CN110055345A - Primer sets and its application - Google Patents
Primer sets and its application Download PDFInfo
- Publication number
- CN110055345A CN110055345A CN201811634154.0A CN201811634154A CN110055345A CN 110055345 A CN110055345 A CN 110055345A CN 201811634154 A CN201811634154 A CN 201811634154A CN 110055345 A CN110055345 A CN 110055345A
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleotide sequence
- seq
- amplification
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001523006 Talaromyces marneffei Species 0.000 claims abstract description 39
- 238000001514 detection method Methods 0.000 claims abstract description 27
- 239000002773 nucleotide Substances 0.000 claims description 60
- 125000003729 nucleotide group Chemical group 0.000 claims description 60
- 230000003321 amplification Effects 0.000 claims description 45
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 45
- 238000000034 method Methods 0.000 claims description 25
- 238000012360 testing method Methods 0.000 claims description 19
- 238000012986 modification Methods 0.000 claims description 15
- 230000004048 modification Effects 0.000 claims description 15
- 238000006467 substitution reaction Methods 0.000 claims description 13
- 230000000295 complement effect Effects 0.000 claims description 12
- 238000012217 deletion Methods 0.000 claims description 10
- 230000037430 deletion Effects 0.000 claims description 10
- 241000894006 Bacteria Species 0.000 claims description 9
- 230000001404 mediated effect Effects 0.000 claims description 8
- 238000002360 preparation method Methods 0.000 claims description 8
- 108020004707 nucleic acids Proteins 0.000 claims description 4
- 102000039446 nucleic acids Human genes 0.000 claims description 4
- 150000007523 nucleic acids Chemical class 0.000 claims description 4
- 238000012797 qualification Methods 0.000 claims description 2
- 239000002585 base Substances 0.000 claims 6
- 239000003513 alkali Substances 0.000 claims 2
- 239000000203 mixture Substances 0.000 abstract description 19
- 230000035945 sensitivity Effects 0.000 abstract description 8
- 230000001737 promoting effect Effects 0.000 abstract description 2
- 238000006243 chemical reaction Methods 0.000 description 64
- 108020004414 DNA Proteins 0.000 description 36
- 239000012895 dilution Substances 0.000 description 31
- 238000010790 dilution Methods 0.000 description 31
- 239000013256 coordination polymer Substances 0.000 description 12
- 239000000243 solution Substances 0.000 description 12
- 230000003020 moisturizing effect Effects 0.000 description 10
- 108090000623 proteins and genes Proteins 0.000 description 10
- 241000233866 Fungi Species 0.000 description 9
- 230000001580 bacterial effect Effects 0.000 description 9
- 208000015181 infectious disease Diseases 0.000 description 7
- 241001225321 Aspergillus fumigatus Species 0.000 description 6
- 241001465318 Aspergillus terreus Species 0.000 description 6
- 229940091771 aspergillus fumigatus Drugs 0.000 description 6
- 238000011901 isothermal amplification Methods 0.000 description 6
- 201000007336 Cryptococcosis Diseases 0.000 description 5
- 241001337994 Cryptococcus <scale insect> Species 0.000 description 5
- 241000221204 Cryptococcus neoformans Species 0.000 description 5
- 208000031888 Mycoses Diseases 0.000 description 5
- 230000000052 comparative effect Effects 0.000 description 5
- 208000037026 Invasive Fungal Infections Diseases 0.000 description 4
- 238000007397 LAMP assay Methods 0.000 description 4
- 238000003745 diagnosis Methods 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 238000007689 inspection Methods 0.000 description 4
- 206010017533 Fungal infection Diseases 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- -1 that is Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 102000053602 DNA Human genes 0.000 description 2
- 241000282414 Homo sapiens Species 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000013401 experimental design Methods 0.000 description 2
- 239000012530 fluid Substances 0.000 description 2
- 239000003205 fragrance Substances 0.000 description 2
- 239000003018 immunosuppressive agent Substances 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- YNPNZTXNASCQKK-UHFFFAOYSA-N phenanthrene Chemical compound C1=CC=C2C3=CC=CC=C3C=CC2=C1 YNPNZTXNASCQKK-UHFFFAOYSA-N 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- 239000008223 sterile water Substances 0.000 description 2
- 230000009885 systemic effect Effects 0.000 description 2
- 208000030507 AIDS Diseases 0.000 description 1
- 241000222122 Candida albicans Species 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 241000228404 Histoplasma capsulatum Species 0.000 description 1
- 101000686153 Homo sapiens Ras-related GTP-binding protein A Proteins 0.000 description 1
- 206010061218 Inflammation Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 241000228150 Penicillium chrysogenum Species 0.000 description 1
- 102100025001 Ras-related GTP-binding protein A Human genes 0.000 description 1
