CN103898222A - Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method - Google Patents
Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method Download PDFInfo
- Publication number
- CN103898222A CN103898222A CN201410137471.7A CN201410137471A CN103898222A CN 103898222 A CN103898222 A CN 103898222A CN 201410137471 A CN201410137471 A CN 201410137471A CN 103898222 A CN103898222 A CN 103898222A
- Authority
- CN
- China
- Prior art keywords
- salmonellas
- primer
- lamp
- detection
- salmonella
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a salmonella molecular detection kit based on bcfD genes and a non-diagnostic detection method. The kit comprises (1) 10* Lamp buffer; (2) 8000U/mL BstDNA polymerase; (3) 10mM dNTPs; (4) a Lamp primer group: outer primer 5pmol/micro liter, inner primer 40pmol/micro liter, and annular primer 20pmol/micro-liter; (5) double distilled water; (6) fluorescent dye: 10*SYBR Green I; (7) positive control: salmonella standard strain genome DNA; and (8) negative control: double distilled water. The LAMP detection method has the advantages of rapidness, high efficiency, simplicity in operation, high specificity, high sensitivity, broad-spectrum property, applicability to in-situ detection and the like; no complicated instrument is needed; novel technical support is provided for the detection of salmonella; the salmonella molecular detection kit can be used for screening and detecting salmonella in animal husbandry production units, basic medical sanitary units, entry-exit and different disease control centers and is wide in market prospect, good in economic benefit and social benefit and wide in application range.
Description
Technical field
The present invention relates to molecular Biological Detection technical field, in particular a kind of Salmonellas molecular detection kit and non-diagnostic assays method thereof based on bcfD gene.
Background technology
Salmonellas (Salmonella) is modal infecting both domestic animals and human cause of disease bacterium in enterobacteriaceae, often parasitizes in animal and human's body enteron aisle.No matter developed country or developing country, Salmonellas is all the important food borne bacteria that causes human infection.Be that in all bacterial food poisonings, ratio is the highest by salmonellal food poisoning, endanger the widest one, account for the 42.6%-60% of bacterial food poisoning.At present, the domestic detection for Salmonellas is still take conventional bacteriological detection method as main, its weak point is mainly manifested in: the first, operation steps is loaded down with trivial details consuming time, in existing national standard or industry standard, the detection of Salmonellas is needed to 4-6 days conventionally, can not meet quality monitoring and control and prevention of disease demand timely and effectively; The second, sensitivity is lower, in the time that Salmonellas content is lower in sample, easily causes false negative result; Three, accuracy is not high, especially the food after processing is subject to the effect of heating, dry, high salt and the factor such as freezing, and Salmonellas wherein can form auxotroph, causes phenotype not to be true to type, easily there is false negative result by traditional technique in measuring, cause the difference of detected result.Therefore, how to improve Salmonellas recall rate, shorten detection time, prevent from occurring because undetected phenomenon occurs the inhibited reactions such as reason such as sample complicacy, supressor be many, to guaranteeing that food safety has great importance.
Along with molecular biological development, traditional bacteriological detection method can not meet the rapid batch diagnosis of Salmonellas, the evaluation of pathogenic micro-organism is no longer confined in the checks such as morphology, develop into from molecular level and detected cause of disease nucleic acid and protein and other, new diagnostic techniques constantly occurs, as immunofluorescence, enzyme linked immunological, radioimmunity, PCR, dot hybridization, gene chip etc., wherein many methods can detect Salmonellas in 24h, but need to be equipped with specific equipment, complicated operation, and often there is non-specific result to occur, still can not meet the requirement of rapid detection.
Loop-mediated isothermal amplification technique is the novel nucleic acids method for quick that a kind of development in recent years is got up, be characterized in the 4 kinds of special primers of 6 zone design for target gene, utilize strand displacement type archaeal dna polymerase, can under isothermal condition, in (60～65 ℃), 1h, amplify specifically 10
9～10
10copy target sequence.Keeping on the basis of normal PCR technological merit, further improving the specificity of reaction, shortening detection time simultaneously.Now be applied to detection and the research of multiple pathogenic microorganisms, and there is good development prospect.
Pili is Salmonellas is sticked field planting key factor host, is extremely important in diagnostic reagent research and development field.Salmonellas can be expressed multiple pili, and different pili are expressed by corresponding pili operon gene coding.Research shows, bcf pili operon is to find at present a kind of pili operon the most conservative in Salmonellas, all conservative existence in the serotype comprising Salmonella enteritidis and Bang Geer Salmonellas; Study more fim pili operon and be mainly present in Salmonella enteritidis, and do not exist in Bang Geer Salmonellas.
Summary of the invention
Technical problem to be solved by this invention is the problem existing in detection Salmonellas for prior art, and a kind of Salmonellas molecular detection kit and non-diagnostic assays method thereof based on bcfD gene is provided.
