CN104372099A - LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition - Google Patents
LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition Download PDFInfo
- Publication number
- CN104372099A CN104372099A CN201410699942.3A CN201410699942A CN104372099A CN 104372099 A CN104372099 A CN 104372099A CN 201410699942 A CN201410699942 A CN 201410699942A CN 104372099 A CN104372099 A CN 104372099A
- Authority
- CN
- China
- Prior art keywords
- lamp
- primer
- phytophthora cactorum
- lamp detection
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses an LAMP detection primer composition for phytophthotacactorum, as well as an LAMP detection kit and an LAMP detection method of the LAMP detection primer composition. The LAMP detection primer composition consists of a positive inner primer FIP, a reverse inner primer BIP, a positive outer primer F3, a reverse outer primer B3 and a reverse loop primer LB; detailed sequences of all the primers are as follows: FIP: 5'-TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC-3'; BIP: 5'-AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT-3'; F3: 5'-TTCTGCGCTAGGCGACC-3'; B3: 5'-CACACAAGTGGACCGTTAG3'; LB: 5'-GGAAAGACCATCAAGCTCCAGAT-3'. The detection method disclosed by the invention is high in accuracy, high in specificity, convenient to operate and good in practicability; constant-temperature amplification is realized; meanwhile, a novel technology platform is provided for detection of the phytophthotacactorum; the detection method can be applied to high-sensitivity rapid detection of the phytophthotacactorum; simultaneously, pathogens can be identified in initial stage of invasion of diseases, and the phytophthotacactorum soil of a field can be detected. The LAMP detection primer composition for the phytophthotacactorum, as well as the LAMP detection kit and the LAMP detection method of the LAMP detection primer composition, disclosed by the invention, play an important role in epidemic treatment caused by the phytophthotacactorum, reduction of sightless usage of pesticides, reduction of production cost and reduction of environmental pollution caused by the pesticides as well.
Description
Technical field
The invention belongs to biological technical field, be specifically related to the LAMP detection primer composition of a kind of Phytophthora cactorum bacterium and LAMP detection kit thereof and LAMP detection method.
Background technology
It is that a kind of universal soil passes destructive disease that Phytophthora cactorum (Phytophthora cactorum) infects the vegetable plague caused, harm is more than 200 kind of plant, and the normal production to diversified economy crop (as strawberry, apple, pears, ginseng etc.) brings heavy losses.Phytophthora cactorum Pseudomonas is in oomycetes door (Oomycota), Oomycete (Oomycetes), Peronosporales (Peronosporales), pythiaceae (Pythiaceae), phytophthora (Phytophthora).The Plant diseases that Phytophthora cactorum causes is widely distributed, so the rapid molecular detection technique setting up Phytophthora cactorum causes the early stage control of epidemic disease significant for it.At present to the also not prophylactico-therapeutic measures fast and effectively of this disease, the most effective way controlling this disease strengthens quarantine exactly, prevents the propagation of pathogenic bacteria and hinders its diffusion way.
The taxonomic identification of traditional Phytophthora cactorum bacterium is mainly based on morphological feature, Pathogenicity, physiological and biochemical property etc.Traditional method has played vital role in Phytophthora cactorum bacterium detects, but wastes time and energy and require that operator possesses professional phytophthora separation, Morphological Identification knowledge and rich experience; The interference that simultaneously traditional classification authentication method length consuming time, sensitivity is low, be subject to the factors such as artificial and environment, can not make diagnosis, be difficult to monitor timely disease and effectively control in disease latent period and their early stage.Along with molecular biological development, round pcr is that pathogenic diagnosis provides quick, sensitive, advantage accurately.The method of regular-PCR has been used successfully to and has detected Phytophthora cactorum bacterium, although PCR method is greatly improved in specificity and susceptibility, but detection time is still long, general 4 ~ 5h, PCR method relies on accurate temperature cycling device simultaneously, its detection sensitivity is higher, testing process is complicated, can not meet the demand of rapid detection.
Loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification, LAMP) be a kind of new nucleic acid amplification technologies, because it is simple to operate, quick, specificity is high, low cost and other advantages, become the new nucleic acid amplification technologies that can substitute PCR.It is 6 species specific primers of zone design 4 for target gene, self-circulation strand replacement reaction is caused under the effect of Bst Large fragment polymerase, in 60 ~ 65 DEG C of scope 80min, while a large amount of synthesis target dna, being attended by by product--the magnesium pyrophosphate precipitation of white produces.Target sequence 6 isolated areas are identified because LAMP amplification procedure relies on, so atopic is very strong, and amplification process is carried out under constant temperature, ortho-water bath or have the equipment of stable thermal source just can meet to react requirement, testing cost reduces greatly.Because LAMP reaction is simple, quick, efficient, economic dispatch feature, thus there is application prospect very widely.Since LAMP detection technique is set up 14 years, this technology has been widely used in the detect delay to pathogenic bacterias such as virus, bacterium, parasite, fungies, but little at the detection report of pathogenic oomycetes, and the detection of Phytophthora cactorum bacterium is not reported both at home and abroad.
