXTouch TM (Bio-Rad)。
reagent transport and storage conditions:
the kit can be transported at 2-8 ℃. During storage, the product should be stored at-20 ℃.
The validity period is as follows: the effective period of the kit is 12 months, and the kit is used in the effective period.
The principle of the kit is as follows:
the kit uses Hot-start Taq enzyme to carry out PCR amplification, and achieves the aim of detecting the amplification of a PCR product by hydrolyzing the change of fluorescence intensity released by a TaqMan probe through the Taq enzyme in reaction liquid. The fungus genome sequence containing the conservation region (5.8S, 18S, 28S) and ITS region of fungus rDNA is used for PCR amplification, and TaqMan probe is used for realizing the identification and the distinction of each strain. Because the DNA polymerase in the kit uses the Hot-start Taq enzyme, the nonspecific amplification at normal temperature is inhibited, and the accuracy of PCR amplification is greatly improved.
TaqMan multiplex fluorescence assay:
TaqMan probes marked by FAM, VIC/ROX and CY5 are hybridized with target fragments and hydrolyzed by Taq enzyme to emit fluorescence, and specific fluorescence in a reaction system is detected to achieve the purposes of detecting, identifying and distinguishing specific fungus strains (candida albicans, candida tropicalis, candida glabrata, candida krusei, candida glabrata and aspergillus fumigatus).
The kit is characterized in that:
the kit is suitable for various conventional Real-Time PCR reaction platforms, and can be used for quickly and accurately detecting and analyzing invasive infection caused by candida albicans, candida tropicalis, candida glabrata, candida krusei, candida glabrata and aspergillus fumigatus in human serum, plasma and lavage fluid, and determining specific infected strains. When the PCR reaction solution is prepared, a primer probe is mixed into a reaction system, and then a template is added to perform Real-Time PCR reaction, so that the operation is simple and convenient. The DNA polymerase uses Hot-start DNA polymerase, and is combined with a Buffer system independently developed by a company, so that the DNA polymerase has the characteristics of high amplification efficiency, high amplification sensitivity and high amplification specificity.
The invention also has the following beneficial effects: in methodology, the nested + multiplex fluorescent hybridization probe PCR detection is applied to realize the instant observation of the detection result. The detection time is as short as 1.5-3 hours, the operation is simple and convenient, and the method is beneficial to wide popularization and application in practice. The kit provided by the invention applies the extracellular free DNA (cfDNA) detection method to the field of fungal infection detection for the first time, and directly detects the species-specific genome fragment after enriching the fungal cfDNA fragment in the sample, so that the pathogenic fungal nucleic acid detection kit without cell lysis and nucleic acid extraction is developed. The advantages are as follows: 1. fungi (spores) in the environment have no influence on the detection result, so that the misdiagnosis rate is effectively reduced, and the detection reliability is improved; 2. the detection steps are simplified, and the operation is simpler and faster; 3. the detection cost is reduced. The kit disclosed by the invention is carried out by adopting a strategy of nested + multiple fluorescent hybridization probe PCR (Nest-PCR + Mutiplex-PCR). It is characterized by combining a Nest type amplification PCR technology (Nest-RCR) with higher sensitivity with a fluorescent hybridization probe technology with higher specificity. Firstly, the problem of relatively low cfDNA content is overcome in a targeted manner by utilizing the characteristic of high sensitivity of the nested PCR. Secondly, the reaction conditions of the nested + multiple fluorescent hybridization probe PCR are optimized and improved, all the reactions are completed in one step, the high sensitivity of the nested PCR is considered, the possibility of introducing errors during the midway sample adding is avoided, and the reliability of the result is improved.
Drawings
FIG. 1 is a schematic diagram showing the design target segments of the probe and the primer of the present invention.
FIG. 2 is a schematic diagram showing a specific implementation manner of the multiplex PCR primer probe for fungal species identified in the present invention, wherein the position of the specific multiplex detection TaqMan probe (ITS region) and the position of the amplification region (5.8s,28s,18s) of the nested PCR primer (arrow mark) are marked by solid lines. Nested PCR amplification is achieved by different annealing temperatures at two stages in a single reaction.