- 240000004808 Saccharomyces cerevisiae Species 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 238000002835 absorbance Methods 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 230000000844 anti-bacterial effect Effects 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 229940095731 candida albicans Drugs 0.000 description 1
- 238000002512 chemotherapy Methods 0.000 description 1
- 238000012790 confirmation Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000037029 cross reaction Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 206010012601 diabetes mellitus Diseases 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 238000006073 displacement reaction Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000004362 fungal culture Methods 0.000 description 1
- 230000002538 fungal effect Effects 0.000 description 1
- 239000003862 glucocorticoid Substances 0.000 description 1
- 230000002489 hematologic effect Effects 0.000 description 1
- 238000011134 hematopoietic stem cell transplantation Methods 0.000 description 1
- 230000002962 histologic effect Effects 0.000 description 1
- 230000036039 immunity Effects 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 230000004054 inflammatory process Effects 0.000 description 1
- 230000003834 intracellular effect Effects 0.000 description 1
- 230000009545 invasion Effects 0.000 description 1
- 230000003902 lesion Effects 0.000 description 1
- 231100000518 lethal Toxicity 0.000 description 1
- 230000001665 lethal effect Effects 0.000 description 1
- 238000007479 molecular analysis Methods 0.000 description 1
- 210000000865 mononuclear phagocyte system Anatomy 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000004768 organ dysfunction Effects 0.000 description 1
- 238000004806 packaging method and process Methods 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 238000003906 pulsed field gel electrophoresis Methods 0.000 description 1
- 238000012113 quantitative test Methods 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 230000035484 reaction time Effects 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 230000000405 serological effect Effects 0.000 description 1
- 235000015170 shellfish Nutrition 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000004575 stone Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, in particular to primer sets and its application.The invention discloses one kind for detecting penicillium Marneffei LAMP primer composition and its application.Primer combination provided by the invention, 6 primers shown in No.1~6 SEQ ID form.Primer combination provided by the invention can be applied to detect whether can be applied in detection sample to be tested whether contain penicillium Marneffei containing penicillium Marneffei.Primer combination identification provided by the invention has high specific and high sensitivity, easy, quick, accurate detection may be implemented for detecting penicillium Marneffei.The present invention has great promotional value.
Description
Technical field
The present invention relates to field of biotechnology, in particular to primer sets and its application.
Background technique
Studies of invasive fungal infections (invasive fungal disease, IFD) is also known as invasive infections with fungi (invasive
Fungal infection, IFI), deep fungal infection (deep fungal infection, DFI), refer to fungi invade people
Body tissue, blood grow wherein and breed, cause inflammatory reaction, and cause the pathology of histologic lesion, organ dysfunction raw
Reason process.Over nearly twenty or thirty year, with the new technologies such as solid organ and hematopoietic stem cell transplantation, chemotherapy of tumors, immunosuppressor
Extensive use in clinic increases the disease incidence of studies of invasive fungal infections and case fatality rate year by year, and having become causes to be hospitalized
One of the main reason for death.ICU is moved in since infection studies of invasive fungal infections is mainly in, advanced age, diabetes, hematologic
Systemic disease, candida albicans field planting, invasion operation, using in the crowds such as antibacterials, glucocorticoid, immunosuppressor,
Immunity of organisms is low, and the severe death rate is high, therefore early detection to invasive infections with fungi and determines that infection bacteria species have pole
For important meaning.
Penicillium Marneffei disease is the act of violence caused by penicillium Marneffei (Penicillium marneffei) infection
Danger, easily lethal systemic mycoses, in recent years it have become fungal infection that Southeast Asia AIDS patient most often merges it
One.Penicillium Marneffei is a kind of saprophytic fungus, is temperature dependency diphasic fungi, is in vitro in mycelia when 25 DEG C of cultures
Phase, into human body after be converted into yeast phase, the bacterium invade mononuclear phagocyte system, be intracellular pathomycete.When body is exempted from
When epidemic disease power is low, body is invaded by skin or respiratory tract, can be sent out by blood circulation to whole body.Main host is immune deficiency
Patient, especially aids patient.