Technical scheme of the present invention is as follows:
A Salmonellas molecular detection kit based on bcfD gene, comprising:
（1）10×Lamp?buffer；
(2) 8000U/mL BstDNA polysaccharase;
（3）10mM?dNTPs；
(4) Lamp primer sets: outer primer concentration is 5pmol/ μ L, and outer primer is F3 and B3, and F3 sequence is 5 '-CCGGACAAACGATTCTGGTA-3 ', and B3 sequence is 5 '-CCGACATCGGCATTATCCG-3 '; Inner primer concentration is 40pmol/ μ L, and inner primer is FIP and BIP, and FIP sequence is 5 '-TGCACTTTACCGGTACGCTGAATACAGCGGCAATTTCAACCA-3 ', and BIP sequence is 5 '-CGGTCTGGATTCGCAGGTCAAAGCGATAGCCTGGGGAAC-3 '; Ring primer concentration is 20pmol/ μ L, and ring primer is LF and LB, and LF sequence is 5 '-TACCCCCTCCGGCTTTTG-3 ', and LB sequence is 5 '-ACAATGCGTCTTATCGCTACG-3 ';
(5) distilled water;
(6) fluorescence dye: 10 × SYBR Green I;
(7) positive control: Salmonellas type strain genomic dna;
(8) negative control: distilled water.
Described 10 × Lamp buffer contains 200mM Tris-HCl(pH8.8,25 ℃), 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and the concentration expressed in percentage by volume triton x-100 that is 1%.
The non-diagnostic assays method of the Salmonellas molecular detection kit based on bcfD gene, comprises the steps:
(1) extraction of sample gene group DNA to be checked: extract according to a conventional method or test kit extraction;
(2) LAMP detection reaction system is as shown in the table:
Note: if adopt fluorescence visual method, add 10 × SYBR Green I2.5 μ L in reaction system, reaction system total amount keeps 25.0 μ L constant;
(3) reaction system in (2) is formulated in PCR pipe, positive control and negative control are set simultaneously;
(4) LAMP reaction conditions: rear centrifugal by mixing containing the PCR pipe of reaction system, be placed in 64 ℃ of reaction 50min of isoperibol (water-bath or PCR reaction instrument etc.), and at 80 ℃ of lasting 10min, take out.It is muddy that visual inspection liquid becomes, and illustrates in sample to be checked and contain Salmonellas; Or observation colour-change, color becomes green, in interpret sample, contains Salmonellas; Color is orange, and interpret sample is not containing Salmonellas; Or use 2% concentration agarose gel electrophoresis to detect, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
This test kit LAMP detection method has the following advantages:
(1) rapidly and efficiently: whole amplification only can complete with 35～50min, amplification output can reach 10
9～10
10individual copy target sequence;
(2) simple operation: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details step such as sex change of double-stranded DNA, only need a Daepori water flowing bath just to react and detect, condition is gentleer;
(3) high specific: the present invention according to Salmonellas bcfD gene design six Auele Specific Primers, apply above-mentioned six primers, 6 regions of amplified target sequence, in 6 regions, any region is not mated and all can not be carried out nucleic acid amplification with primer, therefore its specificity is high, and highly stable, form primer dimer probability low, guarantee carrying out smoothly of reaction;
(4) highly sensitive: the lowest detection limit can reach 5～6cfu/ pipe, than the high 1-2 of a regular-PCR order of magnitude;
(5) broad spectrum: it detects target spot bcfD gene and all guards existence and have specificity in most salmonella types;
(6) be applicable to Site Detection: it is positive that visual inspection liquid becomes muddiness, and clear is negative; If adopt fluorescence visual method to observe colour-change, color becomes green, in interpret sample, contains Salmonellas; Color is orange, and interpret sample is not containing Salmonellas; Or use 2% concentration agarose gel electrophoresis to detect, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
LAMP detection method of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, broad spectrum, be applicable to the advantages such as Site Detection, do not need complex instrument, for the detection of Salmonellas provides new technical support, can be used for livestock industry production unit, primary care health unit, entry and exit and the examination of each disease prevention and control center and detect Salmonellas, there are wide market outlook and larger economical, societal benefits, be suitable for applying on a large scale.
Accompanying drawing explanation
Fig. 1 is outer primer and the inner primer ratio optimization test-results figure of Salmonellas LAMP detection method of the present invention.
Fig. 2 is the outer primer and ring primer ratio optimization test-results figure of Salmonellas LAMP detection method of the present invention.
Fig. 3 is the default test-results figure of primer of Salmonellas LAMP detection method of the present invention.
Fig. 4 is different concns Mg in Salmonellas LAMP detection system of the present invention
2+test-results figure.
Fig. 5 is different concns BstDNA polymerase assay result figure in Salmonellas LAMP detection system of the present invention.
Fig. 6 is different concns dNTPs test-results figure in Salmonellas LAMP detection system of the present invention.
Fig. 7 is the differential responses humid test result figure of Salmonellas LAMP testing conditions of the present invention.
Fig. 8 be Salmonellas LAMP detect gene bcfD enzyme cut identify and outer primer to PCR the result figure; Wherein, swimming lane M is DL-5000marker; Swimming lane 1 is to get 5 μ L electrophoresis result after Salmonellas type strain ATCC14028LAMP product dilutes 10 times; Swimming lane 2 is cut product electrophoresis result for Hinf I enzyme, swimming lane 3 be outer primer to PCR product electrophoresis result, the negative contrast of swimming lane 4.