FIG. 3 shows the amplification curves (TaqMan probes) of positive clone plasmids of different concentrations (Weak Yang, Strong Yang, and Strong Yang) in the present invention. Wherein FIG. 3A shows an amplification curve of Candida albicans positive plasmid (wherein the reaction cycle number on the abscissa is 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence value on the ordinate is 0.099, 0.899, 1.699, 2.499, 3.299, 4.099, 4.899, 5.699, 6.499, 7.299, 8.099); FIG. 3B shows an amplification curve of Candida tropicalis-positive plasmid (wherein the number of reaction cycles on the abscissa is 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence on the ordinate is 0.242, 0.942, 1.642, 2.342, 3.042, 3.742, 4.442, 5.142, 5.842, 6.542, 7.242); FIG. 3C shows the amplification curves of Candida parapsilosis positive plasmids (in which the numbers of reaction cycles on the abscissa are 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence values on the ordinate are-0.118, 0.582, 1.282, 1.982, 2.682, 3.382, 4.082, 4.782, 5.482, 6.182, 6.882, 7.582).
FIG. 4 shows the amplification curves (TaqMan probes) of positive clone plasmids of different concentrations (Weak Yang, Strong Yang, and Strong Yang) in the present invention. Wherein, FIG. 4A shows the Candida krusei positive plasmid amplification curve (wherein, the reaction cycle number of the abscissa is 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence value of the ordinate is 0.394, 1.194, 1.994, 2.794, 3.594, 4.394, 5.194, 5.994, 6.794, 7.594, 8.394); FIG. 4B shows the Candida glabrata positive plasmid amplification curve (in which the numbers of reaction cycles on the abscissa are 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence values on the ordinate are 0.216, 0.916, 1.616, 2.316, 3.016, 3.716, 4.416, 5.116, 5.816, 6.516, 7.216); FIG. 4C shows the amplification curve of the Aspergillus fumigatus positive plasmid (wherein the number of reaction cycles on the abscissa is 5, 10, 15, 20, 25, 30, 35; and the relative fluorescence on the ordinate is-0.151, 0.549, 1.249, 1.949, 2.649, 3.349, 4.049, 4.749, 5.449, 6.149, 6.849, 7.549).
Detailed Description
The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings/tables, and the present invention is not limited to the following examples. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, and the scope of the appended claims is intended to be protected. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.
Example 1:
verification of the method of the invention with a Positive plasmid sample
In this example, the method of the present invention was used to perform PCR detection on plasmids of each positive strain, and it was verified that the reaction system of the method of the present invention can specifically identify candida albicans, candida tropicalis, candida glabrata, or candida krusei, candida glabrata, or aspergillus fumigatus at one time through a single-tube multiplex reaction without cross reaction. Each reaction contains the positive plasmids of each strain, and the positive plasmids of each strain are prepared into a sample to be detected (the plasmid concentration is 10) singly or after being combined 2 Copy/. mu.L).
The implementation method comprises the following steps:
1. preparation of positive plasmid of strain
1.1. Designing a primer: the primer sequences of the positive plasmids of each strain are designed and constructed by respectively referring to the reported rDNA sequences (comprising 5.8s,18s,28s and ITS regions) of each strain:
candida albicans:
the 5 '-3' sequence of the upstream primer: GGTGTTGAGCAATACGACTTGG (SEQ ID NO.15)
The 5 '-3' sequence of the downstream primer: AGACCTAAGCCATTGTCAAAGC (SEQ ID NO.16)
Candida tropicalis:
the 5 '-3' sequence of the upstream primer: TGGTATTCCAAAGGGCATGC (SEQ ID NO.17)
The 5 '-3' sequence of the downstream primer: CCACGTTAAATTCTTTCAAACAAA (SEQ ID NO.18)
Candida glabrata:
the 5 '-3' sequence of the upstream primer: ATTGCGCCCTTAGGGCATG (SEQ ID NO.19)
The 5 '-3' sequence of the downstream primer: TCCATTAGTTTATACTCCGCCTT (SEQ ID NO.20)
Candida krusei:
the 5 '-3' sequence of the upstream primer: CTGTTTGAGCGTCGTTTCCA (SEQ ID NO.21)
The 5 '-3' sequence of the downstream primer: TCCTACCTGATTTGAGGTCGAG (SEQ ID NO.22)
Candida glabrata:
the 5 '-3' sequence of the upstream primer: CCATATCAGTATGTGGGACACGA (SEQ ID NO.23)
The 5 '-3' sequence of the downstream primer: ATCCCTCCCTAGATCAACACC (SEQ ID NO.24)
Aspergillus fumigatus:
the 5 '-3' sequence of the upstream primer: ATTGCGCCCTTAGGGCATG (SEQ ID NO.25)
The 5 '-3' sequence of the downstream primer: TCCATTAGTTTATACTCCGCCTT (SEQ ID NO. 26).