Existing invasive infections with fungi detection method mainly includes routine inspection method and two kinds of special examined method.Wherein often
Rule inspection technique specifically includes that 1) fungi microscope inspection, i.e. direct smear dyeing microscopic examination；2) fungal culture is identified；3) histopathology
It learns and checks.Special examined method specifically includes that 1) Serological testing；2) Bio-molecular analysis.Wherein routine inspection method is still regarded
For the foundation stone for making a definite diagnosis invasive infections with fungi, but its that there are susceptibilitys is lower, operate complicated, negative findings can not rule out diagnosis,
The problems such as detection cycle longer (it is generally necessary to time of a few days to a few weeks), and lead to delay treatment and medication, increase the death rate
Deng；Serologic detection is difficult to exclude the inter-species antibody and antigen cross-reaction of the certain categories of fungi so as to cause erroneous judgement.Compare first two
Method, Protocols in Molecular Biology have the advantages that high specific and high accuracy, and can be illustrated from gene level fungal population it
Between and in taxonomic relation, thus be increasingly widely recognized and apply in recent years.The relevant molecule established at present
Learning diagnostic method has regular-PCR method, Pulse field gel electrophoresis (PFGE), Multilocus sequence typing (MLST), restricted
Fragment length polymorphism analyzes (RFLP), Real-Time Fluorescent Quantitative PCR Technique (RTFQ-PCR) etc., and shared problem is to experiment
Operate more demanding, detection time longer (2.5h-3h) left and right.Therefore, fast and accurately molecular diagnosis method is established, for clinic
There is provided early stage diagnosis and treatment foundation is the key that solve status.
Summary of the invention
In view of this, the present invention provides a kind of primer sets and its application.Primer combination identification is luxuriant and rich with fragrance green for detecting Marni
Mould has high specific and high sensitivity, and easy, quick, accurate detection may be implemented.
In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:
The present invention provides a kind of primer sets, including primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF
With primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(a1), there is nucleotide sequence shown in SEQ ID NO:1；
(a2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(a3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(a4), the complementary series of the sequence as shown in (a1), (a2) or (a3)；
Primer-the B3 has any one in nucleotide sequence as follows:
(a5), there is nucleotide sequence shown in SEQ ID NO:2；
(a6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(a7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(a8), the complementary series of the sequence as shown in (a5), (a6) or (a7)；
Primer-the FIP has any one in nucleotide sequence as follows:
(a9), there is nucleotide sequence shown in SEQ ID NO:3；
(a10), have SEQ ID NO:3 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a11) I, the sequence with nucleotide sequence shown in SEQ ID NO:3 at least 80% homology；
(a12), the complementary series of the sequence as shown in (a9), (a10) or (a11)；
Primer-the BIP has any one in nucleotide sequence as follows:
(a13), there is nucleotide sequence shown in SEQ ID NO:4；
(a14), have SEQ ID NO:4 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(a16), the complementary series of the sequence as shown in (a13), (a14) or (a15)；
Primer-the LF has any one in nucleotide sequence as follows:
(a17), there is nucleotide sequence shown in SEQ ID NO:5；
(a18), have SEQ ID NO:5 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(a20), the complementary series of the sequence as shown in (a17), (a18) or (a19)；
Primer-the LB has any one in nucleotide sequence as follows:
(a21), there is nucleotide sequence shown in SEQ ID NO:6；
(a22), have SEQ ID NO:6 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(a24), the complementary series of the sequence as shown in (a21), (a22) or (a23).
In some specific embodiments of the invention, the primer-F3, the primer-B3, the primer-FIP, institute
The molar ratio for stating primer-BIP, the primer-LF and the primer-LB is 0.5:0.5:2:2:1:1.
The present invention also provides application of the primer sets in the nucleic acid molecules of amplification penicillium Marneffei.
The present invention also provides the primer sets to detect and/or identify the application in penicillium Marneffei.
The present invention also provides the primer sets in the kit of preparation detection and/or identification penicillium Marneffei
Using.
The present invention also provides the kit including the primer sets, the purposes of the kit includes:
I, penicillium Marneffei is identified；
II, detect in sample to be tested whether contain penicillium Marneffei.
