CN104651518A - Streptococcus iniae loop-mediated isothermal amplification kit and application thereof - Google Patents
Streptococcus iniae loop-mediated isothermal amplification kit and application thereof Download PDFInfo
- Publication number
- CN104651518A CN104651518A CN201510095340.1A CN201510095340A CN104651518A CN 104651518 A CN104651518 A CN 104651518A CN 201510095340 A CN201510095340 A CN 201510095340A CN 104651518 A CN104651518 A CN 104651518A
- Authority
- CN
- China
- Prior art keywords
- streptococcus iniae
- loop
- lamp
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a streptococcus iniae loop-mediated isothermal amplification kit and application thereof. The kit comprises LAMP primers, a 2*reaction buffer, a Bst DNA polymerase, a fluorescent visual detection reagent, ultra-pure water and a streptococcus iniae DNA template, wherein the LAMP primers comprise outer primers F3 and B33 and inner primers FIP and BIP. Specificity detection and sensitivity detection show that the LAMP detection method provided by the invention can be used for monitoring reaction in real time and detecting the copy number of streptococcus iniae quantitatively so that the detection result can be obtained rapidly and accurately and convenience is brought for simple and rapid detection of the streptococcus iniae.
Description
Technical field
The present invention relates to technical field of microbial detection, relate to a kind of quick, visual and can the loop-mediated isothermal amplification kit of Real_time quantitative detection Streptococcus iniae and application thereof specifically.
Background technology
Fish streptococcicosis is a kind of disease caused by streptococcal infection, and pathogenic bacteria belongs to 3 and belongs to and 7 kinds.The pathogenic bacteria of streptococcus has Streptococcus iniae (Streptococcus iniae), streptococcus agalactiae (Streptococcus agalactme), the scorching suis of accessory breast
(streptococcus parauberis) and streptococcus dysgalactiae (Streptococcus dysgalactiae); Lactococcus have Lactococcus garvieae (Lactococcus garvieae) and fish galactococcus (Lactococcus piscium); The salmon that has of roaming Pseudomonas roams bacterium (Vagococcus salmoninarum).Wherein, Streptococcus iniae, streptococcus agalactiae, the scorching suis of accessory breast, streptococcus dysgalactiae and Lactococcus garvieae are the pathogenic bacteria of warm water fish streptococcicosis, and fish galactococcus and salmon roaming Pseudomonas are in the pathogenic bacteria of cold water fishes streptococcicosis.
Current discovery Streptococcus iniae and streptococcus agalactiae are the main two kinds of cause of diseases causing multiple wild fish and economic cultured fishes streptococcicosis.Wherein, the streptococcicosis caused by Streptococcus iniae can cause multiple fresh water in worldwide and seawater fish big area infects, and has very high infection rate and lethality rate.This bacterium can infect and comprise rainbow trout, Sea Bream, tilapia, Yellow Tail, catfish, spends 17 kinds of fish of fish, catfish, grey mullet etc. in vain.
Streptococcicosis is Global prevalence, and annual world's tilapia industry of giving causes great economic loss.In China, there is streptococcicosis in tilapia cultivation in 2001 ~ 2006 years, and causes the cumulative mortality of 5 ~ 15% in indivedual plant successively.2009 ~ 2012 continuous 4 years, this interior syndrome state tilapia main culture zone big area outbreak of epidemic, cumulative mortality was between 15 ~ 95%, and the financial loss caused to China's tilapia aquaculture is accumulative up to 1,600,000,000 dollars.How fast, Streptococcus iniae disease is diagnosed just to seem especially important efficiently and accurately.
At present, the detection technique of fish Streptococcus iniae mainly contains ordinary method and molecular biology method.Ordinary method is by identifying the phenotypic characteristic of bacterium and biochemical indicator.The biochemical indicator of qualification Streptococcus iniae mainly comprises: the experiment of gramstaining, oxydase, the experiment of peroxidation oxygenase, CAMP experiment, V-P react the experiment of (Fu Gesi-Puli's Squall) product, aggegation experiment, ELISA experiment; LancefieldShi group specific antigen group qualification etc.But there is complicated operation in general survey method, the shortcoming that required time is long and specificity is not strong.Some automatic quick bacteria identification systems are had to identify for suis at present, as RAPID Strep strip, API rapid strep 32, API 20E Vitek system, ATB rapid detection system etc., but the automatic identification equipment of bacterium detects the unstable result of Streptococcus iniae, and due to type strain limited amount in the database of bacterium automatization qualification, still under study for action, therefore the application of the method is also restricted streptococcic critical data.