Summary of the invention
Goal of the invention: for the problem that cycle length needed for Phytophthora cactorum bacterium biological detection method in prior art, detection method poor specificity, sensitivity are low, the object of this invention is to provide the LAMP detection primer composition of a kind of Phytophthora cactorum bacterium.Another object of the present invention is to provide the LAMP detection kit of above-mentioned Phytophthora cactorum bacterium.The present invention also has an object to be to provide the LAMP detection method of above-mentioned Phytophthora cactorum bacterium.
Technical scheme: in order to realize foregoing invention object, the technical solution used in the present invention is:
A kind of LAMP detection primer composition for detecting Phytophthora cactorum bacterium: be made up of forward inner primer FIP, oppositely inner primer BIP, forward outer primer F3, oppositely outer primer B3 and reverse ring primer LB; Each primer sequence is specific as follows:
FIP：5′-TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC-3′；
BIP：5′-AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT-3′；
F3：5′-TTCTGCGCTAGGCGACC-3′；
B3：5′-CACACAAGTGGACCGTTAG-3′；
LB：5′-GGAAAGACCATCAAGCTCCAGAT-3′。
Described LAMP detection primer composition is detecting the application in Phytophthora cactorum bacterium.
Detect the LAMP detection kit of Phytophthora cactorum bacterium: comprise 1mL and detect a solution, described detection solution comprises: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3,8mM reverse outer primer B3,8mM ring primer LB, 50mM dNTPs, 0.8M Tris-HC, 0.4mM KCl, 0.4mM (NH
4)
2sO
4, 0.24mM MgSO
4, 4%Triton X-100, Bst DNA polymerase 320 unit, 200mM hydroxynaphthol blue; Wherein, each primer sequence is specific as follows:
FIP：5′-TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC-3′；
BIP：5′-AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT-3′；
F3：5′-TTCTGCGCTAGGCGACC-3′；
B3：5′-CACACAAGTGGACCGTTAG-3′；
LB：5′-GGAAAGACCATCAAGCTCCAGAT-3′。
The LAMP kit of described detection Phytophthora cactorum bacterium is detecting the application in Phytophthora cactorum bacterium.
Detect the LAMP detection method of Phytophthora cactorum bacterium: comprise the DNA extracting microorganism to be checked, with the DNA extracted for template, utilize LAMP detection primer composition or LAMP detection kit to carry out LAMP; Amplified production carries out agarose gel electrophoresis, under ultraviolet light detected result, if the stepped band of existing characteristics, then prove detect in sample and there is Phytophthora cactorum bacterium; The stepped band of atypism, then in detected sample without Phytophthora cactorum bacterium; Or observe LAMP reaction soln colour-change, sky blue represents test positive, there is Phytophthora cactorum bacterium; Purple represents that detected result is negative, there is not Phytophthora cactorum bacterium.
The LAMP detection method of described detection Phytophthora cactorum bacterium: the DNA extracting microorganism to be checked, get 1 μ L DNA solution, add detection solution in 23 μ LLAMP test kits and 1 μ L sterilizing deionized water to carry out LAMP, LAMP response procedures and be: 60 DEG C ~ 65 DEG C, 50 ~ 70min.
The method of detection Phytophthora cactorum bacterium of the present invention, comprises the DNA extracting microorganism to be checked, and with the DNA extracted for template, the LAMP primer composition thing described in utilization carries out LAMP; Hydroxynaphthol blue (hydroxylnaphthol blue, HNB) belongs to the one of Metal ion indicator.HNB is Mg
2+titrating solution, its color changes with solution PH change, therefore can by Mg in monitoring LAMP reaction system
2+the change of concentration and solution PH and play the effect of color indicator.Join in reaction solution by HNB before reaction, reaction system is purple, Mg in reaction process
2+the by product P reacted with LAMP
2o
7 4-in conjunction with a large amount of precipitation of generation, Mg in solution
2+concentration reduces, and pH changes, thus makes the color from purple of HNB become sky blue.Therefore, by the colour-change of reaction system after reaction terminates, judge the presence or absence of Phytophthora cactorum bacterium: sky blue represents test positive, there is Phytophthora cactorum bacterium; Purple represents that detected result is negative, there is not Phytophthora cactorum bacterium.
