CN104726568A - Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof - Google Patents
Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof Download PDFInfo
- Publication number
- CN104726568A CN104726568A CN201510095947.XA CN201510095947A CN104726568A CN 104726568 A CN104726568 A CN 104726568A CN 201510095947 A CN201510095947 A CN 201510095947A CN 104726568 A CN104726568 A CN 104726568A
- Authority
- CN
- China
- Prior art keywords
- penicillium marneffei
- lamp
- loop
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof. The kit comprises LAMP primers, a 2x reaction buffer, Bst DNA polymerase, a fluorescence visual detection agent, ultrapure water and a penicillium marneffei DNA template, wherein the LAMP primers comprise outer primers F3 and B3 and inner primers FIP and BIP. Specificity detection and sensibility detection confirm the LAMP detection method provided by the invention can be used for monitoring reaction in real time and quantitatively detecting the copy number of penicillium marneffei, detection results can be obtained rapidly and correctly, and convenience is provided for conveniently and rapidly detecting penicillium marneffei.
Description
Technical field
The present invention relates to technical field of microbial detection, relate to a kind of quick, visual and can the loop-mediated isothermal amplification kit of Real_time quantitative detection penicillium Marneffei and application thereof specifically.
Background technology
People's penicilliposis marneffei (
pSM Penicilliosis marneffei) be a kind of by Penicillium marneffei (
pM Penicillium marneffei) the extensive disseminated infections that causes, be a kind of opportunistic infection lethality mycosis.Penicillium marneffei belongs to imperfect fungi, Haplomycetes, hyphomycetales, Moniliaceae, Penicillium.It is characterized in that in Penicillium (>270 kind) unique in temperature biphasic or bipolar type pathogenic bacterium, exist with mycelia form at nature, then can form little circle in the tissue to elliptical erythrocyte.
Penicilliposis marneffei all has report all over the world, but with South East Asia morbidity at most, as the area such as Guangxi, Guangdong, Hong Kong of Northern Thailand, Vietnam, India, Laos, China, and is considered to the prevailing disease in above area.Before the eighties in 20th century, this disease is report seldom, but along with the appearance of acquired immune deficiency syndrome (AIDS) (AIDS) and popular, South East Asia one is with this disease to increase year by year, has now become common systemic mycoses, is one of common opportunistic infection of AIDS.China reports this disease 1 example early than Guangxi in 1985, and later report increases gradually, and the whole nation has more than 12 provinces or municipality directly under the Central Government's this disease of report discovery so far, and with South China, particularly Guangxi, Guangdong two province are maximum.
The contagium of penicilliposis marneffei and route of transmission are not yet clear, and main intermediate host is bamboo rat.This sick incidence of occult, complicated clinical manifestation, treatment difficulty, case fatality rate can reach 91.3%.Its survival rate and early diagnosis closely related, therefore, how fast, efficiently and accurately diagnose penicilliposis marneffei just seem especially important.
Current diagnosis penicilliposis marneffei comprises traditional method, serological method and molecular biological testing.Traditional method comprises Routine Test Lab inspection, direct smear and fungus culture, histopathological examination, immunologic test, radiological examination, these traditional methods specificity except fungus culture is all not strong, and fungus culture is consuming time longer, generally need 1-2 time-of-week; Serological method mainly detects by ELISA method, with
p.marneffeimannoproteins (Mp1p) and polygalactomannan be antigen, although serodiagnosis susceptibility is higher, but method is complicated, need higher experiment condition, expend height, and be still short of a large amount of clinical samples do Prospective Clinical evaluation, and part detection method specificity is lower, there is intercrossing with other fungies; Therefore the method is at present also not used for clinical; Molecular biology utilizes the rrna of rDNA to transcribe interval (internal transcribed spacers, ITS) the ripe qualification being applied to multiple pathogenic fungi of sequential analysis, conventional detection method comprises Chao Shi PCR, quantitative fluorescent PCR and rolling circle amplification.Although PCR method comparatively ordinary method quick and precisely, need complicated plant and instrument, cost is higher, is not suitable for basic unit and Site Detection.