Fig. 9 is Salmonellas LAMP fluorescence visual detection result figure of the present invention.
Figure 10 is the sensitivity result figure of Salmonellas LAMP detection method of the present invention.
Figure 11 is the sensitivity result figure based on bcfD gene process of PCR detecting salmonella.
Figure 12 detects 15 strain Salmonellas type strain electrophoresis result figure in Salmonellas LAMP method specificity experiment of the present invention.
Figure 13 detects the non-Salmonellas type strain of 10 strain electrophoresis result figure in Salmonellas LAMP method specificity experiment of the present invention.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
The Salmonellas type strain ATCC14028 that laboratory is preserved carries out checking order after nucleic acid amplification, carry out homology analysis by BLAST software, (sequence has uploaded to U.S.'s gene database for the broad spectrum of acquisition Salmonellas and specific conservative target sequence bcfD gene; GenBank accession number: KJ021967, as shown in SEQ ID NO.7), then according to this conservative target-gene sequence, utilize online design software: Primer Explorer version4(
http:// primerexplorer.jp/e) carrying out the design of LAMP primer sets, result optimizing obtains three groups of primer pairs, and F3 and B3 are first group, and FIP and BIP are second group, and LF and LB are the 3rd group, concrete primer sequence is as table 1.In application, three groups of primer pairs can mix use by arbitrary proportion, have provided a kind of concrete optimization assembly as example in embodiment 2 reaction systems.
The LAMP of table 1 based on Salmonellas bcfD fimbriae gene detects primer
Described LAMP detection method gained bcfD gene amplification fragment sequence (dotted line frame is denoted as HinfI restriction enzyme site) is as follows:
CCGGACAAACGATTCTGGTAAATTTCGGCGCATTATACAGCGGCAATTTCAACCATGCAGGCCAAAAGCCGGAGGGGGTACGAGCGAAAAAATTCAGCGTACCGGTAAAGTGCAGCGGTCTG
GCAGGTCAATTTAACAATGCGTCTTATCGCTACGCCGGATAGCCACGTTCCCCAGGCTATCGCTTCGGATAATGCCGATGTCGG(SEQ?ID?NO.7)
The foundation of the molecular detection kit detection method of embodiment 2 based on Salmonellas bcfD fimbriae gene:
The various Salmonellas for Salmonellas being carried out preserve in three pairs of primer pair laboratories of LAMP detection obtaining with embodiment 1 carries out LAMP detection, and to obtain optimum response system and reaction conditions, concrete grammar is as follows:
(1) sample collecting: the Salmonellas molecular detection kit based on bcfD gene, described sample comprises 15 strain Salmonellas reference cultures used in specificity confirmatory experiment and the non-Salmonellas reference culture of 10 strains and the related bacterial strain from pig, ox, chicken, duck, goose cloaca and separate tissue thereof of clinical detection test, and the animal derived product separation bacterial strain such as the live-bird animal of selling on the market and egg, milk.
(2) extraction of sample gene group DNA to be checked: extract according to a conventional method or test kit extraction.
One, determining of optimal reaction system
1, ratio optimization and default experiment between primer
(1) optimization of ratio between primer
Take Salmonellas type strain ATCC14028 genomic dna as template, under the guiding of three pairs of primers that obtain at embodiment 1, carry out LAMP amplification, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 ℃), 10mM KCl, 10mM (NH
4)
2sO
4, the triton x-100 that concentration expressed in percentage by volume is 0.1%, 0.8M trimethyl-glycine (betaine), the MgSO of 8mM
41.4mMdNTPs, 8000U/mLBstDNA polymerase1 μ L(is purchased from NEB company), being optimized for of the concentration ratio of outer primer and inner primer: the concentration of outer primer is set as to 5pmol/ μ L, adds inner primer: 1:5,1:6 according to following ratio successively, 1:7,1:8,1:9, selects optimum concn ratio.The selection optimum concn ratio of fixing outer primer and inner primer, outer primer and the optimization that encircles primer concentration ratio: add ring primer: 1:2 according to following ratio successively, 1:3,1:4,1:5,1:6, selects optimum concn ratio.Other composition: F3, B35pmol/ μ L; FIP, BIP40pmol/ μ L; DNTPs1.4mmol/L; Reaction conditions is for being placed in 64 ℃ of isoperibol 50min, and in 80 ℃ of lasting 10min.Use 2% concentration agarose gel electrophoresis to detect, the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
Result as shown in Figure 1, in each reaction system, all can produce trapezoid-shaped strips, in the time that the ratio of outer primer and inner primer is 1:8, reacts best, so select the reaction system that the concentration ratio of outer primer and inner primer is 1:8.The concentration ratio of fixing inside and outside primer, encircle the concentration of primer by change, make to encircle the concentration of primer and the concentration ratio of inner primer between 1/8～6/8, result as shown in Figure 2, in the time that outer primer concentration is 5:8 with the ratio of ring primer concentration, can produce brighter amplified band.So the concentration ratio of determining outer primer, inner primer and ring primer is 1:8:5.In Fig. 1 and Fig. 2, swimming lane M is DL-5000marker; In Fig. 1, that swimming Taoist monastic name 1-5 is respectively is outer, inner primer is than 1:5,1:6,1:7,1:8,1:9, the negative contrast of swimming lane 6; In Fig. 2, swimming Taoist monastic name 1-5 is outward, encircles primer than 1:2,1:3,1:4,1:5,1:6, the negative contrast of swimming lane 6.