Utilize the specific polymerase chain of genome 16SrRNA Data mining to react (PCR) method to be usually used in identifying suis.In addition, 16S-23SrDNA sequence, Lactate Oxidase (lctO) and the CAMP factor etc. is utilized to carry out fast PCR qualification to suis in addition.In addition, the dual-PCR method of Streptococcus iniae and nested PCR method is also established for detecting Streptococcus iniae.Although PCR method comparatively ordinary method quick and precisely, need complicated plant and instrument, cost is higher, is not suitable for basic unit and Site Detection.
Summary of the invention
The object of this invention is to provide a kind of method detecting fish Streptococcus iniae exactly for basic unit is easy, quick, disclose a kind of quick, visual and can the loop-mediated isothermal amplification kit of detection Streptococcus iniae of real-time quantitative.The technical scheme provided for realizing the object of the invention is: a kind of Streptococcus iniae loop-mediated isothermal amplification kit, this test kit comprises LAMP primer, 2 × reaction buffer, Bst archaeal dna polymerase, fluorescence visual detection reagent, ultrapure water and Streptococcus iniae DNA profiling, and described LAMP primer comprises outer primer F3(SEQ ID NO:1) and B3(SEQ ID NO:2) and inner primer FIP(SEQ ID NO:3) and BIP(SEQ ID NO:4);
Wherein the sequence of primer is respectively:
F3 AAGCAGATTTGGAACAAGC
B3 TTTAAGAGCAGGTTTTTCTTCT
FIP TCTGCCAATTGTTTTTGAAGTTCAGTGCACGAGAATTAGATACGC
BIP AACACAGAATTAACAGCAACTGTTGGCTTCTTTCTTAGCCGCT；
2 described × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
Described Streptococcus iniae DNA profiling extracts from Streptococcus iniae culture, uses bacterial genomes DNA extraction kit to extract.
Described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
2 described × reaction buffer comprises Tris-HCL 30-60mM, KCL 25-40mM, MgSO
415-25mM, (NH
4)
2sO
425-30mM, Tween20 0.3-0.7 ℅, Betaine 1.5-3.5M and dNTPs 3-5 mM, above-mentioned solvent, under pH is 8.8 conditions, evenly obtains by its compound method.
An application for Streptococcus iniae loop-mediated isothermal amplification kit, for detecting doubtful Streptococcus iniae, concrete detecting step comprises:
(1) Design and synthesis of LAMP primer
(2) extraction of Streptococcus iniae DNA profiling
(3) LAMP reaction system is set up
(4) LAMP detection method.
Described LAMP reaction system is set up in 25 μ L,
2 × reaction buffer 12.5 μ L
Bst archaeal dna polymerase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Streptococcus iniae DNA 2 μ L
Ultrapure water supplies 25 μ L.
It is the Streptococcus iniae extracted, the genomic dna contrasting bacterium and clinical isolates that described LAMP detection method detects sample solution.
Described LAMP detection method adopts the real-time turbidimeter of Loopamp LA-320C to carry out airtight complete monitoring, and temperature of reaction is 63 DEG C, reacts appearance amplification between 20-30 minute.
Substantive distinguishing features of the present invention and marked improvement are:
1) high specificity
Loop-mediated isothermal amplification kit specific detection of the present invention goes out Streptococcus iniae, and the negative control virus detected, negative control bacterium and all no positive result of water contrast are out, consistent with PCR detected result.
2) highly sensitive
The sensitivity of common PCR detection method is 1.7 × 10
-6ng/ μ L, and use detection method, detectability is about 1.7 × 10
-8ng/ μ L, improves 100 times nearly than the sensitivity of regular-PCR.