One of guardian technique of the present invention is primer sequence and the amplification method thereof of the efficient specific amplified of Phytophthora cactorum bacterium.In order to verify the specific primer sequence of Phytophthora cactorum bacterium, the present invention for for examination material (table 1), adopts CTAB method to extract the DNA of Phytophthora cactorum bacterium in incidence tissue with 15 strain Phytophthora cactorum bacteria strains and 13 kinds of other oomycetes and 19 kinds of pathogenic fungies.Concrete grammar is as follows: take a morsel hypha powder, adds 900 μ L 2%CTAB extracting solutions and 90 μ L 10%SDS, and whirlpool mixes, and in 55 DEG C of water-bath 1h, middle every 10min turns upside down several times.The centrifugal 10min of 12000rpm, gets and resets and add equal-volume phenol/chloroform/primary isoamyl alcohol (25:24:1), put upside down mixing, the centrifugal 10min of 12000rpm; Supernatant is transferred to new pipe, adds equal-volume chloroform, put upside down mixing gently, the centrifugal 5min of 12000rpm.Supernatant is transferred in new pipe, adds the dehydrated alcohol of 2 times of volumes and the 3M NaAc (pH 5.2) of 1/10 volume ,-20 DEG C of precipitations (>1h).The centrifugal 10min of 12000rpm, incline supernatant, and precipitate by 70% washing with alcohol twice, room temperature is dried.Add appropriate sterilizing ultrapure water or TE (pH 8.0) dissolution precipitation (containing 20 μ g/mL RNase), after 37 DEG C of process 1h ,-20 DEG C save backup.All pedotheques adopt
sPIN test kit (Q-Biogene Ltd, USA) carries out the extraction of DNA.Soil DNA extraction step is see test kit specification sheets.This commercial soil microbial DNA extraction test kit can extract the microorganism in soil in 0.5h.
When there is LAMP amplified reaction, producing a large amount of magnesium pyrophosphate white precipitates causes the turbidity of reaction solution to rise, by shown in the color reaction result of HNB, all in sky blue in the reaction tubes of Phytophthora cactorum bacterium, it is positive findings, and the mould kind of other epidemic disease, fungi, rotten mould and negative control bacterium reaction tubes all in purple, be negative findings, the LAMP Auele Specific Primer designed by proving has the specificity of kind.Simultaneously, reaction product is through 2% agarose gel electrophoresis, the reaction product of imaging amplification, there is typical stairstepping band in the reaction solution in the reaction tubes of Phytophthora cactorum bacterium, and the mould kind of other epidemic disease, fungi, rotten mould and negative control bacterium reaction tubes do not occur trapezoid-shaped strips.This illustrates that this primer sets can be used to the fast and reliable Testing and appraisal of Phytophthora cactorum bacterium in incidence tissue and soil in production practice.When there is Phytophthora cactorum bacterium in for incidence tissue, NaOH rapid cleavage method is adopted to extract the DNA of Phytophthora cactorum bacterium, detailed process is as follows: the plant tissue of getting one section of morbidity, every milligram of tissue adds 10 μ L 0.5M NaOH, be transferred in the EP pipe of 1.5mL after fully grinding in mortar, the centrifugal 5min of 12000rpm, gets 5 μ L supernatant liquors and adds 495 μ L 0.1mM Tris (pH 8.0), gets 1 μ L and be directly used in PCR reaction after mixing.Each reaction at least in triplicate, exists without PCR inhibition in plant for determining simultaneously.
Table 1 is for detecting the specific fungi of Phytophthora cactorum bacterium and oomycetes bacterial strain
Beneficial effect: compared with prior art, advantage of the present invention and positively effect show:
1) accuracy is high: because traditional Phytophthora cactorum bacterium detection technique just determines detected object according to morphological specificity, cannot get rid of the interference of human factor, is difficult to distinguish the close kind of form, and detection accuracy only has 60-80%; And the present invention is according to the sequence of the Ypt1 gene (Genebank:ID HQ850000.1) of Phytophthora cactorum bacterium, utilize Bioedit software the sequence of the Ypt1 gene order of Phytophthora cactorum bacterium and the mould kind of other epidemic diseases to be compared, choose the distinctive one section of specific LAMP primer of sequences Design of Phytophthora cactorum bacterium.LAMP reaction is by 6 isolated areas on 4 primer (FIP, BIP, F3, B3) specific recognition target sequences, and its specificity and sensitivity are all higher.In addition, reverse ring primer LB can improve speed of reaction, together with other four primers, when guaranteeing reaction accuracy, makes the present invention can carry out Phytophthora cactorum detection fast.