1.2. The rDNA sequences of each strain (including 5.8s,18s,28s and ITS regions) were cloned using the following PCR reaction system:
adding a PCR reaction system into a 200 mu L trace PCR reaction tube:
the reaction conditions were 8 min at 94 ℃ for total denaturation, 35 cycles (94 ℃ for 25 sec, 62 ℃ for 20 sec, 72 ℃ for 35 sec).
Cloning of PCR products: the amplified PCR fragment was recovered with a PCR product recovery kit, the end was blunted with T4DNA polymerase (T4DNA polymerase, NEB BioLabs), and then subjected to agarose gel electrophoresis, and the target fragment was recovered and purified with a gel recovery kit, and then inserted into the EcoRV site on pBluescript II SK (+) vector, as described in detail in the literature (Sambrooks, molecular cloning Manual), and finally the ligation product was transformed into DH 5. alpha. strain, and positive clones were selected by PCR.
1.4. And (3) carrying out DNA sequence determination on the positive clone, wherein the sequencing result is consistent with the sequence of the gene bank or the public reported sequence.
The Real-time PCR reaction system is as follows:
2. setting of reaction conditions (Standard two-step method)
Total denaturation 95 ℃ for 5 min, 5 cycles (94 ℃ for 15 sec, 63 ℃ for 15 sec, 72 ℃ for 25 sec), 38 cycles (94 ℃ for 15 sec, 60 ℃ for 15 sec, 72 ℃ for 25 sec).
II, detecting results:
after the PCR reaction is finished, whether the Ct value of the fluorescence signal of each channel is consistent with the added positive sample strain is judged according to the Ct value, and when the detection signal is amplified (Ct is less than or equal to 35), the positive signal is judged, so that the effectiveness of the system for detecting each strain is proved. The results of the experiments are shown in Table-2:
table-2 results of detection determination of each positive plasmid ("+" containing positive plasmid, "-" having no positive plasmid) after adding a probe targeting c.albicans, c.tropicalis, c.paradosis to the reaction tube
Table-3 determination of each positive plasmid ("+" contains a positive plasmid, "-" has no positive plasmid) by adding probes targeting c.krusei (FAM), c.glabrata (ROX) and a.fumigatus to the reaction tube
In Table-2 and Table-3, when the detection signal (Ct. ltoreq.35) is amplified, it is determined as a positive signal: the corresponding signal channels of each strain are as follows: albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy 5). In the table, "+" indicates the addition of positive plasmids of the corresponding species, and "-" indicates the absence of positive plasmids of the corresponding species. In each reaction, the corresponding signal channel can be detected to be positive only when a probe corresponding to the positive plasmid is added, which shows that the system has good specificity, can specifically identify each fungus strain, and has no cross reaction. The multiplex detection system of the present invention can simultaneously and accurately distinguish and detect any combination of strains at a time under a lower target concentration without any errors such as false positives and false negatives. In conclusion, the embodiment shows that the specificity and the sensitivity of the detection system of the invention meet the design requirements, and the detection system can be used as an effective tool for quickly and conveniently diagnosing invasive fungal infection cause types.
Example 2:
strain identification testing using in vitro culture models infected with known strains
In this example, a sample of the culture supernatant from a defined fungal species in vitro mock (PBMC) was used to test whether the PCR system of the invention could differentiate species using free fungal DNA and was not affected by non-detectable target species. Through the embodiment, the kit is further proved to be suitable for distinguishing, identifying and detecting the fungus strains based on the fungus free DNA fragments, and the system specificity and the repeatability are good in the detection of in vitro simulated infection samples, and the kit is not influenced by other interference factors.