(2) the default test of primer
For the impact of checking wall scroll and single cover primer pair LAMP reaction has designed the default test of primer, in reaction system, primer adds as follows successively: primer inner and outer ring primer has entirely, without upstream outer primer F3, without downstream outer primer B3, supreme, downstream outer primer F3, B3, without upstream inner primer FIP, without downstream inner primer BIP, supreme, downstream inner primer FIP, BIP, supreme lantern primer LF, without lower lantern primer LB, supreme, lower lantern primer LF, LB, inner and outer ring primer all without, negative control, the effect in LAMP reaction of analysis of key binding site and corresponding primer thereof.
As shown in Figure 3, inner primer has played Main Function to test to result, and only adds wall scroll inner primer and can not start LAMP reaction and carry out.The default of outer primer do not have inner primer obvious on LAMP reaction impact, adds wall scroll outer primer and can start LAMP reaction yet, and the default startup on LAMP of ring primer does not affect, and just changes the efficiency of LAMP reaction.In Fig. 3, swimming lane M is DL-5000marker; Swimming Taoist monastic name 1-11 is respectively primer inner and outer ring primer to be had entirely, without upstream outer primer F3, without downstream outer primer B3, without upstream and downstream outer primer F3, B3, without upstream inner primer FIP, without downstream inner primer BIP, without upstream and downstream inner primer FIP, BIP, supreme lantern primer LF, without lower lantern primer LB, without upstream and downstream rings primer LF, LB, inner and outer ring primer is all without, the negative contrast of swimming lane 12.
2, the suitableeest Mg
2+determining of concentration
In reaction system, add the Mg of different concns
2+, to determine best Mg
2+concentration, comprises the following steps:
(1) take Salmonellas type strain ATCC14028 genomic dna as template, under the guiding of three pairs of primers that obtain at embodiment 1, carry out LAMP amplification, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 ℃), 10mM KCl, 10mM (NH
4)
2sO
4, the triton x-100 that concentration expressed in percentage by volume is 0.1%, 0.8M trimethyl-glycine (betaine), the respectively MgSO of interpolation (4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM)
4, 1.4mM dNTPs, 8000U/mL Bst DNA polymerase, the primer amount adding is: 5pmol F3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions is for being placed in 64 ℃ of isoperibol 50min, and at 80 ℃ of lasting 10min.2% concentration agarose gel electrophoresis detects, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
(2) at the above-mentioned different concns Mg that contains
2+reaction system in, result contains 8mM MgSO
4the detection effect of reaction system best, as shown in Figure 4, in figure, swimming lane M is DL-5000marker to result; Swimming Taoist monastic name 1-7 is respectively the MgSO of concentration 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM
4, the negative contrast of swimming lane 8.
3, determining of the suitableeest BstDNA polymerase reaction density
(1) take Salmonellas type strain ATCC14028 genomic dna as template, under the guiding of three pairs of primers that obtain at embodiment 1, carry out LAMP amplification, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 ℃), 10mM KCl, 10mM (NH
4)
2sO
4, the triton x-100 that concentration expressed in percentage by volume is 0.1%, 0.8M trimethyl-glycine (betaine), the MgSO of 8mM
41.4mmol/L dNTPs, 8000U/mL Bst DNA polymerase(is purchased from NEB company), design enzyme addition is followed successively by 0.0,0.6,0.8,1.0,1.2,1.4 μ L and is optimized exploration, the primer amount adding is: 5pmol F3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions is for being placed in 64 ℃ of isoperibol 35～50min, and at 80 ℃ of lasting 10min.Use 2% concentration agarose gel electrophoresis to detect, the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
(2) in (1), contain in the reaction system of different concns Bst DNA polymerase, as seen from Figure 5, when 8000U/mL Bst DNA polymerase addition is 1.0 μ L, effect is best.In Fig. 5, swimming lane M is DL-5000marker; Swimming Taoist monastic name 1-6 respectively corresponding Bst DNApolymerase addition is followed successively by 0.0,0.6,0.8,1.0,1.2,1.4 μ L, the negative contrast of swimming Taoist monastic name 7.