2) easy to operate: the cycle needed for the biological detection method that the LAMP method of detection Phytophthora cactorum bacterium provided by the invention overcomes Phytophthora cactorum bacterium in prior art is grown, waste time and energy, the problem of loaded down with trivial details, poor specificity and PCR detection technique need thermal cycler instrument, cannot the problem of rapid detection Phytophthora cactorum bacterium.Detection method is under 64 DEG C of isothermal conditions, and energy fast, convenient, efficient, height is special, Phytophthora cactorum bacterium detected with sensitivity, do not need complex instrument, better can meet the Site Detection to Phytophthora cactorum bacterium.
3) constant-temperature amplification is achieved, must thermal cycling unlike PCR method, so just break away from the dependence to thermal cycler instrument, as long as there is stable thermal source LAMP reaction just can occur, extend the scope that LAMP uses greatly, why LAMP can react under constant thermal source is because with the addition of trimethyl-glycine in LAMP reaction solution, in running balance double-stranded DNA being in unwind, under the effect of Bst archaeal dna polymerase, realizes amplification.
4) practicality is good.Common PCR reaction is carried out gel electrophoresis to product and is easy to cause product to spread, and this is a main source of laboratory pollution; And ethidium bromide (EB) has huge poison, can accumulate carcinogenic; Long-term observation ultraviolet lamp also can cause injury to a certain degree to experimenter.And LAMP reaction only need be carried out in thermostat water bath, just can direct judged result by the colour-change of HNB after reaction terminates, thus add its using value detected in the plant carried disease germs and soil.
5) the present invention is that the detection of Phytophthora cactorum bacterium provides new technology platform, can be used for the highly sensitive rapid detection of Phytophthora cactorum bacterium, identifies pathogen simultaneously, also can detect the pathogen in field soil at the disease infestation initial stage.The present invention blindly uses minimizing agricultural chemicals, reduces production cost, and the environmental pollution reducing agricultural chemicals is also significant.
Accompanying drawing explanation
Based on agarose gel electrophoresis and HNB colour-change, Fig. 1 judges that LAMP detects the specific chromogenic figure of Phytophthora cactorum bacterium; In figure, 1 (a) LAMP detects the specific agarose gel electrophoresis figure of Phytophthora cactorum; Wherein, M is 100bpDNA marker; In figure, display the 1st swimming lane and the 9th swimming lane have typical trapezoidal shape band, are positive; All the other swimming lanes are negative; In figure, 1 (b) color judges that LAMP detects the specific chromogenic figure of Phytophthora cactorum; Show the 1st pipe and the aobvious sky blue of the 9th pipe in figure, be positive; The aobvious purple of all the other pipes, is negative; Wherein, 1,9: Phytophthora cactorum bacterium (P.cactorum); 3: ramie mould (P.boehmeriae); 4: camphor tree epidemic disease mould (P.cinnamomi); 5: Phytophthora capsici (P.capsici); 6: Phytophthora drechsleri (P.drechsleri); 7: phytophthora infestans (P.infestans); 8: strawberry epidemic disease mould (P.fragariae); 10: Pythium ultimum (Pythium ultimum); 11: scouring rush's Fusariumsp (Fusarium equiseti); 12: tack anthrax-bacilus (Colletotrichum truncatum); 13: Pyricularia oryzae (Magnaporthe grisea); 14: dry thread Pyrenomycetes (Rhizoctonia solani); 15: verticillium dahliae (Verticilium dahliae); 8,16: negative control;
Fig. 2 detects LAMP sensitivity based on agarose gel electrophoresis and HNB colour-change; In figure 2 (a) LAMP detect Phytophthora cactorum specific agarose gel electrophoresis figure; Wherein, M is 100bp DNA marker; In figure, 2 (b) color judges that LAMP detects the sensitivity colour developing figure of Phytophthora cactorum; Show the 1st pipe and the aobvious sky blue of the 2nd pipe in figure, be positive; The aobvious purple of 3-9 pipe, is negative; Reaction tubes respectively containing 10ng, 1ng, 100pg Phytophthora cactorum bacterium DNA in the reaction system of 25 μ L shows sky blue, be positive, reaction tubes respectively containing 10pg, 1pg, 100fg, 10fg Phytophthora cactorum bacterium DNA in the reaction system of 25 μ L shows purple, and be negative reaction.Colour developing result shows that the sensitivity that LAMP reacts reaches 100pg.
Embodiment
Below in conjunction with specific embodiment, the present invention is described further, but the present invention is not limited by the following examples.