Summary of the invention
The object of this invention is to provide a kind of for basic unit is easy, fast detect the method for penicillium Marneffei exactly, disclose a kind of quick, visual and can the loop-mediated isothermal amplification kit of detection penicillium Marneffei of real-time quantitative.The technical scheme used for realizing the object of the invention is:
A kind of penicillium Marneffei loop-mediated isothermal amplification kit, this test kit comprises LAMP primer, 2 × reaction buffer, Bst archaeal dna polymerase, fluorescence visual detection reagent, ultrapure water and penicillium Marneffei DNA profiling, and described LAMP primer comprises outer primer F3(SEQ ID NO:1) and B3(SEQ ID NO:2) and inner primer FIP(SEQ ID NO:3) and BIP(SEQ ID NO:4);
Wherein the sequence of primer is respectively:
F3 TCAAAGCTACTCTGG
B3 TGGAGACCAATTCGC
FIP CAGGGCCAAGGGCAGTCCCTCCAAAATGAGC
BIP AGGAACCTCTTGTTCAGGCTGGCCTCCTCCTGTTGTTGCCTAAG；
2 described × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
It is the genomic dna using bacterial genomes to extract test kit extraction penicillium Marneffei culture or clinical separation fungi that above-described penicillium Marneffei DNA profiling extracts.
Above-described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
Above-described 2 × reaction buffer comprises Tris-HCL 45-50mM, KCL 25-30mM, MgSO
418-25mM, (NH
4)
2sO
422-28mM, Tween20 0.3-0.8 ℅, Betaine 2-3.5M and dNTPs3-5 mM, above-mentioned solvent, under pH is about 8.8 conditions, evenly obtains by its compound method.
An application for penicillium Marneffei loop-mediated isothermal amplification kit, for detecting doubtful penicillium Marneffei, concrete detecting step comprises:
(1) Design and synthesis of LAMP primer
(2) extraction of penicillium Marneffei DNA profiling
(3) LAMP reaction system is set up
(4) LAMP detection method.
Above-described LAMP reaction system sets up LAMP in 25 μ L,
2 × reaction buffer 12.5 μ L
Bst DNA polysaccharase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Penicillium Marneffei DNA 2 μ L
Ultrapure water supplies 25 μ L.
Above-described LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
Above-described LAMP detection method adopts the real-time turbidimeter of Loopamp LA-320C to carry out airtight complete monitoring, and temperature of reaction is 63 DEG C, reacts appearance amplification in about 30 minutes.
Substantive distinguishing features of the present invention and progress are:
1) high specificity
LAMP detection method specific detection of the present invention goes out penicillium Marneffei, and the contrast fungus and bacterium detected and all no positive result of water contrast are out, consistent with PCR detected result.
2) highly sensitive
The sensitivity of common PCR detection method is 1.7 × 10
-6ng/ μ L number level, and the LAMP method using the present invention to detect, detectability is about 1.7 × 10
-7ng/ μ L, susceptibility is 10 times of regular-PCR.
3) obtain a result rapidly
The whole process of common PCR just can be obtained a result at 24 hours, the LAMP reaction method that current majority is set up after the completion of reaction, the video picture of agarose gel electrophoresis ultraviolet analysis must be adopted to carry out result of determination, extract acquisition test-results from fungal genomic DNA, need 4-5 hours.Amplification is there is in LAMP detection method reaction provided by the invention at about 30 minutes, amplification can be completed in 60 minutes, and result decision procedure easy-amplification terminate to get final product judged result, not needing to carry out the video picture of agarose gel electrophoresis ultraviolet analysis again and carry out result of determination, can complete in 2-3 hour to obtaining net result from extracting genome DNA.