The implementation method comprises the following steps:
1. for the culture of known species, the supernatant was centrifuged and the DNA was extracted using Qiagen or Desai diagnostic System (Shanghai) Co.Ltd.blood DNA extraction kit.
The real-time PCR reaction system is as follows:
3. setting of reaction conditions
Total denaturation 95 ℃ for 5 min, 5 cycles (94 ℃ for 15 sec, 63 ℃ for 15 sec, 72 ℃ for 25 sec), 38 cycles (94 ℃ for 15 sec, 60 ℃ for 15 sec, 72 ℃ for 25 sec).
II, detecting results:
when the detection signal is amplified (Ct is less than or equal to 35), the signal is judged to be a positive signal: the corresponding signal channels of each strain are as follows: albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy 5). And after the PCR reaction is finished, judging specific strains in the screened sample according to the Ct value of the fluorescence signal of each channel.
TABLE-4 identification and detection of strains in vitro culture model
In 30 samples of the embodiment, the detection rate of 2 independent experiments of 2 times of the Candida albicans spore culture solution supernatant sample is 100% through a single blind experiment; and other interference factors have no influence. The system simulates the system specificity in an infection sample in vitro and has good repeatability.
As shown in Table-4, "-" in the table indicates no amplification signal or Ct > 35. In this example, 30 in total in vitro culture simulation samples of the determined strains are obtained, and the coincidence rate of the results obtained by using the kit and the method of the present invention and the known sequencing results is 100% after comparison. Therefore, the multiple PCR identification method based on the detection of the fungus free DNA fragment by the lysis fungus can be used for identifying the fungus in the real sample.
Example 3:
species identification test using animal fungal infestation infection model sera infected with known species
In this example, a sample of serum from an animal infection model to determine fungal species infection was used to determine whether the infectious species of the in vivo infection model could be identified by the methodology of the present invention. The embodiment further proves that the kit is suitable for distinguishing, identifying and detecting the fungus strains by gene free fungus DNA fragments, and shows that the system specificity and the repeatability are good in the detection of in vivo simulated infection samples without being influenced by other interference factors.
The implementation method comprises the following steps:
1. for mice treated differently (immunosuppressant treatment or no immunosuppressant treatment), a fungal culture of Candida albicans was injected via the tail vein, blood was taken after a certain number of days, serum samples were prepared, and DNA was extracted using a blood DNA extraction kit from Qiagen or Texas diagnostic System (Shanghai).
The real-time PCR reaction system is as follows:
3. setting of reaction conditions
Total denaturation 95 ℃ for 5 min, 5 cycles (94 ℃ for 15 sec, 63 ℃ for 15 sec, 72 ℃ for 25 sec), 38 cycles (94 ℃ for 15 sec, 60 ℃ for 15 sec, 72 ℃ for 25 sec).
II, detecting results:
when the detection signal is amplified (Ct is less than or equal to 35), the signal is judged to be a positive signal: the corresponding signal channels of each strain are as follows: c, albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy5), and after the PCR reaction is finished, the specific strain in the screened sample is judged according to the Ct value of the fluorescence signal of each channel.
TABLE-5 Strain identification test results with known fungal Strain infected animal models
In the above-mentioned Table-5, "+" indicates that the condition item in the left column in the table is "YES"/"Add", and "-" indicates that the condition item in the left column in the table is "NO"/"No". The mouse infection model test display system can detect the Candida albicans infection of mice with disease signs after inoculation. Negative mice had no false positive signals. And infected but constitutively healthy mice also had no positive signs. The results of two independent repeated tests of the system are consistent. The system can be used for strain identification and detection of clinical invasive fungal infection samples.
Example 4:
the method is verified by using randomly selected serum samples of suspected infected patients of fungi which are infected by unknown fungi strains in departments of hospitals and are detected to be positive by a G test, and compared with the detection methodology of the G test
In this example, all samples were determined to be positive by the G test using serum samples from patients suspected of fungal infection in various departments of the hospital. From this example, it was further confirmed that the multiple PCR species discrimination, identification and detection method based on free fungal DNA fragments of the present invention is applicable to diagnosis of detection of human invasive fungal infection and identification of infectious species. And compared with the test G for clinical relevance.