3) obtain a result rapidly
The whole process of common PCR just can be obtained a result at 24 hours, the LAMP reaction method that current majority is set up after the completion of reaction, the video picture of agarose gel electrophoresis ultraviolet analysis must be adopted to carry out result of determination, extract acquisition test-results from DNA of bacteria, need 5-6 hours.Amplification is there is in LAMP detection method reaction provided by the invention between 20-30 minute, can complete amplification in 60 minutes, and result interpretation mode is easy--, under visible light positive and negative pipe is compared, obviously can see that positive reaction is obvious muddiness by naked eyes, negative reaction pipe is transparent; Of short duration centrifugal after, have obvious white magnesium pyrophosphate throw out bottom positive reaction pipe, and a sediment-free bottom negative reaction pipe; Or add fluorescence dye, positive reaction pipe under ultraviolet light in green, with the naked eye just observable experimental result.Do not need to carry out the video picture of agarose gel electrophoresis ultraviolet analysis again or uncap to add fluorescence dye and carry out carrying out sentence read result, extract from DNA of bacteria and obtain net result and can complete in 2-3 hour.
4) do not pollute
Although set up LAMP development process for detecting Streptococcus iniae at present, whether development process can only be uncap after reaction terminates to add fluorescence dye and carry out color reaction, observe and have colour developing to carry out interpretation test-results, uncap and easily cause laboratory pollution.And LAMP fluorescence Visual detection methods of the present invention, fluorescence dye adds before the reaction, avoid uncapping and pollute, in addition, LAMP detection method of the present invention, on result judges, directly can be carried out result of determination by the turbidity value of turbidimeter detection reaction pipe, can not carry out fluorescent dye determination detected result or carry out agarose gel electrophoresis detected result, do not need to uncap, can effectively avoid polluting.
5) can real-time quantitative
The present invention utilizes Tubidimeter real-time LA-320 turbidimeter to carry out the result of real-time analysis LAMP reaction, the typical curve that time of the turbidity value that the concentration of different standard models is corresponding is depicted as, substitute into typical curve equation, the Streptococcus iniae copy number of each time can be obtained, reach the object of detection by quantitative product.
Accompanying drawing explanation
Fig. 1 is our bright LAMP method specific detection result; Wherein 1, Streptococcus iniae; 2, intestinal bacteria; 3, Aeromonas hydrophila; 4, Aeromonas veronii; 5, Channel-catfish Ai Dehuashi Zymomonas mobilis; 6, the lonely bacterium of Kazakhstan; 7, the lonely bacterium of wound; 8, streptococcus agalactiae; 9, enterobacter cloacae; 10, water contrast.Result shows the upcurve that turbidity appears in 1 strain fish Streptococcus iniae reaction tubes, and 8 strain negative control bacterium reaction tubess and water control reaction are all without amplification.
Fig. 2 and Fig. 3 is the sensitivity Detection result of LAMP detection method of the present invention and traditional PCR method; Wherein A:1.7 × 10
2ng/ μ L; B::1.7 × 10
1ng/ μ L; C:1.7 × 10
0ng/ μ L; D:1.7 × 10
-1ng/ μ L; E:1.7 × 10
-2ng/ μ L; F:1.7 × 10
-3ng/ μ L; G:1.7 × 10
-4ng/ μ L; H:1.7 × 10
-5ng/ μ L; I:1.7 × 10
-6ng/ μ L; J:1.7 × 10
-7ng/ μ L; K:1.7 × 10
-8ng/ μ L; L:water.Recombinant plasmid pMD18-T-
siminitial concentration be 1.7 × 10
2ng/ μ L, carries out LAMP and pcr amplification after 10 times of doubling dilutions, and result display LAMP method detectability is about 1.7 × 10
-8ng/ μ L, and the detection of PCR method is limited to 1.7 × 10
-6ng/ μ L.
Fig. 4 adds detection of fluorescent dyes result: the response situation that right pipe is is template with Streptococcus iniae genomic dna, is positive findings, and left pipe is the response situation of negative control, is negative control result.
Fig. 5 is the typical curve of detection by quantitative Streptococcus iniae LAMP method of the present invention; Utilize the typical curve that turbidity value corresponding to the concentration of different standard models was depicted as the time, substitute into typical curve equation, the Streptococcus iniae copy number of each time can be obtained.
Embodiment
1, the preparation of material
Streptococcus iniae, intestinal bacteria, Aeromonas hydrophila, Aeromonas veronii, Channel-catfish Ai Dehuashi Zymomonas mobilis, the lonely bacterium of Kazakhstan, the lonely bacterium of wound, streptococcus agalactiae, enterobacter cloacae are all separated from tilapia, preserve for Guangxi Zhuang Autonomous Region aquatic science research institute is separated.LAMP method DNA cloning test kit is purchased from Beijing Lanpu Biological Technology Co., Ltd., and article No. SLP204, it is century bio tech ltd purchased from health that bacterial genomes extracts test kit, article No. CW0522.