Embodiment 1
For detecting a LAMP detection kit for Phytophthora cactorum bacterium, by Tris-HCl, 10mM KCl, 10mM (NH of 1.6 μMs of forward inner primer FIP, 1.6 μMs of reverse inner primer BIP, 0.2 μM of forward outer primer F3,0.2 μM of reverse outer primer B3,0.2 μM of reverse ring primer LB, 1.25mM dNTPs, 20mM pH 8.8
4)
2sO
4, 6mM MgSO
4, 0.1%Triton X-100, Bst DNA polymerase 16 unit, 5mM hydroxynaphthol blue, add ultrapure water be prepared into 25uL detect solution.Each primer sequence is specific as follows:
FIP：5′-TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC-3′；
BIP：5′-AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT-3′；
F3：5′-TTCTGCGCTAGGCGACC-3′；
B3：5′-CACACAAGTGGACCGTTAG-3′；
LB：5′-GGAAAGACCATCAAGCTCCAGAT-3′。
Wherein, forward inner primer FIP, oppositely inner primer BIP, forward outer primer F3, oppositely outer primer B3 and reverse ring primer LB directly can form the LAMP detection primer composition for detecting Phytophthora cactorum bacterium.
The specific test that embodiment 2 Phytophthora cactorum bacterium LAMP reacts
In order to verify the specificity of LAMP method, with 15 strain Phytophthora cactorum bacteria strains and 13 kinds of other oomycetes and 19 kinds of pathogenic fungies for for examination material (table 1), LAMP detected result shows 15 strain Phytophthora cactorum bacteria strains and all can be observed sapphire positive reaction or the stair-stepping band of LAMP appears in agarose gel electrophoresis, and all the other 13 kinds of oomycetes and 19 kinds of pathogenic fungi colour developing results are that the negative reaction of purple or agarose gel electrophoresis do not occur amplified band.Select and Phytophthora cactorum bacterium (ramie mould not of the same race; Camphor tree epidemic disease is mould; Phytophthora capsici; Phytophthora drechsleri; Phytophthora infestans; Strawberry epidemic disease is mould) and bacterium (the tack anthrax-bacilus that do not belong to together; Eggplant sickle-like bacteria; Pyricularia oryzae; Dry thread Pyrenomycetes; Verticillium dahliae; Pythium ultimum) DNA as template, get 1 μ L DNA solution, add 23 μ L embodiments 1 preparation detection solution and 1 μ L sterilizing deionized water carry out LAMP reaction, response procedures is: 64 DEG C of 60min.Based on reaction system agarose gel electrophoresis and color reaction as result criterion, during the DNA profiling of result with LAMP primer amplification P.tentaculata, all amplify typical stepped band; And, the bacterium that do not belong to not of the same race with P.tentaculata and negative control all do not have to amplify object band, and (Fig. 1 a).When showing the DNA profiling of amplification Phytophthora cactorum bacterium, present sky blue simultaneously; The DNA profiling of bacterium that amplification is not of the same race with Phytophthora cactorum bacterium, do not belong to together and negative control all present purple (Fig. 1 b).
The sensitivity test that embodiment 3 Phytophthora cactorum bacterium LAMP reacts
In order to determine the sensitivity of LAMP detection method, the DNA spectrophotometric determination concentration (1 μ g/ μ L) of the Phytophthora cactorum bacterium of extracting being carried out 10 doubling dilutions with DEPC water afterwards, preserving as template for-70 DEG C.Get each concentration DNA diluent 1 μ L after 10 doubling dilutions respectively as template, the detection solution and the 1 μ L sterilizing deionized water that add 23 μ L embodiment 1 preparations carry out LAMP reaction, and response procedures is: 64 DEG C of 60min.Get 2 μ L amplified production loadings, result display agarose gel electrophoresis and HNB color reaction show that sensitivity that LAMP reacts reaches the DNA (Fig. 2) of the Phytophthora cactorum bacterium of 100pg.
Embodiment 4 Phytophthora cactorum bacterium LAMP reacts primer specificity checking and sensitivity checking
For the LAMP primer group of Phytophthora cactorum bacterium, devise 11 groups of qualified primers altogether, finishing screen selects the Primer composition (comprise forward inner primer FIP, oppositely inner primer BIP, forward outer primer F3, oppositely outer primer B3, forward ring primer LF and oppositely ring primer LB) used in 1 group of the most special and primer that sensitivity is high and embodiment 1.Adopt all the other primers (select from residue 10 pairs of primers at random 1 to) of design, primer sequence is as follows: FIP1:5 '-AGGAAACACGCCACGTCTGC-TCGAGCTGGACGGAAAGAC-3 '; BIP1:5 '-AACGGTCCACTTGTGTGTCTGT-AGTGATCGTGCGGAAACG-3 '; F31:5 '-TTTTTGCGGTTGTGCCCA-3 '; B31:5 '-CCACGATAATGCCATGGGC-3 '; LB1:5 '-GGAAAGACCATCAAGCTCCAGAT-3 '; With the bacterial strain adopted in embodiment 2 for for examination material (15 strain Phytophthora cactorum bacteria strains and 13 kinds of other oomycetes and 19 kinds of pathogenic fungies), the specificity of the selected primer of LAMP detected result display is not high, and sensitivity is also poor.Illustrate that being used for Primer composition of the present invention has higher specificity and sensitivity.