4) do not pollute
The fluorescence dye that current LAMP method is used for directly observing is for adding after reaction, and fluorescence dye of the present invention is the fluorexon commercial dyes (non-syber-green) added before the reaction, and testing process does not need to uncap.But development process can only be reaction terminate after uncap and add fluorescence dye and carry out color reaction, whether observe has colour developing to carry out interpretation test-results, or the method for being swum by leakage of electricity carries out result judgement, specific amplification and non-specific amplification cannot be distinguished, because this increasing the probability of false positive diagnoses result; And for weak positive reaction, be probably mistaken for feminine gender by the mode of artificial naked eyes interpretation; In addition, carried out the mode of sentence read result by the method for electrophoresis, add experimentation cost, time-consuming and easily cause laboratory pollution.And LAMP detection method of the present invention is on result judges, directly carry out result of determination by the turbidity value of turbidimeter detection reaction pipe, fluorescent dye determination detected result can not be carried out or carry out agarose gel electrophoresis detected result, not needing to uncap, can effectively avoid polluting.
5) can real-time quantitative
The present invention utilizes Tubidimeter real-time LA-320C turbidimeter to carry out the result of real-time analysis LAMP reaction, the typical curve that time of the turbidity value that the concentration of different standard models is corresponding is depicted as, substitute into typical curve equation, the penicillium Marneffei copy number of each time can be obtained, reach the object of detection by quantitative product.
Accompanying drawing explanation
Fig. 1 is our bright LAMP method specific detection result; Wherein 1, penicillium Marneffei; 2, aspergillus fumigatus; 3, Fusarium solani; 4, Exophiala spinifera bacterium; 5, intestinal bacteria; 6, Aeromonas hydrophila; 7, the lonely bacterium of Kazakhstan; 8, the lonely bacterium of wound; 9, water contrast.Result shows the upcurve that turbidity appears in 1 strain penicillium Marneffei reaction tubes, and 7 strain negative control bacterium reaction tubess and water control reaction are all without amplification.
Fig. 2 and Fig. 3 is the sensitivity Detection result of LAMP method of the present invention and traditional PCR method; 1:1.7 × 10
1ng/ μ L; 2:1.7 × 10
0ng/ μ L; 3:1.7 × 10
-1ng/ μ L; 4:1.7 × 10
-2ng/ μ L; 5:1.7 × 10
-3ng/ μ L; 6:1.7 × 10
-4ng/ μ L; 7:1.7 × 10
-5ng/ μ L; 8:1.7 × 10
-6ng/ μ L; 9:1.7 × 10
-7ng/ μ L; 10:1.7 × 10
-8ng/ μ L; 11:water.
Recombinant plasmid pMD18-T-
mPinitial concentration be 1.7 × 10ng/ μ L, after 10 times of doubling dilutions, carry out LAMP and pcr amplification, result display LAMP method detectability is about 1.7 × 10
-7ng/ μ L, and the detection of PCR method is limited to 1.7 × 10
-6ng/ μ L.
Fig. 4 is visual results after adding fluorescence dye: the response situation that right pipe is is template with penicillium Marneffei genomic dna is positive findings, and left pipe is the response situation of negative control, is negative control result.
Fig. 5 is the typical curve of detection by quantitative penicillium Marneffei of the present invention; Utilize the typical curve that turbidity value corresponding to the concentration of different standard models was depicted as the time, substitute into typical curve equation, the penicillium Marneffei copy number of each time can be obtained.
Embodiment
1, the preparation of material
Penicillium Marneffei, aspergillus fumigatus, Fusarium solani, sour jujube shape outer blank enzyme bacterium, intestinal bacteria, Aeromonas hydrophila, the lonely bacterium of Kazakhstan, the lonely bacterium of wound, preserve for Guangxi Zhuang Autonomous Region aquatic science research institute is separated.LAMP method DNA cloning test kit is purchased from Beijing Lanpu Biological Technology Co., Ltd., and article No. SLP204, bacterial genomes DNA extraction kit is century bio tech ltd purchased from health, article No. CW0522.
2, the Design and synthesis of LAMP primer
According to the penicillium Marneffei MP1 sequence in GenBank, utilize a set of LAMP primer of LAMP method primer Autocad PrimerExplorer V4 software design, wherein F3, B3 are outer primer, FIP, BIP are inner primer, wherein F3, B3 are that penicillium Marneffei PCR detects primer, wherein
F3 TCAAAGCTACTCTGG
B3 TGGAGACCAATTCGC
FIP CAGGGCCAAGGGCAGTCCCTCCAAAATGAGC
BIP AGGAACCTCTTGTTCAGGCTGGCCTCCTCCTGTTGTTGCCTAAG
3, fungal genomic DNA extracts
The bacterial genomes extraction test kit using health to produce for century bio tech ltd extracts fungal genomic DNA.