2, the Design and synthesis of LAMP primer
According to the Streptococcus iniae Sim gene order in GenBank, utilize a set of LAMP primer of LAMP method primer Autocad PrimerExplorer V4 software design, wherein F3, B3 are outer primer, FIP, BIP are inner primer, wherein F3, B3 are that Streptococcus iniae PCR detects primer, wherein
F3 AAGCAGATTTGGAACAAGC
B3 TTTAAGAGCAGGTTTTTCTTCT
FIP TCTGCCAATTGTTTTTGAAGTTCAGTGCACGAGAATTAGATACGC
BIP AACACAGAATTAACAGCAACTGTTGGCTTCTTTCTTAGCCGCT
3, bacterial genomes DNA extraction
The bacterial genomes extraction test kit using health to produce for century bio tech ltd extracts bacterial genomes DNA.
4, LAMP reaction system is set up
According to test kit specification sheets, by 25 μ l system configurations:
2 × reaction buffer 12.5 μ L
Bst DNA polysaccharase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Streptococcus iniae DNA 2 μ L
Ultrapure water supplies 25 μ L.
LAMP reaction is with real-time turbidimeter (LA-320C, Rong Yan company of Japan) form of carrying out airtight complete monitoring monitor present method detect situation, turbidimeter monitors amplification situation in real time, can drawing standard curve, time value corresponding to 0.1 turbidity value is reached by obtaining unknown sample, the starting copy number of this sample can be calculated from typical curve, temperature of reaction with 63 DEG C as temperature of reaction.
5, LAMP detection method
1) specific detection
Extract the genomic dna template of reacting as LAMP of tilapia Streptococcus iniae, intestinal bacteria, Aeromonas hydrophila, Aeromonas veronii, Channel-catfish Ai Dehuashi Zymomonas mobilis, the lonely bacterium of Kazakhstan, the lonely bacterium of wound, streptococcus agalactiae, enterobacter cloacae respectively, carry out the LAMP amplification of each bacterial strain, the specificity of inspection LAMP method simultaneously.
2) sensitivity Detection
With the tilapia Streptococcus iniae genomic dna extracted for template, carry out pcr amplification with outer primer F3 and B3, by goal gene connection carrier pMD-18T, clone, extract the plasmid of mono-clonal bacterium, measure its concentration, through sequence verification.With RNA-Free Water by recombinant plasmid pMD-18T-
simcontinuous 10 times of doubling dilutions become 11 extent of dilution, get each extent of dilution plasmid 2 μ L and carry out LAMP amplification as template.
3) fluorescent visual detects
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye before the reaction, the dyestuff added is fluorexon commercial dyes, react at 63 DEG C after 60 minutes, observe under ultraviolet lamp, do not adopt the video picture of agarose gel electrophoresis ultraviolet analysis, avoid uncapping and run the Aerosol Pollution that electrophoresis observation causes.
The specific outcome of embodiment 1 LAMP detection method
LAMP amplification is carried out to 1 strain Streptococcus iniae and 8 strain negative control bacterium and water contrast, result as shown in Figure 1, the upcurve of turbidity is there is in Streptococcus iniae reaction tubes at about 30 minutes, for positive findings, 8 strain negative control bacterium reaction tubess and water control reaction pipe curve all occur without amplification situation, are negative findings.
The susceptibility results of embodiment 2 LAMP detection method
Recombinant plasmid pMD18-T-
siminitial concentration be 1.7 × 10
2ng/ μ L, carries out LAMP and pcr amplification after 10 times of doubling dilutions, and as shown in Figures 2 and 3, result display LAMP method detectability is about 1.7 × 10 to result
-8ng/ μ L, and the detection of PCR method is limited to 1.7 × 10
-6ng/ μ L.
The fluorescent visual detected result of embodiment 3 LAMP detection method
According to the condition that turbidimeter monitoring is optimized, reactor adds fluorescence dye, 63 DEG C of reactions are after 60 minutes, observe under ultraviolet lamp, Fig. 4 is observations, right pipe is take Streptococcus iniae as the response situation of template, and be positive findings, left pipe is negative control response situation, for negative findings, show that the method set up can facilitate basic unit to use, the LAMP primer that only test kit need be used to coordinate present method to design, after adding sample, with cheap water-bath keep 63 DEG C 60 minutes, get final product rapid examination result, and without the need to uncapping, avoid pollution.