4, determining of the suitableeest dNTPs concentration
(1) take Salmonellas type strain ATCC14028 genomic dna as template, under the guiding of three pairs of primers that obtain at embodiment 1, carry out LAMP amplification, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 ℃), 10mM KCl, 10mM (NH
4)
2sO
4, concentration expressed in percentage by volume is 0.1% triton x-100,0.8M trimethyl-glycine (betaine), the MgSO of 8mM
4add respectively dNTPs (10mmol/L) 2 μ L, 2.5 μ L, 3 μ L, 3.5 μ L, 4 μ L, 4.5 μ L, 5 μ L, by the concentration of the dNTPs in reaction system be adjusted into successively 0.8,1,1.2,1.4,1.6,1.8,2.0mmol/L, 8000U/mL Bst DNA polymerase(is purchased from NEB company), the primer amount adding is: 5pmolF3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions is for being placed in 64 ℃ of isoperibol 50min, and at 80 ℃ of lasting 10min.Use 2% concentration agarose gel electrophoresis to detect, the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
(2) in the reaction system that contains different concns dNTPs in (1), as seen from Figure 6, dNTPs concentration all can amplify target gene DNA from 0.8-2.0mmol/L, but can obtain homogeneous, stable band at 1.4mmol/L.Thus, best dNTPs concentration is defined as 1.4mmol/L.In Fig. 6, swimming lane M is DL-5000marker; Swimming Taoist monastic name 1-7 respectively the concentration of the dNTPs in corresponding reaction system be followed successively by 0.8,1,1.2,1.4,1.6,1.8,2.0mmol/L, the negative contrast of swimming Taoist monastic name 8.
5, enzyme is cut checking LAMP reaction
In the extension increasing sequence of this test kit LAMP, contain a HinfI(G
▼aNTC/CTNA
▲g) restriction enzyme site, can carry out enzyme to Salmonellas LAMP amplified production and cut evaluation (it is 123bp and 88bp size two bands that enzyme is cut product), gets 2 μ L LAMP amplified productions, adds 1 μ L Hinf I, 2 μ L damping fluid and ddH
2o15 μ L, centrifugal after mixing lightly, under 37 ℃ of conditions, enzyme is cut 1h, 2.0% agarose gel electrophoresis observations.
In sum, optimal reaction system is defined as: the concentration ratio of outer primer, inner primer and ring primer is 1:8:5, Mg
2+concentration is 8mM, and 8000U/mL Bst DNA polymerase addition in 25 μ L systems is 1.0 μ L, and best dNTPs concentration is defined as 1.4mmol/L.
Two, determining of optimal reactive temperature
(1) take Salmonellas type strain ATCC14028 genomic dna as template, under the guiding of three pairs of primers that obtain at embodiment 1, carry out LAMP amplification, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 ℃), 10mM KCl, 10mM (NH
4)
2sO
4, 0.1% triton x-100,0.8M trimethyl-glycine (betaine), the MgSO of 8mM
4, 1.4mmol/LdNTPs, 8000U/mL Bst DNA polymerase(is purchased from NEB company), the primer amount adding is: 5pmolF3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions is that to be placed in respectively thermograde be the isoperibol 50min of 60.0 ℃, 61.0 ℃, 62.0 ℃, 63.0 ℃, 64.0 ℃, 65.0 ℃, and at 80 ℃ of lasting 10min.2% concentration agarose gel electrophoresis detects, and the positive can present typical specificity scalariform band, and feminine gender is without this phenomenon.
(2) as can be seen from Figure 7,2～7 swimming lanes have all produced trapezoid-shaped strips, illustrate at 60.0 ℃～65.0 ℃ temperature and can react, the brightest when 64.0 ℃ of bands, therefore select 64.0 ℃ as optimum temperuture.In Fig. 7, swimming lane M is DL-5000marker; Swimming Taoist monastic name 1-6 respectively corresponding temperature gradient is 60.0 ℃, 61.0 ℃, 62.0 ℃, 63.0 ℃, 64.0 ℃, 65.0 ℃, the negative contrast of swimming Taoist monastic name 7.
The present embodiment test LAMP detection method of the present invention and regular-PCR method detect the sensitivity of Salmonellas.Method is: first clinical Salmonellas and other negative strains are cultivated to (carrying out with reference to GB4789.4-2010), by the bacterium after cultivating, (original concentration is 5.6 × 10
7cfu/ μ L) carry out 10 times of gradient dilutions, extract DNA according to the method in embodiment 2, carrying out respectively LAMP and PCR detects, wherein PCR primer is the outer primer (F3 and B3) of LAMP method, the bacterium liquid of dilution is carried out to flat board simultaneously and cultivate counting, the sensitivity minimization of flat board being cultivated to count results and this test kit LAMP contrasts.Wherein: LAMP detection reaction system is as shown in table 2.
Table 2LAMP detection reaction system
Above-mentioned reaction system is formulated in PCR pipe, and positive control and negative control are set simultaneously; LAMP reaction conditions: the PCR pipe containing reaction system that above-mentioned configuration is completed mixes rear instantaneous centrifugal, is placed in 64 ℃ of reaction 50min of water-bath, and at 80 ℃ of lasting 10min.
PCR detection system is as shown in table 3.
Table 3PCR detection system
Above-mentioned reaction system is formulated in PCR pipe, and positive control and negative control are set simultaneously; PCR reaction conditions: the PCR pipe containing reaction system that above-mentioned configuration is completed mixes rear centrifugal, PCR detection system Amplification is specially: first 94 ℃ of denaturation 5min, start afterwards amplification cycles, and the program of each circulation is: 94 ℃ of sex change 20s, 58 ℃ of annealing 15s, 72 ℃ are extended 15s; Totally 35 circulations; After loop ends, 72 ℃ are extended 10min, 4 ℃ of persistences.