The present invention also provides a kind of methods for identifying penicillium Marneffei, include the following steps:
(1) genomic DNA of bacterium to be measured is obtained；
(2) for the genomic DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring Jie
Isothermal duplication is led, amplification is obtained；
(3) qualification result is obtained according to the amplification.
In some specific embodiments of the invention, if amplification is specific amplification, i.e., if described in
Primer sets may be implemented then to contain in bacterium to be measured using the genomic DNA as the specific amplification of template or candidate contains Ma Er
Buddhist nun's phenanthrene Penicillium notatum.
The present invention also provides in a kind of detection sample to be tested whether the method containing penicillium Marneffei, including it is as follows
Step:
(1) total DNA of sample to be tested is obtained；
(2) for the total DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediation etc.
Temperature amplification, obtains amplification；
(3) testing result is obtained according to the amplification.
In some specific embodiments of the invention, if amplification is specific amplification, i.e., if described in
Primer sets may be implemented then to contain in the sample to be tested using the genomic DNA as the specific amplification of template or candidate contains
There is penicillium Marneffei.
In any description above method of the present invention, when using the primer sets I, the reactant of the ring mediated isothermal amplification
Primer I-F3 in system, primer I-B3, primer I-FIP, primer I-BIP, primer I-LF and primer I-LB molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
Any description above bacterium to be measured of the present invention concretely aspergillus fumigatus, Aspergillus terreus, Cryptococcus neoformans or adds special cryptococcus.
The aspergillus fumigatus concretely CGMCC, strain number: 3.08027 aspergillus fumigatus.The Aspergillus terreus concretely CGMCC, bacterial strain
Number: 3.08115 Aspergillus terreus.The Cryptococcus neoformans concretely ATCC, bacterial strain number: 208821 Cryptococcus neoformans.Institute
State plus special cryptococcus can be ATCC, bacterial strain number: 14248 plus special cryptococcus.
In any description above method of the present invention, loop-mediated isothermal amplification condition are as follows: 65 DEG C of constant temperature 50min.
Heretofore described sample to be tested can be the bronchoalveolar lavage fluid of people (Homo sapiens).
In the present invention, the realization ring mediated isothermal amplification can specifically embody are as follows: be detected using quantitative fluorescent PCR
When may occur in which ring mediated isothermal amplification curve.The ring mediated isothermal amplification curve can be typical " S type " amplification curve.
The present invention also protects the primer combination whether detecting bacterium to be measured containing the application in penicillium Marneffei.
Whether the present invention also protects the primer combination in detection sample to be tested containing answering in penicillium Marneffei
With.
In the present invention, penicillium Marneffei strain number is ATCC 18224.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to and fast and accurately detect common strain.LAMP method has sensitivity height, specific good, reaction
Time is short, determines that result is convenient, does not need the advantages such as expensive instrument.
10 μ L of reaction system in the present invention are as follows: (6.7~7.3) μ L reaction solution (Capitalbio Corporation Co., Ltd.'s product,
Catalog number is CP.440020), (0.8~1.2) μ L primer sets, 1 μ L dilution (copy by the genome contained in 1 μ L dilution
Shellfish number is 5*102Copies), moisturizing is to 10 μ L.
Primer provided by the invention combination identification has high specific and highly sensitive for detecting penicillium Marneffei
Easy, quick, accurate detection may be implemented in degree.The present invention has great promotional value.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described.
Fig. 1 shows the testing result that primer sets I is used in embodiment 2；
Fig. 2 shows the testing result of reaction system 1 in embodiment 3；
Fig. 3 shows the testing result of reaction system 2 in embodiment 3；
Fig. 4 shows the testing result of reaction system 3 in embodiment 3；
Fig. 5 shows the testing result of reaction system 1 in embodiment 4；
Fig. 6 shows the testing result of reaction system 2 in embodiment 4；
Fig. 7 shows the testing result of reaction system 3 in embodiment 4；
Fig. 8 shows the testing result of reaction system 4 in embodiment 4；
Fig. 9 shows the testing result of reaction system 5 in embodiment 4；
Figure 10 shows the testing result of clinical sample in embodiment 5；
Figure 11 shows the sensitivity technique result of primer provided by the invention in comparative test；
Figure 12 shows the sensitivity technique result that primer is compareed in comparative test；
Figure 13 shows the specific detection result of primer provided by the invention in comparative test；
Figure 14 shows the specific detection result that primer is compareed in comparative test.