The implementation method comprises the following steps:
1. serum samples collected from different departments of a hospital were used, and the measurement values of the sample G assay were recorded, and DNA was extracted using a blood DNA extraction kit from Qiagen or shanghai, respectively (diagnosis).
The real-time PCR reaction system is as follows:
3. setting of reaction conditions
Total denaturation 95 ℃ for 5 min, 5 cycles (94 ℃ for 15 sec, 63 ℃ for 15 sec, 72 ℃ for 25 sec), 38 cycles (94 ℃ for 15 sec, 60 ℃ for 15 sec, 72 ℃ for 25 sec).
II, detecting results:
when the detection signal is amplified (Ct is less than or equal to 35), the signal is judged to be a positive signal: the corresponding signal channels of each strain are as follows: albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy 5). And after the PCR reaction is finished, judging specific strains in the screened sample according to the Ct value of the fluorescence signal of each channel.
TABLE-6 test results for randomly selected samples from each department of hospital
The test of a small batch of clinical samples (N-7) shows that the method can use fungus free DNA fragments to carry out a strain identification diagnosis test on invasive fungus infection patients in human serum samples. Compared with the detection result of the G test, the method has certain correlation (70%), and compared with the detection method of the G test, the method has shorter detection time, can confirm specific infected strains, and can provide treatment guidance for reasonable application of the strains in the later period.
Example 5:
the verification test of the method of the invention is carried out by using the serum sample of suspected fungal infection patient infected by unknown fungal strain of hospital inpatient randomly selected and tested by G or GM experiment, and compared with the methodological comparison of G and GM test
In this example, randomly selected hospitalized serum samples were used, which were suspected of fungal infection (species unknown), and tested using the G or GM test. By this example, it is further demonstrated that the multiple PCR species discrimination and identification detection method based on free fungal DNA fragments of the present invention is applicable to detection, diagnosis and identification of infectious species in humans for invasive fungal infection. And compared to clinical relevance with the G and GM assays.
The implementation method comprises the following steps:
1. using a randomly selected serum sample of an inpatient from a hospital, said serum sample being suspected of fungal infection (species unknown), and testing said serum sample using the G or GM test, and recording the value of the measurement of the G or GM test of the sample; then, DNA was extracted using a blood DNA extraction kit from Qiagen or Desai diagnostics (Shanghai) Ltd.
The real-time PCR reaction system is as follows:
3. setting of reaction conditions
Total denaturation 95 ℃ for 5 min, 5 cycles (94 ℃ for 15 sec, 63 ℃ for 15 sec, 72 ℃ for 25 sec), 38 cycles (94 ℃ for 15 sec, 60 ℃ for 15 sec, 72 ℃ for 25 sec).
II, detecting results:
when the amplification detection signal (Ct ≦ 35), the signal is determined as positive: the corresponding signal channels of each strain are as follows: albicans (FAM), C.tropicalis (Cy5), C.parapsilosis (ROX/VIC), and C.krusei (FAM), C.glabrata (ROX), A.fumigatus (Cy 5). And after the PCR reaction is finished, judging specific strains in the screened sample according to the Ct value of the fluorescence signal of each channel.
TABLE-7 ratio of strains in randomly selected hospital inpatient sample test results
| The ratio of each strain in the test sample (sample number ═ 45) | |
| C.albicans | 87.2 |
| C.tropicalis | 2.1 |
| C.parapsilosis | 2.1 |
| C.krusei | 2.1 |
| C.glabrata | 2.1 |
| Aspergillus fumigatus | 38.3 |
TABLE-8 PCR test for randomly selected hospital inpatient samples in compliance with G or GM test
| Number of samples | The percent of coincidence of the PCR test | |
| GM is positive | 20 | 75(15/20) |
| GM negative | 5 | 80(4/5) |
| G positive | 14 | 92.9(13/14) |
| G negative | 6 | 33.3(2/6) |
As is statistically demonstrated in table-7 above, the distribution of invasive infectious fungal species described in the open literature was confirmed by using only the PCR method to determine that more than 80% of the samples were detected as candida albicans (c.albicans) before reference to clinical results was not considered. In Table-8, the GM test has a negative and positive coincidence rate of > 70%, which is related to the high specificity of the GM test. The positive rate of the G test part is higher (compared with the actual clinical case history information), and the specific reason can be explained as the high sensitivity of the methodology of the PCR. The results show that the method has certain correlation with the existing G and GM detection methods, but has higher sensitivity, and can confirm the specific strain of infection, thereby having great significance for early and targeted treatment guidance of fungal infection according to the targeted medication of the strain.