4, LAMP reaction system is set up
According to test kit specification sheets, by 25 μ l system configurations:
2 × reaction buffer 12.5 μ L
Bst DNA polysaccharase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Penicillium Marneffei DNA 2 μ L
Ultrapure water supplies 25 μ L.
LAMP reaction is with real-time turbidimeter (LA-320C, Rong Yan company of Japan) form of carrying out airtight complete monitoring monitor present method detect situation, turbidimeter monitors amplification situation in real time, can drawing standard curve, time value corresponding to 0.1 turbidity value is reached by obtaining unknown sample, can calculate the starting copy number of this sample from typical curve, 63 DEG C that recommend with test kit as temperature of reaction.
5, LAMP detection method
1) specific detection
Extract the genomic dna template of reacting as LAMP of penicillium Marneffei, aspergillus fumigatus, Fusarium solani, Exophiala spinifera bacterium, intestinal bacteria, Aeromonas hydrophila, the lonely bacterium of Kazakhstan, the lonely bacterium of wound, in contrast with water simultaneously, carry out the LAMP amplification of each bacterial strain, the specificity of inspection LAMP method.
2) sensitivity Detection
With the penicillium Marneffei genomic dna extracted for template, carry out pcr amplification with outer primer F3 and B3, by goal gene connection carrier pMD-18T, clone, extract the plasmid of mono-clonal bacterium, measure its concentration, through sequence verification.With RNA-Free Water by recombinant plasmid pMD-18T-
mPcontinuous 10 times of doubling dilutions become 10 extent of dilution, get each extent of dilution 2 μ L and carry out LAMP amplification as template.
3) fluorescent visual detects
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye before the reaction, the dyestuff added is fluorexon commercial dyes, react at 63 DEG C after 60 minutes, observe under ultraviolet lamp, do not adopt the video picture of agarose gel electrophoresis ultraviolet analysis, avoid uncapping and run the Aerosol Pollution that electrophoresis observation causes.
The specific outcome of embodiment 1 LAMP detection method
LAMP amplification is carried out to 1 strain penicillium Marneffei, 3 strain contrast fungies, 4 strain negative control bacterium and water contrast, result as shown in Figure 1, the upcurve of turbidity is there is in penicillium Marneffei reaction tubes at about 35 minutes, for positive findings, 3 strain contrast fungies, 4 strain negative control bacterium and the water control reaction Guan Junwu situation that increases occur, are negative findings.
The susceptibility results of embodiment 2 LAMP detection method
Recombinant plasmid pMD18-T-
mPinitial concentration be 1.7 × 10
1ng/ μ L, carries out LAMP and pcr amplification after 10 times of doubling dilutions, and as shown in Figures 2 and 3, result display LAMP method detectability is about 1.7 × 10 to result
-7ng/ μ L, and the detection of PCR method is limited to 1.7 × 10
-6ng/ μ L.
The fluorescent visual detected result of embodiment 3 LAMP detection method
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye before reaction, 63 DEG C of reactions are after 60 minutes, observe under ultraviolet lamp, Fig. 4 is observations, and left pipe is negative control, right pipe is take penicillium Marneffei as the response situation of template, show that the method set up can facilitate basic unit to use, the LAMP primer that only test kit need be used to coordinate present method to design, after adding sample, with cheap water-bath keep 63 DEG C 60 minutes, get final product rapid examination result, and without the need to uncapping, avoid pollution.