The drafting of embodiment 4 Streptococcus iniae quantitation curves
Contrast is set: concentration is 1.7 × 10
2ng/ μ L, 1.7 × 10
1ng/ μ L, 1.7 × 10
0ng/ μ L, 1.7 × 10
-1ng/ μ L, 1.7 × 10
-2ng/ μ L, 1.7 × 10
-3ng/ μ L, 1.7 × 10
-4ng/ μ L, 1.7 × 10
-5the recombinant plasmid pMD18-T-of ng/ μ L
simeach one of standard model, because the negative logarithm of concentration and turbidity value be 0.1 time value linear, so the value that turbidimeter can be captured and time (as table 1) make typical curve, obtain typical curve equation, y=0.4834x-10.416, as shown in Figure 5.From typical curve equation coefficient R
2be 0.9968, in good linear relationship.Take time as X value, can obtain the negative time number formulary of Y value and concentration, then concentration is 10-
y, then be multiplied by radix 1.7, be 1.7 x10
-yng/ μ L.According to copy number reduction formula copies/ μ L=(6.02 x 10
23x (ng/ul x 10
-9))/(DNA length x 660), DNA length is that carrier sequence size adds goal gene sequence size, is 2693+220=2913 bp, is converted into copy number (copies/ μ L): 6.02 x 10
23x(1.7 x10
-yx 10
-9)/(2913 x 660), be reduced to: 5.32 x 10
8x10
-y.As certain test sample reach turbidity value be 0.1 time be 25 minutes, bring set up typical curve equation into, obtain Y and equal 1.699, then concentration is 10
-1.699, then being multiplied by radix 1.7, the concentration being this test sample is 1.71.7 x10
-1.699, copy number is 5.32 x 10
8x10
-1.699, i.e. 5.32 x 10
6.331copies/ μ L, thus reach quantitative effect.
Table 1
| Time (min) | 17.9 | 19.2 | 21.5 | 23.6 | 25.3 | 27.8 | 29.7 | 32.2 |
| Standard value (-LOG) | -2 | -1 | 0 | 1 | 2 | 3 | 4 | 5 |
Claims (8)
1. a Streptococcus iniae loop-mediated isothermal amplification kit, it is characterized in that, this test kit comprises LAMP primer, 2 × reaction buffer, Bst archaeal dna polymerase, fluorescence visual detection reagent, ultrapure water and Streptococcus iniae DNA profiling, and described LAMP primer comprises outer primer F3(SEQ ID NO:1) and B3(SEQ ID NO:2) and inner primer FIP(SEQ ID NO:3) and BIP(SEQ ID NO:4);
Wherein the sequence of primer is respectively:
F3 AAGCAGATTTGGAACAAGC
B3 TTTAAGAGCAGGTTTTTCTTCT
FIP TCTGCCAATTGTTTTTGAAGTTCAGTGCACGAGAATTAGATACGC
BIP AACACAGAATTAACAGCAACTGTTGGCTTCTTTCTTAGCCGCT；
2 described × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
2. Streptococcus iniae loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described Streptococcus iniae DNA profiling extracts from Streptococcus iniae culture, uses bacterial genomes DNA extraction kit to extract.
3. Streptococcus iniae loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
4. Streptococcus iniae loop-mediated isothermal amplification kit according to claim 1, is characterized in that, 2 described × reaction buffer comprises Tris-HCL 30-60mM, KCL 25-40mM, MgSO
415-25mM, (NH
4)
2sO
425-30mM, Tween20 0.3-0.7 ℅, Betaine 1.5-3.5M and dNTPs 3-5 mM.
5. an application for Streptococcus iniae loop-mediated isothermal amplification kit, is characterized in that, for detecting doubtful Streptococcus iniae, concrete detecting step comprises:
(1) Design and synthesis of LAMP primer
(2) extraction of Streptococcus iniae DNA profiling
(3) LAMP reaction system is set up
(4) LAMP detection method.