Specific embodiment
The invention discloses a kind of primer sets and its application, those skilled in the art can use for reference present disclosure, suitably change
Into realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications are aobvious for a person skilled in the art
And be clear to, they are considered as being included in the present invention.Method and application of the invention is carried out by preferred embodiment
Description, related personnel can obviously not depart from the content of present invention, carried out in spirit and scope to method described herein and application
Change or appropriate changes and combinations, carry out implementation and application the technology of the present invention.
Raw materials used, auxiliary material and reagent are available on the market in primer sets provided by the invention and its application.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.
Reaction solution is Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440020.
The calculation method of DNA copy number is as follows:
50 μ g/ml of 1A260 absorbance value=ds DNA；
Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；
Average molecular weight (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；
Mole=6.02 × 1023；
Average molecular weight (MW): dsDNA=(base number) × (660 dalton/base)；
Copy number calculation formula:
(6.02×1023Copies/ moles) × (l × 10 x ng/ μ-9)/(DNA length × 660)=copies/ μ l.
Below with reference to embodiment, the present invention is further explained:
The preparation of 1 primer sets I of embodiment
Kit is made of a LAMP primer group, for detecting penicillium Marneffei.
It is following (5 ' → 3 ') for detecting penicillium Marneffei primer sets:
Outer primer F3 (SEQ ID No.1): TGTTCCCAGCCCCG；
Outer primer B3 (SEQ ID No.2): TGGTGCAGTCTTCTTG；
Inner primer FIP (SEQ ID No.3): AACTCGAGAGTCGAAGGAGACTCAGGCGATCCTTTC；
Inner primer BIP (SEQ ID No.4): CGCACTGCCTTAAACGCGCTGCTCTGGATCGCTA；
Ring primer LF (SEQ ID No.5): CGCCACCGCTTTGAA；
Ring primer LB (SEQ ID No.6): GCACCTACGTCTAACC.
Primer sets for detecting penicillium Marneffei are named as primer sets.
Detection penicillium Marneffei primer combination is made of primer sets, and in primer combination, each single stranded DNA is respectively independent
Packaging.
In primer sets, primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and primer-LB molar ratio be
0.5:0.5:2:2:1:1；
2 specificity of embodiment
One, the preparation of sample to be tested
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；
Sample to be tested 2: Aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA；
Sample to be tested 3: Cryptococcus neoformans (ATCC, bacterial strain number: 208821) genomic DNA；
Sample to be tested 4: add special cryptococcus (ATCC, bacterial strain number: 14248) genomic DNA；
Sample to be tested 5: penicillium Marneffei (ATCC, bacterial strain number: 18224) genomic DNA.
Two, the detection of sample to be tested
Using each sample to be tested in step 1 as template, ring Jie is carried out using the primer combination of 1 step 2 of embodiment preparation
Lead isothermal duplication.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), 1 μ L primer mixture, 1 μ L template DNA (5pg~50pg), moisturizing to 10 μ L.Primer mixture, that is, primer sets
The mixture of each primer composition in conjunction.In reaction system, the final concentration of primers F 3 and primer B3 are 0.5 μM, primers F IP
Final concentration with primer BIP is 2 μM, and the final concentration of primer LF and primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
20 repetitions are arranged in each reaction system.
The result is shown in Figure 1.The result shows that only when sample to be tested is Histoplasma capsulatum Plasmid DNA (sample to be tested 5)
When show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be sample to be tested 1,
2,3,4 when do not show positive amplification curve.
The above result shows that primer combination provided by the invention has very high specificity to its target gene.
The sensitivity of the primer combination of 3 penicillium Marneffei of embodiment
Sample to be tested 1: the penicillium Marneffei genome of embodiment 1.
1, the genome for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.
2, for the dilution obtained using step 1 as template, the primer sets I that the preparation of embodiment 1 is respectively adopted carries out ring mediation etc.
Temperature amplification.