Embodiment 5 detects Phytophthora cactorum bacterium from soil sample of carrying disease germs
The Phytophthora cactorum bacterium detection kit of embodiment 1, for detecting the method for Phytophthora cactorum bacterium, comprising:
1) enrichment of oospore in soil: get pedotheque to be checked 20 ~ 100 grams, grinds, successively adopts the 200 larger grogs in eye mesh screen place to go, then filter through 400,500,800 eye mesh screens, repeatedly rinse with 3 ~ 10 premium on currency simultaneously, from 800 mesh sieve online collection oospore, use 1mL aqueous suspension.Because oospore can not through 800 eye mesh screens, process can reach the effect making oospore enrichment like this.
2) from micro-oospore, DNA is extracted: transfer in the centrifuge tube of 1.5mL, at 12000r.min by the oospore suspended with sterilized water
-1under rotating speed centrifugal 5 minutes, pouring liquids; Add 50 μ L CTAB buffer, grinding, then add 500 μ L CTAB buffer, water-bath 30 minutes; Add equal-volume chloroform, at 12000r.min
-1under rotating speed centrifugal 10 minutes, draw supernatant; Add the 3M NaAc of 1/10 volume, 2 times of volumes without water-ice ethanol, precipitation at room temperature 30 minutes, 12000r.min
-1under rotating speed centrifugal 10 minutes, fall dry liquids; Add 1mL 70% (V/V) washing with alcohol, 12000r.min
-1under rotating speed centrifugal 10 minutes, fall dry liquids, dry to alcohol-free taste; Add 10 μ L aseptic double-distilled waters to dissolve, for the template of LAMP amplification.
3) Phytophthora cactorum bacterium LAMP detects, and comprising: the LAMP of Phytophthora cactorum bacterium detects: get 1 μ L DNA solution, add detection solution and the 1 μ L sterilizing deionized water of 23 μ L, cumulative volume is 25 μ L; Response procedures is: 64 DEG C of 60min; Using HNB (hydroxynaphthol blue) as reaction indicator, the color that amplification terminates rear LAMP reaction system presents sky blue, judges that can produce positive reaction from soil sample of carrying disease germs contains Phytophthora cactorum bacterium with this.
In embodiment 6 biological tissue, the LAMP of Phytophthora cactorum bacterium detects
Adopt the DNA of the morbidity strawberry of NaOH alkaline lysis method of extracting inoculation Phytophthora cactorum bacterium, it can be used as template to increase for LAMP.Get 1uL DNA solution, by the method for embodiment 4, carry out LAMP reaction.Carry out LAMP in the morbidity strawberry of result display inoculation Phytophthora cactorum bacterium, its color reaction also presents positive sky blue; And healthy strawberry and negative control present purple.
SEQUENCE LISTING
<110> Nanjing Forestry University
The LAMP detection primer composition of a <120> Phytophthora cactorum bacterium and LAMP detection kit thereof and LAMP detection method
<130> 100
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 40
<212> DNA
<213> Artificial
<220>
<223> FIP primer sequence
<400> 1
tctgggcaca accgcaaaaa tttgcgagct ccagatttcc 40
<210> 2
<211> 38
<212> DNA
<213> Artificial
<220>
<223> BIP primer sequence
<400> 2
aatccgtacg atcgagctgg acacacgcca cgtctgct 38
<210> 3
<211> 17
<212> DNA
<213> Artificial
<220>
<223> F3 primer sequence
<400> 3
ttctgcgcta ggcgacc 17
<210> 4
<211> 19
<212> DNA
<213> Artificial
<220>
<223> B3 primer sequence
<400> 4
cacacaagtg gaccgttag 19
<210> 5
<211> 23
<212> DNA
<213> Artificial
<220>
<223> LB primer sequence
<400> 5
ggaaagacca tcaagctcca gat 23
<210> 6
<211> 39
<212> DNA
<213> Artificial
<220>
<223> FIP1 primer sequence
<400> 6
aggaaacacg ccacgtctgc tcgagctgga cggaaagac 39
<210> 7
<211> 40
<212> DNA
<213> Artificial
<220>
<223> BIP1 primer sequence
<400> 7
aacggtccac ttgtgtgtct gtagtgatcg tgcggaaacg 40
<210> 8
<211> 18
<212> DNA
<213> Artificial
<220>
<223> F31 primer sequence
<400> 8
tttttgcggt tgtgccca 18
<210> 9
<211> 19
<212> DNA
<213> Artificial
<220>
<223> B31 primer sequence
<400> 9
ccacgataat gccatgggc 19
<210> 10
<211> 23
<212> DNA
<213> Artificial
<220>
<223> LB1 primer sequence
<400> 10
ggaaagacca tcaagctcca gat 23
Claims (6)
1. for detecting a LAMP primer composition thing for Phytophthora cactorum bacterium, it is characterized in that: be made up of forward inner primer FIP, oppositely inner primer BIP, forward outer primer F3, oppositely outer primer B3 and reverse ring primer LB; Each primer sequence is specific as follows:
