CN102199665A - LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella - Google Patents

Abstract

The invention belongs to the field of biological products, and relates to a detection kit and a detection method for rapidly detecting salmonella by utilizing an LAMP (loop-mediated isothermal amplification) technique. The kit is composed of a salmonella genome extracting reagent and an LAMP reaction reagent, wherein the salmonella genome extracting reagent comprises the following components: SDS (sodium dodecyl sulfate), protease K, CTAB (cetyltrimethyl ammonium bromide)/NaCl solution and NaAC; and the LAMP reaction reagent is composed of a reaction liquid A and a reaction liquid B, the reaction liquid A comprises the following components: 10*Lampbuffer, Bst DNA (deoxyribonucleic acid) polymerase, dNTP (deoxy-ribonucleoside triphosphate), an interprimer 1, an interprimer 2, an outer primer 1, an outer primer 2, lycine and ultrapure water, and the reaction liquid B is a fluorescent dye. The invention can be used to carry out LAMP detection on salmonella, has the characteristics of rapid detection, high accuracy, high sensitivity and convenient field application, and can be widely applied in the fields of veterinarian, food and exit-entry quarantine, etc.

Description

Salmonellas LAMP quick detection kit and detection method thereof

Technical field

The invention belongs to field of biological product, relate to a kind of detection kit and detection method thereof of utilizing ring mediated isothermal amplification (LAMP) technology rapid detection Salmonellas.

Background technology

Salmonellosis is one of zoonosis significant on the public hygienics, according to the report of the World Health Organization, since 1985, worldwide, significantly increase by the salmonellal human number of patients of having made a definite diagnosis, increased more than five times in some European countries.In China hinterland, rank first repeatly by salmonellal food poisoning.According to statistics, in China's bacterial food poisoning, 70%～80%, cause by Salmonellas, and in causing the food of salmonella poisoning, be animal products such as meat more than 90%.Contain multiple rich nutrient contents in the animal product, be suitable for very much the growth and breeding of Salmonellas, in a single day people have taken in the animal product that contains a large amount of Salmonellass, will cause bacterial infection, and then issue the uncooked food poisoning in the effect of toxin.

Mainly be divided into two big classes by salmonellal disease: a class is typhoid fever and paratyphoid, and another kind of is acute gastroenteritis.Wherein Salmonella typhimurium, Salmonella choleraesuls, Salmonella enteritidis etc. are to pollute animal product, and then the main pathogenic bacterium that cause human salmonella food poisoning.Salmonella-pollutedly be mainly derived from ill humans and animals and carrier thereof, mainly by pathogen contamination water source, soil and the feed etc. of its ight soil, urine, milk and aborted fetus, afterbirth and amniotic fluid discharge, wherein feed and contaminated water source are to cause the infectious major cause of Salmonellas.All can find Salmonellas in all feeds, especially animal feedstuff (as fish meal) is common.In view of the serious harm of Salmonellas to human health, countries in the world government all makes very strict regulation to the limit standard of Salmonellas in the animal feedstuff at present, the regulation of Salmonellas in the animal feedstuff must not be detecting, is the strictest level in all microorganism limit standards.

Set up at present multiple detection method at Salmonellas, as the detection method of routine, immunology for the detection method on basis with based on the detection method of molecular biology etc., but these methods or length consuming time, or susceptibility is poor or specificity is not strong.

Ring mediated isothermal amplification method (LAMP) is a kind of novel nucleic acid amplification method, this method is at six Auele Specific Primers of eight zone design on the cause of disease conservative gene, utilize the BstDNA polysaccharase to carry out constant-temperature amplification 30-60min at 60 ℃～65 ℃, by observing response liquid turbidity and combination dye colour-change result of determination, this method sensitivity, quick, accurate, simple to operate, do not need specific apparatus, cost is low, can be used for the product field quick detection.

Salmonellas LAMP detection kit and detection method thereof have been arranged in the prior art, in actual use, still exist the configuration of detection kit reasonable inadequately, reaction system is stable inadequately, and defectives such as the specific aim of designed primer and insufficient sensitivity height.

Summary of the invention

Technical problem to be solved by this invention is, a kind of sensitivity, special, easy, Salmonellas LAMP quick detection kit and detection method thereof that primer is with strong points are provided.