When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are respectively 10 for 1 μ L primer mixture, 1 μ L dilution3、102
Or 101), moisturizing to 10 μ L.The mixture of primer mixture, that is, primer sets I or each primer composition in primer sets II.Reaction
In system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μ
The final concentration of M, ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
According to the difference of genome copy numbers in dilution, total following 3 reaction systems:
The genome copy numbers contained in reaction system 1:1 μ L dilution are respectively 103；
The genome copy numbers contained in reaction system 2:1 μ L dilution are respectively 5 × 102；
The genome copy numbers contained in reaction system 3:1 μ L dilution are respectively 102；
20 repetitions are arranged in each reaction system.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
As a result see Fig. 2-Fig. 4.Primer combine detection target gene genome copy numbers in 1 μ L dilution are 103(Fig. 2)
With 5 × 10220 detections are detectable out and reproducible when (Fig. 3), and 102When (Fig. 4) 20 detection can not completely appearance and
It is less reproducible, therefore the sensitivity of primer combination is 5 × 102A copy number/reaction system.
The screening of 4 reaction system of embodiment
1, the genome for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.
2, the dilution obtained using step 1 carries out ring mediated isothermal expansion using primer sets I prepared by embodiment 1 as template
Increase.
Reaction system 1 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 2 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.7 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.2 μ L primer mixtures, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 3 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.5 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.3 μ L primer mixtures, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 4 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.3 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.8 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 5 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.5 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.7 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
The mixture of each primer of primer mixture, that is, primer sets I composition.In reaction system, outer primer F3 and outer primer
The final concentration of B3 is 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer LF and ring primer LB's
Final concentration is 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using constant-temperature amplification instrument.
8 repetitions are arranged in each reaction system.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
As a result see Fig. 5~Fig. 9.Primer combine detection target gene is in reaction system 1, reaction system 2 and reaction system 4
8 detections are detectable out and reproducible, and primer combine detection target gene is in reaction system 3 and reaction system 58
Detection can not appearance and less reproducible completely.
It is thus determined that reaction system matches are as follows:
10 L:(6.7~7.3 μ of reaction system) μ L reaction solution (Capitalbio Corporation Co., Ltd.'s product, catalog number
For CP.440020), (0.8~1.2) μ L primer sets, 1 μ L dilution, (genome copy numbers contained in 1 μ L dilution are 5*
102Copies), moisturizing is to 10 μ L.
Embodiment 5 identifies primer combine detection clinical sample using penicillium Marneffei
Sample to be tested is following sample one:
Sample one: the bronchoalveolar lavage fluid of people of the identification confirmation containing penicillium Marneffei is sequenced by PCR.
1, the total DNA of sample to be tested is extracted.
2, each primer sets of the preparation of embodiment 1 are respectively adopted to the two samples as template in the total DNA extracted using step 1
This progress ring mediated isothermal amplification, each primer combination detect two kinds of samples.
Reaction system and reaction condition are the same as embodiment 2.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
The result is shown in Figure 10 of sample one.Positive amplification curve is shown when only using primer sets I detection.Draw when using
Positive amplification curve is not shown when object group II, it is consistent with actual conditions.Figure 10 is primer sets I's as a result, remaining is not
Add the result of template.
The above result shows that it is luxuriant and rich with fragrance green to carry out Marni using penicillium Marneffei primer provided by the invention combination
Mould detection, as a result accurately and reliably.
Comparative test
It is as shown in table 1 to compare primer sequence:
Table 1
| F3-1 | SEQ ID No.7 | CTTCATTACGAACGGGG |
| B3-1 | SEQ ID No.8 | TTAGACGTAGGTGCA |
| FIP-1 | SEQ ID No.9 | GTTGAGAAAGGATCGCCTGAGTTGGTGGTGGTGG |
| BIP-1 | SEQ ID No.10 | TCCTTCGACTCTCGAGTTCTGAAACCGCTGCGCTTG |
| LF-1 | SEQ ID No.11 | TTAGGACTCGGGGCTGG |
| LB-1 | SEQ ID No.12 | CGCACTGCCTTAAACGC |
Using existing primer sequence and comparison primer sequence, test is compared.
Sensitivity comparison: (see Figure 11-12)
Experimental design: using existing primer and comparison primer, 20 repeat amplification protcols of detection limit grade are carried out.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5 × 10 for 1 μ L primer mixture, 1 μ L dilution2), it mends
Water is to 10 μ L.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and inner primer BIP
Final concentration be 2 μM, the final concentration of ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
React primer: current primer and comparison primer
As a result: now using primer repeatability better than comparison primer.