6. the application of Streptococcus iniae loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described LAMP reaction system is set up in 25 μ L,
2 × reaction buffer 12.5 μ L
Bst archaeal dna polymerase 1 μ L
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
Streptococcus iniae DNA 2 μ L
Ultrapure water supplies 25 μ L.
7. the application of Streptococcus iniae loop-mediated isothermal amplification kit according to claim 5, it is characterized in that, it is characterized in that, it is the Streptococcus iniae extracted, the genomic dna contrasting bacterium and clinical isolates that described LAMP detection method detects sample solution.
8. the application of Streptococcus iniae loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described LAMP detection method adopts real-time turbidimeter to carry out airtight complete monitoring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095340.1A CN104651518A (en) | 2015-03-04 | 2015-03-04 | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095340.1A CN104651518A (en) | 2015-03-04 | 2015-03-04 | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104651518A true CN104651518A (en) | 2015-05-27 |
Family
ID=53243157
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510095340.1A Pending CN104651518A (en) | 2015-03-04 | 2015-03-04 | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651518A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884048A (en) * | 2017-03-06 | 2017-06-23 | 海南出入境检验检疫局检验检疫技术中心 | One kind detection fish Streptococcus iniae fluorescent PCR kit and its application |
| CN113549572A (en) * | 2021-06-21 | 2021-10-26 | 广东海洋大学 | Streptococcus combined vaccine for marine fishes and preparation method thereof |
| CN115747361A (en) * | 2022-12-28 | 2023-03-07 | 中国海洋大学 | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101586157A (en) * | 2008-12-18 | 2009-11-25 | 中山大学 | Diagnostic kit for Streptococcus iniae molecule and detection method |
| CN103952472A (en) * | 2014-03-27 | 2014-07-30 | 宁波大学 | Primers and probe for streptococcus iniae LAMP-LFD visual detection, and application of primers and probe |
| CN103966342A (en) * | 2014-05-26 | 2014-08-06 | 天津市水产技术推广站 | Primer for rapidly detecting Strepstococcus iniae and detection method of Strepstococcus iniae |
-
2015
- 2015-03-04 CN CN201510095340.1A patent/CN104651518A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101586157A (en) * | 2008-12-18 | 2009-11-25 | 中山大学 | Diagnostic kit for Streptococcus iniae molecule and detection method |
| CN103952472A (en) * | 2014-03-27 | 2014-07-30 | 宁波大学 | Primers and probe for streptococcus iniae LAMP-LFD visual detection, and application of primers and probe |
| CN103966342A (en) * | 2014-05-26 | 2014-08-06 | 天津市水产技术推广站 | Primer for rapidly detecting Strepstococcus iniae and detection method of Strepstococcus iniae |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884048A (en) * | 2017-03-06 | 2017-06-23 | 海南出入境检验检疫局检验检疫技术中心 | One kind detection fish Streptococcus iniae fluorescent PCR kit and its application |
| CN113549572A (en) * | 2021-06-21 | 2021-10-26 | 广东海洋大学 | Streptococcus combined vaccine for marine fishes and preparation method thereof |
| CN115747361A (en) * | 2022-12-28 | 2023-03-07 | 中国海洋大学 | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020008B (en) | Rapid isothermal detection method and kit for nucleic acid of vibrio cholerae O1 group | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN105349672A (en) | Mycoplasma hyopneumoniae loop-mediated isothermal amplification kit and application thereof | |
| CN104651519A (en) | Mycoplasma bovis loop-mediated isothermal amplification kit and application thereof | |
| CN104726568A (en) | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| CN103740839A (en) | Universal type kit and method for detecting clostridium botulinum by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN111004856B (en) | Rapid constant-temperature detection method, primer group and kit for vibrio vulnificus | |
| CN106520966A (en) | LAMP (Loop-mediated Isothermal Amplification) kit for priB gene in acute hepatopancreas necrosis syndrome and application thereof | |
| Abdurahman | Detection of Salmonella Spp. in Egg Laying Hens Collected from Poultry Facilities in Batangas, Philippines using Culture-Based Diadnostic Assay and Loop-Mediated Isothermal Amplification (Lamp) Method | |
| CN116024311A (en) | Double-target index primer group, kit and detection system and method for detecting vibrio parahaemolyticus | |
| CN103114148A (en) | Primer, probe and kit for fluorescence quantitative PCR (polymerase chain reaction) detection and parting of salmonella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150527 |