Salmonellas LAMP quick detection kit of the present invention is formed by extracting salmonella gene group reagent and LAMP reaction reagent;

Described extraction salmonella gene group reagent comprises: SDS, Proteinase K, CTAB/NaCl solution and NaAC;

Described LAMP reaction reagent is made up of reaction solution A and reaction solution B, and reaction solution A contains 10 * Lamp buffer, Bst DNA polysaccharase, dNTP, inner primer 1, inner primer 2, outer primer 1, outer primer 2, trimethyl-glycine, ultrapure water, wherein:

10 * Lamp buffer contains 200mM Tris-HCl (8.8,25 ° of C of pH), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;

Inner primer 1 is: AAGAGGCRCCTTGCGCTAAAGTTTTTGCCAAACCTCGCTTATCGG;

Inner primer 2 is: TAGCACGTCAGCAAAGCGTACCTTTTTGTGGGGAAGGTTAAGGAGG;

Outer primer 1 is: CTGTACGCGAAGCCTTGTT;

Outer primer 2 is: ACTGCTGGAkCAGCCGRA;

Reaction solution B is a fluorescence dye.

In the said extracted salmonella gene group reagent, SDS concentration 10mg/ml, Proteinase K concentration 10mg/ml, CTAB/NaCl solution and NaAC concentration 3M.

In the above-mentioned LAMP reaction reagent, polymerase concentration 8U/ μ l, dNTP concentration 2.5 mM, inner primer 1 concentration 40 μ M, inner primer 2 concentration 40 μ M, outer primer 1 concentration 5 μ M, outer primer 2 concentration 5 μ M, trimethyl-glycine concentration 5M.

Described fluorescence dye is 1000 * SYBR Green I.

The method that test kit of the present invention detects Salmonellas may further comprise the steps:

A. the extraction of DNA in the tissue sample, concrete steps

1), get the 1mL Salmonellas, 10000rpm, 5min abandons supernatant;

2), bacterial sediment, suspend with 600 μ L TE, and add 60 μ L10%SDS, 6 μ LproteinK10mg/ml, mixing, 37 ℃, 1h;

3), add 180 μ L 5mol/L NaCl, mixing adds 180 μ L CTAB/NaCl solution, mixing, 65 ℃, 20min again;

4), use and isopyknic phenol of the rapid liquid of previous step and the extracting of chloroform mixing solutions, phenol in the mixing solutions and chloroform volume ratio are 25:24, centrifugal 12000rpm, 5min pipettes supernatant to clean EP pipe;

5), repeating step 4;

6), get supernatant, about 500 μ L add 6 μ L RNAse, 37 ℃, 30min;

7), add 1mL 100% dehydrated alcohol, 50 μ L 3M NaAc ,-20 ℃, 90min;

8), 12000rpm, 5min abandons supernatant, adds 75% ethanol, 200 μ L flushing precipitation;

9), abandon supernatant, add 40 μ L TE dissolving DNAs, the adularescent resolution of precipitate, standby as template;

B. the ring mediated isothermal amplification of Salmonellas, concrete steps

In the reaction tubes of the LAMP reaction reagent that 22 μ l are housed, add 3 μ l DNA to be checked, in 63-65 ℃ of constant water bath box, place 45min;

C. the color developing detection of amplified production, concrete steps

After step b reaction finishes, add 1000 * SYBR Green I fluorescence dye of 1 μ l; The colour-change that directly detects by an unaided eye, color becomes green, then contains Salmonellas in the interpret sample; Color is orange, and interpret sample does not contain Salmonellas.

The invention solves long, defectives such as sensitivity is lower, cost is high, rig-site utilization difficulty of required cycle of the method that detects Salmonellas in the prior art, detection kit of the Salmonellas that provides and detection method thereof, Salmonellas is carried out LAMP to be detected, fast, the accuracy height, susceptibility is good, rig-site utilization is convenient, can be widely used in fields such as animal doctor, food, entry and exit quarantine.

Embodiment

Embodiment:

Make the loop-mediated isothermal amplification detection kit of Salmonellas by following prescription;

1, extract the salmonella gene group:

1), get the 1mL Salmonellas, 10000rpm, 5min abandons supernatant.

2), bacterial sediment, suspend with 600 μ L TE, and add 60 μ L10%SDS, 6 μ LproteinK10mg/ml, mixing, 37 ℃, 1h.