FIP：5′- TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC-3′；
BIP：5′- AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT-3′；
F3：5′- TTCTGCGCTAGGCGACC-3′；
B3：5′- CACACAAGTGGACCGTTAG-3′；
LB：5′- GGAAAGACCATCAAGCTCCAGAT-3′。
2. LAMP primer composition thing according to claim 1 is detecting the application in Phytophthora cactorum bacterium.
3. one kind is detected the LAMP kit of Phytophthora cactorum bacterium, it is characterized in that: comprise 1mL and detect solution, described detection solution comprises: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3,8mM reverse outer primer B3,8mM ring primer LB, 50mM dNTPs, 0.8M Tris-HC, 0.4mM KCl, 0.4mM (NH
4)
2sO
4, 0.24mM MgSO
4, 4%Triton X-100, Bst DNA polymerase 320 unit, 200mM hydroxynaphthol blue; Wherein, each primer sequence is specific as follows:
FIP：5′- TCTGGGCACAACCGCAAAAA-TTTGCGAGCTCCAGATTTCC -3′；
BIP：5′- AATCCGTACGATCGAGCTGGAC-ACACGCCACGTCTGCT -3′；
F3：5′- TTCTGCGCTAGGCGACC -3′；
B3：5′- CACACAAGTGGACCGTTAG -3′；
LB：5′- GGAAAGACCATCAAGCTCCAGAT -3′。
4. the LAMP kit of detection Phytophthora cactorum bacterium according to claim 3 is detecting the application in Phytophthora cactorum bacterium.
5. detect a method for Phytophthora cactorum bacterium, it is characterized in that: comprise the DNA extracting microorganism to be checked, with the DNA extracted for template, utilize LAMP primer composition thing or LAMP kit to carry out LAMP; Observe LAMP reaction soln colour-change, sky blue represents test positive, there is Phytophthora cactorum bacterium; Purple represents that detected result is negative, there is not Phytophthora cactorum bacterium.
6. the method for detection Phytophthora cactorum bacterium according to claim 5, it is characterized in that: the DNA extracting microorganism to be checked, get 2 μ L DNA solutions, the detection solution added in 23 μ L LAMP kit carries out LAMP, LAMP response procedures is: 60 DEG C ~ 65 DEG C, 50-70min, amplified production carries out the observation of colour-change.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699942.3A CN104372099B (en) | 2014-11-27 | 2014-11-27 | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699942.3A CN104372099B (en) | 2014-11-27 | 2014-11-27 | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104372099A true CN104372099A (en) | 2015-02-25 |
| CN104372099B CN104372099B (en) | 2017-03-15 |
Family
ID=52551290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410699942.3A Active CN104372099B (en) | 2014-11-27 | 2014-11-27 | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104372099B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331714A (en) * | 2015-11-24 | 2016-02-17 | 福建省农业科学院植物保护研究所 | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof |
| CN106434991A (en) * | 2016-11-30 | 2017-02-22 | 福建省农业科学院植物保护研究所 | Specific primer and PCR (polymerase chain reaction) detection method for detecting phytophthora cactorum and application of specific primer |
| KR101937390B1 (en) * | 2017-03-21 | 2019-01-10 | 전남대학교산학협력단 | Primer set for detecting Peronospora destructor Berk., Diagnostic kit, and Detecting method using the same |
| CN110079631A (en) * | 2019-05-10 | 2019-08-02 | 南京林业大学 | A kind of molecular detecting method of 8 kinds of phytophthoras of high-throughput detection |
| KR102238486B1 (en) * | 2019-11-04 | 2021-04-12 | 경상남도 | Primer sets for the detection of Phytophthora species and use thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000898A1 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant genes involved in defense against pathogens |
| CN102586469A (en) * | 2012-03-31 | 2012-07-18 | 中国科学院微生物研究所 | Loop-mediated isothermal amplification (LAMP) primers for detecting Phytophthora capsici and kit comprising primers |
| CN102643925A (en) * | 2012-05-16 | 2012-08-22 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof |
| CN103014152A (en) * | 2012-11-21 | 2013-04-03 | 安徽省农业科学院植物保护与农产品质量安全研究所 | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae |
-
2014
- 2014-11-27 CN CN201410699942.3A patent/CN104372099B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000898A1 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant genes involved in defense against pathogens |
| CN102586469A (en) * | 2012-03-31 | 2012-07-18 | 中国科学院微生物研究所 | Loop-mediated isothermal amplification (LAMP) primers for detecting Phytophthora capsici and kit comprising primers |
| CN102643925A (en) * | 2012-05-16 | 2012-08-22 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof |
| CN103014152A (en) * | 2012-11-21 | 2013-04-03 | 安徽省农业科学院植物保护与农产品质量安全研究所 | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae |
Non-Patent Citations (2)
| Title |
|---|
| N.CAPOTE等: "《Plant Pathology》", 31 December 2012 * |
| QINGHE CHEN等: "Development and evaluation of specific PCR and LAMP assays for the rapid detection of Phytophthora melonis", 《EUROPEAN JOURNAL OF PLANT PATHOLOGY》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331714A (en) * | 2015-11-24 | 2016-02-17 | 福建省农业科学院植物保护研究所 | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof |
| CN105331714B (en) * | 2015-11-24 | 2018-11-09 | 福建省农业科学院植物保护研究所 | A kind of peronophythora litchi LAMP primer and its rapid detection method |
| CN106434991A (en) * | 2016-11-30 | 2017-02-22 | 福建省农业科学院植物保护研究所 | Specific primer and PCR (polymerase chain reaction) detection method for detecting phytophthora cactorum and application of specific primer |
| KR101937390B1 (en) * | 2017-03-21 | 2019-01-10 | 전남대학교산학협력단 | Primer set for detecting Peronospora destructor Berk., Diagnostic kit, and Detecting method using the same |
| CN110079631A (en) * | 2019-05-10 | 2019-08-02 | 南京林业大学 | A kind of molecular detecting method of 8 kinds of phytophthoras of high-throughput detection |
| KR102238486B1 (en) * | 2019-11-04 | 2021-04-12 | 경상남도 | Primer sets for the detection of Phytophthora species and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104372099B (en) | 2017-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643925B (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN104313175B (en) | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN102676511B (en) | Detection target sequence A3apro of phytophthora sojae, and specific LAMP (loop-mediated isothermal amplification) primer composition and application thereof | |
| CN103352078B (en) | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology | |
| CN104372099A (en) | LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
| CN104372092B (en) | The LAMP detection primer composition of a kind of banksia rose phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN103276061B (en) | Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| CN104328171A (en) | Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus | |
| CN108588266A (en) | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of phytophthora hibernalis | |
| CN103614474B (en) | Loop-mediated isothermal amplification detection primer for ralstonia solanacearu and detection method for ralstonia solanacearu | |
| CN101805795A (en) | Detection reagent kit and detection method of soybean phytophthora | |
| CN107012251A (en) | Bee larva bacillus fluorescent quantificationally PCR detecting kit and its application | |
| CN104404157A (en) | LAMP detection primer composition for detecting phytophthora drechsler tucker, LAMP detection kit, and LAMP detection method | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN113005211A (en) | LAMP primer and method for detecting tigecycline high-level drug resistance gene tet (X) and variant thereof | |
| CN103451294B (en) | Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN104195254A (en) | Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20150225 Assignee: Beijing Huamei Wanxiang Technology Co., Ltd. Assignor: Nanjing Forestry University Contract record no.: 2018320000235 Denomination of invention: LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition Granted publication date: 20170315 License type: Common License Record date: 20181024 Application publication date: 20150225 Assignee: Nanjing city Pukou District moon farm Assignor: Nanjing Forestry University Contract record no.: 2018320000234 Denomination of invention: LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition Granted publication date: 20170315 License type: Common License Record date: 20181024 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20150225 Assignee: Huangdun Nursery Farm, Ganyu District, Lianyungang City Assignor: Nanjing Forestry University Contract record no.: 2018320000376 Denomination of invention: LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition Granted publication date: 20170315 License type: Common License Record date: 20181212 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191030 Address after: 200085 room 10789, building 3, 1800 Panyuan Road, Changxing Town, Chongming District, Shanghai (Shanghai Taihe Economic Development Zone) Patentee after: Rui test precision medical testing (Shanghai) Co., Ltd Address before: Nanjing City, Jiangsu province 210037 Longpan Road No. 159 Patentee before: Nanjing Forestry University |
|
| TR01 | Transfer of patent right |