Result judgement: above-mentioned reaction tubes is placed in respectively to water-bath and regular-PCR instrument conditioned response separately, and this LAMP reaction finishes product and uses 2% concentration agarose gel electrophoresis to detect, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.PCR reaction product is used 2% concentration agarose gel electrophoresis, and positive findings is located as seen specific band clearly in 211bp size, and feminine gender does not have.
Result: the LAMP detection method minimum detectability 5.6cfu/ μ L of this test kit, the minimum detectability of PCR detection method is 56cfu/ μ L, result shows that test kit of the present invention has very high sensitivity and clinical detection is worth.Electrophoresis result is shown in Figure 10 and Figure 11.
As shown in figure 10, in figure: the template concentrations of swimming lane 1～9:DNA is respectively 5.6 × 10
7cfu/ μ L, 5.6 × 10
6cfu/ μ L, 5.6 × 10
5cfu/ μ L, 5.6 × 10
4cfu/ μ L, 5.6 × 10
3cfu/ μ L, 5.6 × 10
2cfu/ μ L, 5.6 × 10
1cfu/ μ L, 5.6 × 10
0cfu/ μ L5.6 × 10-
1cfu/ μ L; Swimming lane M:5000bp molecular weight standard, the negative contrast of swimming lane 10.Can see band more clearly at eight lanes, institute's corresponding DNA concentration is 5.6cfu/ μ L, and can't see amplified band completely after eight lanes.Therefore, judge that LAMP detection sensitivity, as 5.6cfu/ μ L, has higher sensitivity and using value.
As shown in figure 11, in figure: the template concentrations of swimming lane 1～7:DNA is respectively 5.6 × 10
6cfu/ μ L, 5.6 × 10
5cfu/ μ L, 5.6 × 10
4cfu/ μ L, 5.6 × 10
3cfu/ μ L, 5.6 × 10
2cfu/ μ L, 5.6 × 10
1cfu/ μ L, 5.6 × 10
0cfu/ μ L; Swimming lane M:5000bp molecular weight standard, the negative contrast of swimming lane 8.Can see slightly dark band at the 6th article of swimming lane, institute's corresponding DNA concentration is 56cfu/ μ L, and the 7th article of swimming lane be can't see amplified band completely.Therefore the detection sensitivity of, judging PCR is 56cfu/ μ L.
Carry out the specificity assessment of LAMP detection method by the method for embodiment 2, bacterial strain uses therefor and strain number are referring to table 4.By reference culture Salmonella paratyphi A, moscow' paratyphi B, Salmonella typhimurium, moscow' paratyphi C, Salmonella choleraesuls, Newport Salmonellas, Salmonella enteritidis, white dysentery Salmonellas, salmonella typhi, salmonella dublin, mountain Fu Dengbao Salmonellas, Strasbourg Salmonellas, two Arizona Salmonellas, Arizona Salmonellas, Bang Geer Salmonellas, bacillus ceylonensis A, Proteus mirabilis, Vibrio parahemolyticus, listeria monocytogenes, intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, campylobacter jejuni, Klebsiella pneumonia, campylobacter jejuni is cultivated, extract genomic dna, carry out LAMP detection according to embodiment 1, 64 ℃ of reaction 50min, result as shown in Figure 12 and Figure 13, the various specific amplification that demonstrates of Salmonellas, non-Salmonellas is all without non-specific amplification.In Figure 12, swimming Taoist monastic name 1-16 is respectively Salmonella paratyphi A, moscow' paratyphi B, Salmonella typhimurium, moscow' paratyphi C, Salmonella choleraesuls, Newport Salmonellas, Salmonella enteritidis, white dysentery Salmonellas, salmonella typhi, salmonella dublin, mountain Fu Dengbao Salmonellas, Strasbourg Salmonellas, two Arizona Salmonellas, Arizona Salmonellas, Bang Geer Salmonellas, negative control; In Figure 13, swimming Taoist monastic name 1-11 is respectively Salmonellas type strain ATCC14028, bacillus ceylonensis A, Proteus mirabilis, Vibrio parahemolyticus, listeria monocytogenes, intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, shigella flexneri, Klebsiella pneumonia, campylobacter jejuni, negative control.
Related relevant bacterial strain information in table 4 evaluation test process of the present invention
Note: in table results one hurdle: "+" represents positive; "-" represents negative.
By 10 × Lamp buffer, 8000U/mL BstDNA polysaccharase, 10mM dNTPs, detect primer sets (outer primer F3 and B3:5pmol/ μ L, inner primer FIP and BIP:40pmol/ μ L, ring primer LF and LB:20pmol/ μ L), distilled water, fluorescence dye (10 × SYBR Green I), positive control, negative control, wherein: 10 × Lamp buffer contains 200mM Tris-HCl(pH8.8, 25 ℃), 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and 1% triton x-100, and as the genomic dna 2 μ L of the Salmonellas of positive control, as jointly not packing containing the LAMP amplification system (distilled water) of DNA of negative control, be equipped with again products instruction (indicating staining and two kinds of detection methods of electrophoretic method), obtain the Salmonellas molecular detection kit based on bcfD gene.