3), add 180 μ L 5mol/L NaCl, mixing adds 180 μ L CTAB/NaCl solution, mixing, 65 ℃, 20min again.

4), use equal-volume phenol: chloroform (25:24) extracting, 12000rpm, 5min pipettes supernatant to clean EP pipe.

5), repeating step 4.

6), get supernatant, about 500 μ L add 6 μ L RNAse, 37 ℃, 30min.

7), add 1mL 100% dehydrated alcohol, 50 μ L 3M NaAc ,-20 ℃, 90min.

8), 12000rpm, 5min abandons supernatant, adds 75% ethanol, 200 μ L flushing precipitation.

9), abandon supernatant, add 40 μ L TE dissolving DNAs, the adularescent resolution of precipitate, standby as template.

2, preparation LAMP reaction reagent comprises following composition:

1), reaction solution A: contain 10 * Lamp buffer, Bst DNA polysaccharase 8U/ μ l, 2.5 mM dNTP, 40 μ M inner primers, 1,40 μ M inner primers, 2,5 μ M outer primers, 1,5 μ M outer primers 2, trimethyl-glycine (5M), ultrapure water, wherein:

10 * Lamp buffer contains 200mM Tris-HCl (8.8,25 ° of C of pH), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;

Contained primer sequence is:

Inner primer 1 is: AAGAGGCRCCTTGCGCTAAAGTTTTTGCCAAACCTCGCTTATCGG

Inner primer 2 is: TAGCACGTCAGCAAAGCGTACCTTTTTGTGGGGAAGGTTAAGGAGG

Outer primer 1 is: CTGTACGCGAAGCCTTGTT

Outer primer 2 is: ACTGCTGGAkCAGCCGRA

2), reaction solution B:1000 * SYBR Green I.

The each reaction of reaction solution A is made up of 22 μ l, and it is formulated as follows:

2.5 μ l 10 * Lamp buffer, 1.0 μ l Bst DNA polysaccharases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l 40 μ M inner primers, 1,0.5 μ l 40 μ M inner primers, 2,0.5 μ l 5 μ M outer primers, 1,0.5 μ l 5 μ M outer primers, 2,5 μ l trimethyl-glycines (5M) and 7.5 μ l sterilization ultrapure water.

3, the ring mediated isothermal amplification of Salmonellas

In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 63-65 ℃ of constant water bath box, place 45min;

4, the color developing detection of amplified production

After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green as color, then contains Salmonellas in the interpret sample; If color is orange, interpret sample does not contain Salmonellas.

Test example 1: the effect of test kit of the present invention in detecting Salmonellas: susceptibility and clinical detection.

One, susceptibility

1.1 sample: (original concentration is 6.2 * 10 to Salmonella choleraesuls ⁶CFU/ μ l)

1.2 sample preparation: with Salmonella choleraesuls DNA(original concentration is 6.2 * 10 ⁶CFU/ μ l) does 10 ^-1-10 ^-7Doubling dilution.

1.3 each set of dispense of detection architecture is such as following:

Salmonellas LAMP detection kit reaction solution A is made up of 22 μ l, and it is formulated as follows:

2.5 μ l 10 * Lamp buffer, 1.0 μ l Bst DNA polysaccharases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l 40 μ M inner primers, 1,0.5 μ l 40 μ M inner primers, 2,0.5 μ l 5 μ M outer primers, 1,0.5 μ l 5 μ M outer primers, 2,5 μ l trimethyl-glycines (5M) and 7.5 μ l sterilization ultrapure water.

1.4 the loop-mediated isothermal amplification of Salmonellas:

In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 63-65 ℃ of constant water bath box, place 45min;

1.5 the color developing detection of amplified production

After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green as color, then contains Salmonellas in the interpret sample; If color is orange, interpret sample does not contain Salmonellas.

1.6 the susceptibility result of test kit

Test-results shows: adopt test kit lowest detection 6 CFU/ pipe of the present invention, show that test kit of the present invention has very high susceptibility.

Two, clinical detection

2.1 sample: the Salmonellas positive and the negative sample of clinical collection

2.2 each set of dispense of detection architecture is such as following:

Salmonellas LAMP detection kit reaction solution A is made up of 22 μ l, and it is formulated as follows:

2.5 μ l 10 * Lamp buffer, 1.0 μ l Bst DNA polysaccharases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l 40 μ M inner primers, 1,0.5 μ l 40 μ M inner primers, 2,0.5 μ l 5 μ M outer primers, 1,0.5 μ l 5 μ M outer primers, 2,5 μ l trimethyl-glycines (5M) and 7.5 μ l sterilization ultrapure water.