The protection content of the present invention is not limited to the above embodiments. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, which is set forth in the following claims.
SEQUENCE LISTING
<110> Texas diagnostic System (Shanghai) Co., Ltd
<120> detection method, detection kit and application of invasive fungal infection
<160> 26
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
tgaagaacgc agcgaaat 18
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
atatgcttaa gttcagcg 18
<210> 3
<211> 16
<212> DNA
<213> Artificial sequence
<400> 3
catgcctgtt tgagcg 16
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<400> 4
gtcctacctg atttgagg 18
<210> 5
<211> 16
<212> DNA
<213> Artificial sequence
<400> 5
taccgccgca agcaat 16
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
tgaaataaat tgtggtggcc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
tggagtttgt accaatgagt 20
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
ttcctacctg atttgagg 18
<210> 9
<211> 17
<212> DNA
<213> Artificial sequence
<400> 9
ccctacctga tttgagg 17
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence
<400> 10
tccctacctg atccgagg 18
<210> 11
<211> 17
<212> DNA
<213> Artificial sequence
<400> 11
catgcctgtc cgagcgt 17
<210> 12
<211> 16
<212> DNA
<213> Artificial sequence
<400> 12
cgtgcgcaga gttggg 16
<210> 13
<211> 17
<212> DNA
<213> Artificial sequence
<400> 13
tgtctgccca gcacgca 17
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<400> 14
cctacagagc aggtgacaaa g 21
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence
<400> 15
ggtgttgagc aatacgactt gg 22
<210> 16
<211> 22
<212> DNA
<213> Artificial sequence
<400> 16
agacctaagc cattgtcaaa gc 22
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
tggtattcca aagggcatgc 20
<210> 18
<211> 24
<212> DNA
<213> Artificial sequence
<400> 18
ccacgttaaa ttctttcaaa caaa 24
<210> 19
<211> 19
<212> DNA
<213> Artificial sequence
<400> 19
attgcgccct tagggcatg 19
<210> 20
<211> 23
<212> DNA
<213> Artificial sequence
<400> 20
tccattagtt tatactccgc ctt 23
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence
<400> 21
ctgtttgagc gtcgtttcca 20
<210> 22
<211> 22
<212> DNA
<213> Artificial sequence
<400> 22
tcctacctga tttgaggtcg ag 22
<210> 23
<211> 23
<212> DNA
<213> Artificial sequence
<400> 23
ccatatcagt atgtgggaca cga 23
<210> 24
<211> 21
<212> DNA
<213> Artificial sequence
<400> 24
atccctccct agatcaacac c 21
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence
<400> 25
attgcgccct tagggcatg 19
<210> 26
<211> 23
<212> DNA
<213> Artificial sequence
<400> 26
tccattagtt tatactccgc ctt 23
Claims (5)
1. A fungus genus specific nested PCR primer and fungus species specific detection fluorescent probe combination for detecting invasive fungus infection is characterized in that the fungus is fungus Candida albicansCandida albicansCandida tropicalisCandida tropicalisCandida parapsilosisCandida parapsilosisCombining;
wherein, the fungus genus specific nested PCR primer comprises a primer combination with the following sequences:
upstream primer 1, 5 '-3' sequence: TGAAGAACGCAGCGAAAT (SEQ ID NO. 1);
downstream primer 1, 5 '-3' sequence: ATATGCTTAAGTTCAGCG (SEQ ID NO. 2);
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 1-2, 5 '-3' sequence: GTCCTACCTGATTTGAGG (SEQ ID NO. 4);
correspondingly, the fungus species specific detection fluorescent probe is a combination of the following sequences:
candida albicansCandida albicans5 '-3' sequence: TACCGCCGCAAGCAAT (SEQ ID NO. 5);
candida tropicalisCandida tropicalis5 '-3' sequence: TGAAATAAATTGTGGTGGCC (SEQ ID NO. 6);
candida parapsilosisCandida parapsilosis5 '-3' sequence: TGGAGTTTGTACCAATGAGT (SEQ ID NO. 7);
and/or the presence of a gas in the gas,
the fungus is Candida kruseiCandida kruseiCandida glabrataCandida glabrataAspergillus fumigatusAspergillus fumigtusCombining; wherein, the fungus genus specific nested PCR primer comprises a primer combination of the following sequences;