(1) sample collecting: the Salmonellas molecular detection kit based on bcfD gene, described sample comprise from pig, ox, chicken, duck, goose, etc. the livestock and poultry Salmonellas and other negative bacterium bacterial strains and animal tissues and the movement that separate, and the animal derived product such as the live-bird animal of selling on the market and meat, egg, milk.
(2) extraction of sample gene group DNA to be checked: extract according to a conventional method or test kit extraction.
(3) LAMP detection reaction system is as shown in table 5.
Table 5LAMP detection reaction system
Above-mentioned reaction system is formulated in PCR pipe, and positive control and negative control are set simultaneously;
LAMP reaction conditions: the PCR pipe containing reaction system that above-mentioned configuration is completed mixes rear centrifugal, is placed in 64 ℃ of reaction 50min of water-bath, and at 80 ℃ of lasting 10min.
(4) result judgement: above-mentioned reaction tubes is placed in to water-bath reaction, and this LAMP reaction finishes product and uses 2% concentration agarose gel electrophoresis to detect, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.Statistics is in table 6.
The routine clinical practice sample detection of table 6338 result
In (5) 338 routine clinical feces of livestock and poultry samples and meat product, take Salmonellas GB detection method (GB4789.4 – 2010) method detection time used as 6-7 days, adopt test kit of the present invention to detect the omnidistance time used and be about 4 hours.As can be seen from Table 5, detect altogether the 21 routine Salmonellas positives with GB detection method, adopt the detection method of test kit of the present invention to detect the 21 routine Salmonellas positives, consistent with National Standard Method.As can be seen here, the detection method that test kit of the present invention is set up is keeping simpler, quick on tradition cultivation accurate, the reliable advantage of detection method detected result basis for clinical practice detection Salmonellas, being worthy to be popularized, is the detection method with good application prospect.
Should be understood that, for those of ordinary skills, can be improved according to the above description or convert, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.
Claims (3)
1. the Salmonellas molecular detection kit based on bcfD gene, is characterized in that, comprising:
（1）10×Lamp?buffer；
(2) 8000U/mL BstDNA polysaccharase;
（3）10mM?dNTPs；
(4) Lamp primer sets: outer primer concentration is 5pmol/ μ L, and outer primer is F3 and B3, and F3 sequence is 5 '-CCGGACAAACGATTCTGGTA-3 ', and B3 sequence is 5 '-CCGACATCGGCATTATCCG-3 '; Inner primer concentration is 40pmol/ μ L, and inner primer is FIP and BIP, and FIP sequence is 5 '-TGCACTTTACCGGTACGCTGAATACAGCGGCAATTTCAACCA-3 ', and BIP sequence is 5 '-CGGTCTGGATTCGCAGGTCAAAGCGATAGCCTGGGGAAC-3 '; Ring primer concentration is 20pmol/ μ L, and ring primer is LF and LB, and LF sequence is 5 '-TACCCCCTCCGGCTTTTG-3 ', and LB sequence is 5 '-ACAATGCGTCTTATCGCTACG-3 ';
(5) distilled water;
(6) fluorescence dye: 10 × SYBR Green I;
(7) positive control: Salmonellas type strain genomic dna;
(8) negative control: distilled water.
2. the Salmonellas molecular detection kit based on bcfD gene according to claim 1, it is characterized in that, described 10 × Lamp buffer contains the triton x-100 that 200mM Tris-HCl, 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and concentration expressed in percentage by volume are 1%.