The drafting of embodiment 4 penicillium Marneffei quantitation curves
Contrast is set: concentration is 1.7 × 10
1ng/ μ L, 1.7 × 10
0ng/ μ L, 1.7 × 10
-1ng/ μ L, 1.7 × 10
-2ng/ μ L, 1.7 × 10
-3ng/ μ L, 1.7 × 10
-4ng/ μ L, 1.7 × 10
-5each one of the standard model of ng/ μ L, because the negative logarithm of concentration and turbidity value be 0.1 time value linear, so the value that turbidimeter can be captured and time (as table 1) make typical curve, obtain typical curve equation, y=0.4145x-8.9968, as shown in Figure 5.From typical curve equation coefficient R
2be 0.9963, in good linear relationship.Take time as X value, can obtain the negative time number formulary of Y value and concentration, then concentration is 10-
y, then be multiplied by radix 1.7, be 1.7 x10
-yng/ μ L.According to copy number reduction formula copies/ μ L=(6.02 x 10
23x (ng/ul x 10
-9))/(DNA length x 660), DNA length is that carrier sequence size adds goal gene sequence size, is 2693+220=2913 bp, is converted into copy number (copies/ μ L): 6.02 x 10
23x(1.7 x10
-yx 10
-9)/(2913 x 660), be reduced to: 5.32x 10
8x10
-y.As certain test sample reach turbidity value be 0.1 time be 25 minutes, bring set up typical curve equation into, obtain Y and equal 0.534, then concentration is 10-
0.534, then being multiplied by radix 1.7, the concentration being sample is 1.7 x10
-0.534ng/ μ L, copy number is 5.32 x 10
8x10
-0.536, be 5.32x 10
7.468copies/ μ L, thus reach quantitative effect.
Table 1
| Time (minute) | 19.8 | 21.5 | 24 | 26.3 | 28.6 | 31.4 | 34.1 |
| Standard value (-LOG) | -1 | 0 | 1 | 2 | 3 | 4 | 5 |
Claims (8)
1. a penicillium Marneffei loop-mediated isothermal amplification kit, it is characterized in that, this test kit comprises LAMP primer, 2 × reaction buffer, Bst archaeal dna polymerase, fluorescence visual detection reagent, ultrapure water and penicillium Marneffei DNA profiling, and described LAMP primer comprises outer primer F3(SEQ ID NO:1) and B3(SEQ ID NO:2) and inner primer FIP(SEQ ID NO:3) and BIP(SEQ ID NO:4);
Wherein the sequence of primer is respectively:
F3 TCAAAGCTACTCTGG
B3 TGGAGACCAATTCGC
FIP CAGGGCCAAGGGCAGTCCCTCCAAAATGAGC
BIP AGGAACCTCTTGTTCAGGCTGGCCTCCTCCTGTTGTTGCCTAAG；
2 described × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
2. penicillium Marneffei loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described penicillium Marneffei DNA profiling extracts from bacterial genomes DNA extraction kit.
3. penicillium Marneffei loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
4. penicillium Marneffei loop-mediated isothermal amplification kit according to claim 1, is characterized in that, 2 described × reaction buffer comprises Tris-HCL 45-50mM, KCL 25-30mM, MgSO
418-25mM, (NH
4)
2sO
422-28mM, Tween20 0.3-0.8 ℅, Betaine 2-3.5M and dNTPs3-5 mM.
5. an application for penicillium Marneffei loop-mediated isothermal amplification kit, is characterized in that, for detecting doubtful penicillium Marneffei, concrete detecting step comprises:
(1) Design and synthesis of LAMP primer
(2) extraction of penicillium Marneffei DNA profiling
(3) LAMP reaction system is set up
(4) LAMP detection method.
6. the application of penicillium Marneffei loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described LAMP reaction system sets up LAMP in 25 μ L,
2 × reaction buffer 12.5 μ L
Bst DNA polysaccharase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Penicillium Marneffei DNA 2 μ L
Ultrapure water supplies 25 μ L.