Specificity comparison: (see Figure 13-14)
Experimental design: using existing primer and comparison primer, the amplification of four kinds of unrelated bacterium templates is carried out.
Template: preparation aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；Aspergillus terreus (compile by CGMCC, bacterial strain
Number: 3.08115) genomic DNA；Cryptococcus neoformans (ATCC, bacterial strain number: 208821) genomic DNA；Add special cryptococcus (ATCC,
Bacterial strain number: the 14248) template of genomic DNA.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 10 for 1 μ L primer mixture, 1 μ L dilution4), moisturizing is extremely
10μL.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, the end of inner primer FIP and inner primer BIP
Concentration is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
React primer: current primer and comparison primer
As a result: now good using primer specificity, no non-specific amplification；There is the non-of aspergillus fumigatus and Aspergillus terreus in comparison primer
Specific amplified.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Capitalbio Corporation Co., Ltd.
<120>primer sets and its application
<130> MP1729046
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgttcccagc cccg 14
<210> 2
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tggtgcagtc ttcttg 16
<210> 3
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aactcgagag tcgaaggaga ctcaggcgat cctttc 36
<210> 4
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgcactgcct taaacgcgct gctctggatc gcta 34
<210> 5
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cgccaccgct ttgaa 15
<210> 6
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gcacctacgt ctaacc 16
<210> 7
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cttcattacg aacgggg 17
<210> 8
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ttagacgtag gtgca 15
<210> 9
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gttgagaaag gatcgcctga gttggtggtg gtgg 34
<210> 10
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tccttcgact ctcgagttct gaaaccgctg cgcttg 36
<210> 11
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ttaggactcg gggctgg 17
<210> 12
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cgcactgcct taaacgc 17
Claims (10)
1. primer sets, including primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(a1), there is nucleotide sequence shown in SEQ ID NO:1；
(a2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(a3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(a4), the complementary series of the sequence as shown in (a1), (a2) or (a3)；
Primer-the B3 has any one in nucleotide sequence as follows:
(a5), there is nucleotide sequence shown in SEQ ID NO:2；
(a6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(a7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(a8), the complementary series of the sequence as shown in (a5), (a6) or (a7)；
Primer-the FIP has any one in nucleotide sequence as follows:
(a9), there is nucleotide sequence shown in SEQ ID NO:3；
(a10), have nucleotide sequence shown in SEQ ID NO:3 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a11) I, the sequence with nucleotide sequence shown in SEQ ID NO:3 at least 80% homology；
(a12), the complementary series of the sequence as shown in (a9), (a10) or (a11)；
Primer-the BIP has any one in nucleotide sequence as follows:
(a13), there is nucleotide sequence shown in SEQ ID NO:4；
(a14), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(a16), the complementary series of the sequence as shown in (a13), (a14) or (a15)；
Primer-the LF has any one in nucleotide sequence as follows:
(a17), there is nucleotide sequence shown in SEQ ID NO:5；
(a18), have nucleotide sequence shown in SEQ ID NO:5 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(a20), the complementary series of the sequence as shown in (a17), (a18) or (a19)；
Primer-the LB has any one in nucleotide sequence as follows:
(a21), there is nucleotide sequence shown in SEQ ID NO:6；
(a22), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(a24), the complementary series of the sequence as shown in (a21), (a22) or (a23).
2. primer sets according to claim 1, which is characterized in that the primer-F3, the primer-B3, the primer-
FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio be 0.5:0.5:2:2:1:1.
3. application of the primer sets as described in claim 1 in the nucleic acid molecules of amplification penicillium Marneffei.
4. primer sets as described in claim 1 are detecting and/or are identifying the application in penicillium Marneffei.
5. application of the primer sets as described in claim 1 in the kit of preparation detection and/or identification penicillium Marneffei.
6. including the kit of primer sets as described in claim 1, which is characterized in that the purposes of the kit includes:
I, penicillium Marneffei is identified；
II, detect in sample to be tested whether contain penicillium Marneffei.
7. a kind of method for identifying penicillium Marneffei, which comprises the steps of:
(1) genomic DNA of bacterium to be measured is obtained；
(2) for the genomic DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediation etc.
Temperature amplification, obtains amplification；
(3) qualification result is obtained according to the amplification.