3. the non-diagnostic assays method of the Salmonellas molecular detection kit based on bcfD gene according to claim 1, is characterized in that, its step is as follows:
(1) extraction of sample gene group DNA to be checked: extract according to a conventional method or test kit extraction;
(2) LAMP detection reaction system is as shown in the table:
Note: if adopt fluorescence visual method, add 10 × SYBR Green I2.5 μ L in reaction system, reaction system total amount keeps 25.0 μ L constant;
(3) reaction system in (2) is formulated in PCR pipe, positive control and negative control are set simultaneously;
(4) LAMP reaction conditions: rear centrifugal by mixing containing the PCR pipe of reaction system, be placed in 64 ℃ of reaction 50min of isoperibol, and at 80 ℃ of lasting 10min, take out; It is muddy that visual inspection liquid becomes, and in interpret sample, contains Salmonellas; Or observation colour-change, color becomes green, in interpret sample, contains Salmonellas; Color is orange, and interpret sample is not containing Salmonellas; Or use 2% concentration agarose gel electrophoresis to detect, and the positive can present typical special scalariform band, and feminine gender is without this phenomenon.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410137471.7A CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410137471.7A CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898222A true CN103898222A (en) | 2014-07-02 |
| CN103898222B CN103898222B (en) | 2015-09-09 |
Family
ID=50989787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410137471.7A Active CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898222B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726575A (en) * | 2015-03-13 | 2015-06-24 | 江苏省家禽科学研究所 | LAMP kit for rapidly detecting salmonella in avian borne samples |
| CN105219870A (en) * | 2015-11-02 | 2016-01-06 | 广东省第二人民医院 | False-negative salmonella constant temperature fluorescent detector primers group, test kit and detection method can be avoided |
| CN107034211A (en) * | 2017-05-09 | 2017-08-11 | 广州海力特生物科技有限公司 | A kind of PCR reaction systems and kit for high GC fragment amplifications |
| CN109182467A (en) * | 2018-08-24 | 2019-01-11 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection salmonella |
| CN110592250A (en) * | 2019-11-01 | 2019-12-20 | 中国人民解放军总医院 | LAMP primer combination for detecting intestinal pathogenic bacteria and application thereof |
| CN117051021A (en) * | 2023-08-01 | 2023-11-14 | 扬州大学 | Salmonella typhimurium recombinant strain for non-inducible expression of salmonella pullorum Bcf pili and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218806A (en) * | 2019-06-27 | 2019-09-10 | 华南农业大学 | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199665A (en) * | 2011-03-29 | 2011-09-28 | 镇江出入境检验检疫局检验检疫综合技术中心 | LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella |
-
2014
- 2014-04-04 CN CN201410137471.7A patent/CN103898222B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199665A (en) * | 2011-03-29 | 2011-09-28 | 镇江出入境检验检疫局检验检疫综合技术中心 | LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella |
Non-Patent Citations (2)
| Title |
|---|
| GONG J ET.AL: "Prevalence and fimbrial genotype distribution of poultry salmonella isolates in china (2006 to 2012).", <APPL ENVIRON MICROBIOL>, 15 November 2013 (2013-11-15), pages 687 - 693 * |
| YANG Q ET.AL: "Detecting salmonella serovars in shell eggs by loop-mediated isothermal amplification.", <J FOOD PORT>, 31 October 2013 (2013-10-31), pages 1790 - 1796 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726575A (en) * | 2015-03-13 | 2015-06-24 | 江苏省家禽科学研究所 | LAMP kit for rapidly detecting salmonella in avian borne samples |
| CN105219870A (en) * | 2015-11-02 | 2016-01-06 | 广东省第二人民医院 | False-negative salmonella constant temperature fluorescent detector primers group, test kit and detection method can be avoided |
| CN107034211A (en) * | 2017-05-09 | 2017-08-11 | 广州海力特生物科技有限公司 | A kind of PCR reaction systems and kit for high GC fragment amplifications |
| CN107034211B (en) * | 2017-05-09 | 2020-05-05 | 广州海力特生物科技有限公司 | PCR reaction system and kit for high GC fragment amplification |
| CN109182467A (en) * | 2018-08-24 | 2019-01-11 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection salmonella |
| CN110592250A (en) * | 2019-11-01 | 2019-12-20 | 中国人民解放军总医院 | LAMP primer combination for detecting intestinal pathogenic bacteria and application thereof |
| CN117051021A (en) * | 2023-08-01 | 2023-11-14 | 扬州大学 | Salmonella typhimurium recombinant strain for non-inducible expression of salmonella pullorum Bcf pili and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898222B (en) | 2015-09-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898222B (en) | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof | |
| CN110938677B (en) | Quick constant-temperature detection method for yersinia pseudotuberculosis nucleic acid and application | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| Zandi et al. | Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN102816847A (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| Milton et al. | Novel saltatory rolling circle amplification assay for rapid and visual detection of Campylobacter jejuni in chicken meat | |
| Wu et al. | An enhanced visual detection assay for Listeria monocytogenes in food based on isothermal amplified peroxidase-mimicking catalytic beacon | |
| CN107663545A (en) | Detect primer sets and the application of yersinia enterocolitica | |
| Du et al. | Probe-based loop-mediated isothermal amplification assay for multi-target quantitative detection of three foodborne pathogens in seafood | |
| Yang et al. | Hybridization chain reaction-assisted enzyme cascade genosensor for the detection of Listeria monocytogenes | |
| Liu et al. | A propidium monoazide-polymerase spiral reaction (PMA-PSR) designed for direct detection of Escherichia coli O157: H7 viable cell | |
| CN104988232B (en) | Application for the primer and probe sequence and primer and probe of Edwardsiella tarda LAMP LFD detections | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN104726575A (en) | LAMP kit for rapidly detecting salmonella in avian borne samples | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN102534038A (en) | High-sensitivity rapid detection kit for campylobacter jejuni | |
| CN109971873A (en) | Identify the method for Listeria Monocytogenes, Yi Shi listeria spp and listeria innocua | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN106755411A (en) | The real-time fluorescence quantitative PCR quick detection primer and its kit of marine product vibrio parahemolyticus toxR genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20160707 Address after: 225127 No. 15 shepherd Road, Hanjiang Industrial Park, Jiangsu, Yangzhou Patentee after: Vacbio Co., Ltd. Address before: 225000 Jiangsu Province, Yangzhou city Guangling District mulberry Road No. 46 Patentee before: Jinagsu Poultry lnstitute |