upstream primer 1, 5 '-3' sequence: TGAAGAACGCAGCGAAAT (SEQ ID NO. 1);
downstream primer 1, 5 '-3' sequence: ATATGCTTAAGTTCAGCG (SEQ ID NO. 2);
upstream primer 1-1, 5 '-3' sequence: CATGCCTGTTTGAGCG (SEQ ID NO. 3);
downstream primer 2-2, 5 '-3' sequence: TTCCTACCTGATTTGAGG (SEQ ID NO. 8);
downstream primer 2-3, 5 '-3' sequence: CCCTACCTGATTTGAGG (SEQ ID NO. 9);
upstream primer 2-4, 5 '-3' sequence: TCCCTACCTGATCCGAGG (SEQ ID NO. 10);
downstream primer 2-5, 5 '-3' sequence: CATGCCTGTCCGAGCGT (SEQ ID NO. 11);
correspondingly, the fungus species specific detection fluorescent probe is a combination of the following sequences:
candida kruseiCandida krusei5 '-3' sequence: CGTGCGCAGAGTTGGG (SEQ ID NO. 12);
candida glabrataCandida glabrata5 '-3' sequence: TGTCTGCCCAGCACGCA (SEQ ID NO. 13);
aspergillus fumigatusAspergillus fumigtus5 '-3' sequence: CCTACAGAGCAGGTGACAAAG (SEQ ID NO. 14).
2. The fungal genus-specific nested PCR primer and fungal species-specific detection fluorescent probe combination for detecting invasive fungal infection according to claim 1, further comprising a fungal species-specific detection fluorescent probe chemically modified at both ends; the chemical modification comprises: 5' end: adopting the combination of any three dyes in FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red and Cy5 fluorescent dye groups for chemical modification; and, 3' end: chemical modification with a BHQ1 or BHQ2 or 3IABkFQ or 3IAbRQSp quencher group.
3. A kit for detecting invasive fungal infection, comprising the fungal genus-specific nested PCR primer of claim 1 in combination with a fungal species-specific detection fluorescent probe.
4. The kit of claim 3, wherein the kit comprises: contains positive plasmid standard substance located in specific section of rDNA fungus strain.
5. Use of a kit according to claim 3 or 4 for the differentiation and identification of invasive fungi for non-diagnostic and therapeutic purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810899103.4A CN109055502B (en) | 2018-08-08 | 2018-08-08 | Detection method, detection kit and application of invasive fungal infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810899103.4A CN109055502B (en) | 2018-08-08 | 2018-08-08 | Detection method, detection kit and application of invasive fungal infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055502A CN109055502A (en) | 2018-12-21 |
| CN109055502B true CN109055502B (en) | 2022-09-20 |
Family
ID=64678925
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810899103.4A Active CN109055502B (en) | 2018-08-08 | 2018-08-08 | Detection method, detection kit and application of invasive fungal infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055502B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666755A (en) * | 2018-12-25 | 2019-04-23 | 北京卓诚惠生生物科技股份有限公司 | For detecting the nucleic acid reagent, kit, system and method for invasive fungi |
| CN109680081B (en) * | 2018-12-29 | 2022-10-28 | 深圳市刚竹医疗科技有限公司 | Nucleic acid composition for detecting multiple pathogens, kit and use method of kit |
| CN109554491A (en) * | 2019-01-17 | 2019-04-02 | 中国农业科学院兰州兽医研究所 | A kind of reagent and method identifying detection sheep Babesia U sp and Mohs Babesia |
| CN109811080A (en) * | 2019-04-02 | 2019-05-28 | 丹娜（天津）生物科技有限公司 | A kind of DPO primer pair, detection method, kit and its application of candida albicans point kind detection |
| CN109971883B (en) | 2019-05-07 | 2020-07-24 | 丹娜（天津）生物科技有限公司 | Primer-probe combination, kit, detection method and application for candida species classification detection |
| CN110714090B (en) * | 2019-12-03 | 2023-08-22 | 郑州安图生物工程股份有限公司 | Kit for detecting free nucleic acid of blood flow infection pathogen in blood plasma |
| CN112522434B (en) * | 2020-12-24 | 2023-02-03 | 中山大学附属第三医院 | Primer group and kit for simultaneously detecting multiple pathogenic fungi |