7. the application of penicillium Marneffei loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
8. the application of penicillium Marneffei loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described LAMP detection method adopts real-time turbidimeter to carry out airtight complete monitoring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095947.XA CN104726568A (en) | 2015-03-04 | 2015-03-04 | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095947.XA CN104726568A (en) | 2015-03-04 | 2015-03-04 | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104726568A true CN104726568A (en) | 2015-06-24 |
Family
ID=53450979
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510095947.XA Pending CN104726568A (en) | 2015-03-04 | 2015-03-04 | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104726568A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055345A (en) * | 2018-12-29 | 2019-07-26 | 博奥生物集团有限公司 | Primer sets and its application |
| CN112626182A (en) * | 2021-02-01 | 2021-04-09 | 云南省传染病医院、云南省艾滋病关爱中心(云南省心理卫生中心) | Molecular identification method of Marneffei staphylium |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705300A (en) * | 2009-11-05 | 2010-05-12 | 北京大学第一医院 | Special probe and gene chip used for identifying penicillium marneffei |
| CN103509870A (en) * | 2013-09-29 | 2014-01-15 | 广西医科大学 | One group of primers and probes for diagnosing penicilliosis marneffei and application thereof |
-
2015
- 2015-03-04 CN CN201510095947.XA patent/CN104726568A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705300A (en) * | 2009-11-05 | 2010-05-12 | 北京大学第一医院 | Special probe and gene chip used for identifying penicillium marneffei |
| CN103509870A (en) * | 2013-09-29 | 2014-01-15 | 广西医科大学 | One group of primers and probes for diagnosing penicilliosis marneffei and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| J SUN. ET AL: "Development and evaluation of loop-mediated isothermal ampli¢cation(LAMP) for the rapid diagnosis ofPenicillium marne¡ei inarchived tissue samples", 《FEMS IMMUNOLOGY AND MEDICAL MICROBIOLOGY》 * |
| 谢志满等: "艾滋病并马尔尼菲青霉病临床特征及诊治进展", 《蛇志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055345A (en) * | 2018-12-29 | 2019-07-26 | 博奥生物集团有限公司 | Primer sets and its application |
| CN112626182A (en) * | 2021-02-01 | 2021-04-09 | 云南省传染病医院、云南省艾滋病关爱中心(云南省心理卫生中心) | Molecular identification method of Marneffei staphylium |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108796131B (en) | Double-fluorescence RT-LAMP detection group for visually identifying foot-and-mouth disease viruses and bluetongue viruses, kit and application thereof | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN103409546B (en) | Kit for detecting streptococcus suis type 2 and application of kit | |
| CN102363815B (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN106435039A (en) | Primers, probe, kit and method for detecting PRRS (porcine reproductive and respiratory syndrome) NADC-30 strain | |
| CN104651535A (en) | Reverse transcription loop-mediated isothermal amplification test kit of hog cholera virus and application thereof | |
| CN104263841B (en) | The real-time fluorescence LAMP detection method of black shank bacterium and test kit in potato | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| CN103898222A (en) | Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method | |
| CN103205494B (en) | LAMP (loop-mediated isothermal amplification) method for detecting haemophilus parasuis | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN105400902A (en) | Reverse transcription loop-mediated isothermal amplification kit for detecting pestedes petits ruminants viruses | |
| CN104031997B (en) | A kind of LAMP primer group for rapid detection ustilago scitaminea bacteria, test kit and detection method thereof | |
| CN105349672A (en) | Mycoplasma hyopneumoniae loop-mediated isothermal amplification kit and application thereof | |
| CN104651519A (en) | Mycoplasma bovis loop-mediated isothermal amplification kit and application thereof | |
| CN104726568A (en) | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| CN102952850A (en) | Real-time fluorescent quantitative PCR method used for detecting Mycobacterium tuberculosis, and primer, probe and kit thereof | |
| CN103205493B (en) | LAMP method for detecting Brucella | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN105779656A (en) | Porcine torque teno sus virus type 2 loop-mediated isothermal amplification kit and application thereof | |
| CN105821160A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for porcine kobuvirus and application thereof | |
| CN103014164A (en) | Duplex fluorescent quantitation RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for shellfish Bonamia and Perkinsus | |
| CN102146468B (en) | Special primer for assisted identification of Streptococcus suis type 2 and Streptococcus suis type 7 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160205 Address after: Support 530000 Nanning Road, the Guangxi Zhuang Autonomous Region No. 6 Applicant after: The First Affiliated Hospital of Guangxi Medical University Address before: 530000, room 211, research building, Guangxi Institute of Fisheries Sciences, 8 Castle Peak Road, Nanning, the Guangxi Zhuang Autonomous Region Applicant before: He Zhiyi |
|
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150624 |
|
| RJ01 | Rejection of invention patent application after publication |