8. the method according to the description of claim 7 is characterized in that if amplification is specific amplification, in bacterium to be measured
Contain or candidate contains penicillium Marneffei.
9. in a kind of detection sample to be tested whether the method containing penicillium Marneffei, which comprises the steps of:
(1) total DNA of sample to be tested is obtained；
(2) for the total DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediated isothermal expansion
Increase, obtains amplification；
(3) testing result is obtained according to the amplification.
10. according to the method described in claim 9, it is characterized in that, if amplification be specific amplification, it is described to be measured
Contain in sample or candidate contains penicillium Marneffei.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634154.0A CN110055345A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634154.0A CN110055345A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110055345A true CN110055345A (en) | 2019-07-26 |
Family
ID=67315825
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811634154.0A Pending CN110055345A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110055345A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304349A (en) * | 2019-12-17 | 2020-06-19 | 北京百康芯生物科技有限公司 | Method for combined detection of multiple pathogen nucleic acids difficult to culture and identify |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726568A (en) * | 2015-03-04 | 2015-06-24 | 何志义 | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof |
| CN104762396A (en) * | 2015-04-15 | 2015-07-08 | 中国人民解放军第二军医大学 | Histoplasma infection molecular diagnosis kit based on loop-mediated isothermal amplification (LAMP) technique principles and application thereof |
-
2018
- 2018-12-29 CN CN201811634154.0A patent/CN110055345A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726568A (en) * | 2015-03-04 | 2015-06-24 | 何志义 | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof |
| CN104762396A (en) * | 2015-04-15 | 2015-07-08 | 中国人民解放军第二军医大学 | Histoplasma infection molecular diagnosis kit based on loop-mediated isothermal amplification (LAMP) technique principles and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| JIUFENG SUN等: "Development and evaluation of loop-mediated isothermal amplification (LAMP) for the rapid diagnosis of Penicillium marneffei in archived tissue samples", 《FEMS IMMUNOLOGY & MEDICAL MICROBIOLOGY》 * |
| PANJAPHORN NIMMANEE等: "Functional analysis of atfA gene to stress response in pathogenic thermal dimorphic fungus Penicillium marneffei", 《PLOS ONE》 * |
| 陈欢等: "环介导等温扩增技术检测马尔尼菲青霉菌的研究", 《中华医院感染学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304349A (en) * | 2019-12-17 | 2020-06-19 | 北京百康芯生物科技有限公司 | Method for combined detection of multiple pathogen nucleic acids difficult to culture and identify |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK2430188T3 (en) | METHOD AND KIT FOR DETECTING ANTIBIOTIC RESISTANT BACTERIA | |
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| Dijkshoorn | Acinetobacter—microbiology | |
| WO2021082590A1 (en) | Lamp detection method for vibrio parahaemolyticus o9 serotype o antigen molecular typing | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN109706145B (en) | Primer set and application thereof | |
| CN110093432B (en) | sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof | |
| CN109487000B (en) | Primer combination and application thereof | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN109988855B (en) | LAMP primer combination for detecting six kinds of aspergillus and application thereof | |
| CN109988857B (en) | LAMP primer combination for detecting two cryptococcus and application thereof | |
| JP2020516271A (en) | Detection and design of microorganisms using ILV3 | |
| CN110055345A (en) | Primer sets and its application | |
| CN109706259A (en) | Primer sets and its application | |
| CN109988856B (en) | LAMP primer combination for detecting yersinia pneumocystis and application thereof | |
| CN115992273A (en) | Nucleic acid molecule, kit and detection method for detecting streptococcus pneumoniae | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN113718053A (en) | Probe and primer pair for detecting yersinia sporogenes, detection method and application | |
| JP2006333785A (en) | Method for detecting clostridium difficile toxin b gene using lamp method, and primer set usable in the method | |
| CN108034736B (en) | Detection kit for drug resistance of Escherichia coli fluoroquinolone antibiotics, detection method and application | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| LU505160B1 (en) | Crrna and kit for detecting salmonella | |
| CN113151570B (en) | Loop-mediated isothermal amplification LAMP technology based on LNA modification and application of LAMP technology in rapid detection of candida | |
| JP6381771B1 (en) | Primer set for amplifying nucleic acid derived from Dwarf fungus and method for detecting Dwarf fungus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190726 |