2.3 the loop-mediated isothermal amplification of Salmonellas:

In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 63-65 ℃ of constant water bath box, place 45min;

2.4 the color developing detection of amplified production

After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye, the sample that contains Salmonellas becomes green; The sample that does not contain Salmonellas, color are orange.

Claims (5)

1. a Salmonellas LAMP quick detection kit is formed by extracting salmonella gene group reagent and LAMP reaction reagent; It is characterized in that:

Described extraction salmonella gene group reagent comprises: SDS, Proteinase K, CTAB/NaCl solution and NaAC;

Described LAMP reaction reagent is made up of reaction solution A and reaction solution B,

Reaction solution A contains 10 * Lamp buffer, Bst DNA polysaccharase, dNTP, inner primer 1, inner primer 2, outer primer 1, outer primer 2, trimethyl-glycine, ultrapure water, wherein:

10 * Lamp buffer contains 200mM Tris-HCl (8.8,25 ° of C of pH), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;

Inner primer 1 is: AAGAGGCRCCTTGCGCTAAAGTTTTTGCCAAACCTCGCTTATCGG

Inner primer 2 is: TAGCACGTCAGCAAAGCGTACCTTTTTGTGGGGAAGGTTAAGGAGG

Outer primer 1 is: CTGTACGCGAAGCCTTGTT

Outer primer 2 is: ACTGCTGGAkCAGCCGRA

Reaction solution B is a fluorescence dye.

2. Salmonellas LAMP quick detection kit according to claim 1 is characterized in that: extract in the salmonella gene group reagent SDS concentration 10mg/ml, Proteinase K concentration 10mg/ml, CTAB/NaCl solution and NaAC concentration 3M.

3. Salmonellas LAMP quick detection kit according to claim 1, it is characterized in that: in the described LAMP reaction reagent, polymerase concentration 8U/ μ l, dNTP concentration 2.5 mM, inner primer 1 concentration 40 μ M, inner primer 2 concentration 40 μ M, outer primer 1 concentration 5 μ M, outer primer 2 concentration 5 μ M, trimethyl-glycine concentration 5M.

4. Salmonellas LAMP quick detection kit according to claim 1 is characterized in that: described fluorescence dye is 1000 * SYBR Green I.

5. one kind is detected the method for Salmonellas with the described test kit of claim 1, may further comprise the steps:

A. the extraction of DNA in the tissue sample, concrete steps

1), get the 1mL Salmonellas, 10000rpm, 5min abandons supernatant;

2), bacterial sediment, suspend with 600 μ L TE, and add 60 μ L10%SDS, 6 μ LproteinK10mg/ml, mixing, 37 ℃, 1h;

3), add 180 μ L 5mol/L NaCl, mixing adds 180 μ L CTAB/NaCl solution, mixing, 65 ℃, 20min again;

4), use and isopyknic phenol of the rapid liquid of previous step and the extracting of chloroform mixing solutions, phenol in the mixing solutions and chloroform volume ratio are 25:24, centrifugal 12000rpm, 5min pipettes supernatant to clean EP pipe;

5), repeating step 4;

6), get supernatant, about 500 μ L add 6 μ L RNAse, 37 ℃, 30min;

7), add 1mL 100% dehydrated alcohol, 50 μ L 3M NaAc ,-20 ℃, 90min;

8), 12000rpm, 5min abandons supernatant, adds 75% ethanol, 200 μ L flushing precipitation;

9), abandon supernatant, add 40 μ L TE dissolving DNAs, the adularescent resolution of precipitate, standby as template;

B. the ring mediated isothermal amplification of Salmonellas, concrete steps

In the reaction tubes of the LAMP reaction reagent that 22 μ l are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 45min;

C. the color developing detection of amplified production, concrete steps

After step b reaction finishes, add 1000 * SYBR Green I fluorescence dye of 1 μ l; The colour-change that directly detects by an unaided eye, color becomes green, then contains Salmonellas in the interpret sample; Color is orange, and interpret sample does not contain Salmonellas.