| CN112695128A (en) * | 2021-02-05 | 2021-04-23 | 杭州医学院 | Rapid analysis method for yeast fungi based on membrane culture |
| CN113151555A (en) * | 2021-04-26 | 2021-07-23 | 南方海洋科学与工程广东省实验室(湛江) | Probe for detecting candida parapsilosis, method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101509037A (en) * | 2009-03-25 | 2009-08-19 | 广州医学院第一附属医院 | Rapid diagnosis reagent kit for detecting four/more than four invasive candidiasis |
| CN107312839A (en) * | 2017-06-30 | 2017-11-03 | 中山大学肿瘤防治中心 | A kind of material, kit and method detected for systemic infection |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5707802A (en) * | 1995-01-13 | 1998-01-13 | Ciba Corning Diagnostics Corp. | Nucleic acid probes for the detection and identification of fungi |
| CN1286989C (en) * | 2005-04-22 | 2006-11-29 | 中国人民解放军军事医学科学院卫生学环境医学研究所 | Biochip for detecting pathogenesis fungus |
| CN104450936B (en) * | 2014-12-25 | 2016-12-07 | 天津宝瑞生物技术有限公司 | The detection fluorescence quantification PCR primer of common causative fungus, probe and test kit |
| CN104911262B (en) * | 2015-05-28 | 2018-01-02 | 海南科大林业有限公司 | A kind of dalbergia odorifera tar spot bacterium molecule detection primer and quick determination method |
| CN106987626B (en) * | 2017-03-27 | 2020-12-15 | 杭州迪安生物技术有限公司 | Primer and probe for rapidly detecting various fungi and identifying strains and application thereof |
-
2018
- 2018-08-08 CN CN201810899103.4A patent/CN109055502B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101509037A (en) * | 2009-03-25 | 2009-08-19 | 广州医学院第一附属医院 | Rapid diagnosis reagent kit for detecting four/more than four invasive candidiasis |
| CN107312839A (en) * | 2017-06-30 | 2017-11-03 | 中山大学肿瘤防治中心 | A kind of material, kit and method detected for systemic infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055502A (en) | 2018-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| AU2011227110B2 (en) | Methods, kits and compositions for detection of MRSA | |
| EP2929051B1 (en) | Method for detecting helicobacter pylori dna in a stool sample | |
| CN112501268A (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN114134219A (en) | Multiple nucleic acid detection system and preparation method and application thereof | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| CN108315478A (en) | The probe and kit of RAA Fluorometric assay hydrophobins | |
| WO2023279042A2 (en) | Compositions and methods for detection of severe acute respiratory syndrome coronavirus 2 variants | |
| CN111521781A (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| AU2020102244A4 (en) | Primer group, kit and detection method for rapidly detecting carbapenemases genes | |
| CN111004862B (en) | Primer and probe for rapidly detecting and identifying cryptococcus and application thereof | |
| CN117363767A (en) | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit | |
| WO2024055627A1 (en) | Primer-molecular beacon combination for molecular typing of wild type and mutant type of monkey poxvirus and use thereof | |
| CN112359126A (en) | Method for accurately detecting cryptococcus neoformans | |
| CN111471800A (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN109988855B (en) | LAMP primer combination for detecting six kinds of aspergillus and application thereof | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| CN109652539A (en) | A kind of kit detected for EGFR T790M site mutation | |
| JP5215726B2 (en) | Detection method of mouse Pneumocystis carini | |
| CN110055345A (en) | Primer sets and its application | |
| CN111712583A (en) | Method for diagnosing tsutsutsugamushi disease using multi-copy gene | |
| KR102496414B1 (en) | Primer sets for simultaneous detection of 18S rRNA gene and 28S rRNA gene of Kudoa Septempunctata |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |