CN103898222B - A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof - Google Patents
A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof Download PDFInfo
- Publication number
- CN103898222B CN103898222B CN201410137471.7A CN201410137471A CN103898222B CN 103898222 B CN103898222 B CN 103898222B CN 201410137471 A CN201410137471 A CN 201410137471A CN 103898222 B CN103898222 B CN 103898222B
- Authority
- CN
- China
- Prior art keywords
- salmonellas
- primer
- lamp
- detection
- reaction system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof.This test kit comprises (1) 10 × Lamp buffer; (2) 8000U/mL BstDNA polysaccharase; (3) 10mM dNTPs; (4) Lamp primer sets: outer primer 5pmol/ μ L, inner primer 40pmol/ μ L, ring primer 2 0pmol/ μ L; (5) distilled water; (6) fluorescence dye: 10 × SYBR GreenI; (7) positive control: Salmonellas type strain genomic dna; (8) negative control: distilled water.LAMP detection method of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, broad spectrum, be applicable to the advantages such as Site Detection, do not need complex instrument, detection for Salmonellas provides new technical support, can be used for Animal husbandry production unit, primary care health unit, entry and exit and the examination of each disease prevention and control center and detect Salmonellas, there are wide market outlook and larger economical, societal benefits, be suitable for applying on a large scale.
Description
Technical field
The present invention relates to technical field of molecular biological detection, in particular a kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof.
Background technology
Salmonellas (Salmonella) is modal infecting both domestic animals and human cause of disease bacterium in enterobacteriaceae, often parasitizes in animal and human's body enteron aisle.No matter developed country or developing country, Salmonellas is all the important food borne bacteria causing human infection.Be that in all bacterial food poisonings, ratio is the highest by salmonellal food poisoning, endanger the widest one, account for the 42.6%-60% of bacterial food poisoning.At present, the domestic detection for Salmonellas is still based on conventional bacteriological detection method, its weak point is mainly manifested in: the first, operation steps is loaded down with trivial details consuming time, in existing national standard or industry standard, usually 4-6 days is needed to the detection of Salmonellas, can not meet quality monitoring and control and prevention of disease demand timely and effectively; The second, sensitivity is lower, when Salmonellas content is lower in sample, easily causes false negative result; Three, accuracy is not high, especially the food after processing is by the effect of heating, dry, high salt and the factor such as freezing, and Salmonellas wherein can form auxotroph, causes phenotype not to be true to type, easily there is false negative result by traditional technique in measuring, cause the difference of detected result.Therefore, how to improve Salmonellas recall rate, shorten detection time, prevent, because of inhibited reactions such as reason such as sample complicacy, supressor are many, undetected phenomenon occurs and occur, to ensureing that food safety has great importance.
Along with molecular biological development, traditional bacteriological detection method can not meet the rapid batch diagnosis of Salmonellas, the qualification of pathogenic micro-organism is no longer confined in the inspections such as morphology, develop into and detected cause of disease nucleic acid and protein and other from molecular level, new diagnostic techniques constantly occurs, as immunofluorescence, enzyme linked immunological, radioimmunity, PCR, dot hybridization, gene chip etc., wherein many methods can detect Salmonellas in 24h, but need to be equipped with specific equipment, complicated operation, and often have non-specific result to occur, still can not meet the requirement of rapid detection.
Loop-mediated isothermal amplification technique is the novel nucleic acids method for quick that a kind of development in recent years is got up, be characterized in 6 zone design 4 species-specific primers for target gene, utilize strand displacement type archaeal dna polymerase, 10 can be amplified specifically in (60 ~ 65 DEG C), 1h under isothermal conditions
9~ 10
10copy target sequence.On the basis keeping traditional PCR technique advantage, further increase the specificity of reaction, shorten detection time simultaneously.Now be applied to detection and the research of multiple pathogenic microorganisms, and there is good development prospect.
Pili is that Salmonellas sticks the key factor of field planting host, is extremely important in diagnostic reagent research and development field.Salmonellas can express multiple pili, and different pili is encoded by corresponding pili operon gene and expressed.Research shows, bcf pili operon finds a kind of pili operon the most conservative in Salmonellas at present, and all conservative in the serotype that Salmonella enteritidis and Bang Geer Salmonellas comprise exist; Study more fim pili operon and be then mainly present in Salmonella enteritidis, and do not exist in Bang Geer Salmonellas.
Summary of the invention
Technical problem to be solved by this invention is for prior art Problems existing in detection Salmonellas, provides a kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof.
Technical scheme of the present invention is as follows:
Based on a Salmonellas molecular detection kit for bcfD gene, comprising:
（1）10×Lamp buffer；
(2) 8000U/mL BstDNA polysaccharase;
（3）10mM dNTPs；
(4) Lamp primer sets: outer primer concentration is 5pmol/ μ L, outer primer is F3 and B3, F3 sequence be 5 '-CCGGACAAACGATTCTGGTA-3 ', B3 sequence is 5 '-CCGACATCGGCATTATCCG-3 '; Inner primer concentration is 40pmol/ μ L, and inner primer is FIP and BIP, FIP sequence be 5 '-TGCACTTTACCGGTACGCTGAATACAGCGGCAATTTCAACCA-3 ', BIP sequence is 5 '-CGGTCTGGATTCGCAGGTCAAAGCGATAGCCTGGGGAAC-3 '; Ring primer concentration is 20pmol/ μ L, and ring primer is LF and LB, LF sequence be 5 '-TACCCCCTCCGGCTTTTG-3 ', LB sequence is 5 '-ACAATGCGTCTTATCGCTACG-3 ';
(5) distilled water;
(6) fluorescence dye: 10 × SYBR Green I;
(7) positive control: Salmonellas type strain genomic dna;
(8) negative control: distilled water.
Described 10 × Lamp buffer contains 200mM Tris-HCl(pH8.8,25 DEG C), 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and concentration expressed in percentage by volume be the triton x-100 of 1%.
Based on the nondiagnostic detection method of the Salmonellas molecular detection kit of bcfD gene, comprise the steps:
(1) extraction of measuring samples genomic dna: extract according to a conventional method or test kit extraction;
(2) LAMP detection reaction system is as shown in the table:
Note: according to fluorescence visual method, then add 10 × SYBR Green I2.5 μ L in reaction system, reaction system total amount keeps 25.0 μ L constant;
(3) reaction system in (2) is formulated in PCR pipe, positive control and negative control are set simultaneously;
(4) LAMP reaction conditions: by containing centrifugal after the PCR pipe mixing of reaction system, be placed in isoperibol (water-bath or PCR react instrument etc.) 64 DEG C of reaction 50min, and at 80 DEG C of lasting 10min, take out.Visual inspection liquid becomes muddy, illustrates in measuring samples containing Salmonellas; Or observation colour-change, color becomes green, then contain Salmonellas in interpret sample; Color is orange, and interpret sample is not containing Salmonellas; Or using 2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
This test kit LAMP detection method has the following advantages:
(1) output that rapidly and efficiently: whole amplification only can complete with 35 ~ 50min, increases can reach 10
9~ 10
10individual copy target sequence;
(2) simple operation: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the tedious steps such as the sex change of double-stranded DNA, only need a Daepori water flowing bath just to react and detect, condition is gentleer;
(3) high specific: the present invention is six Auele Specific Primers according to Salmonellas bcfD gene design, apply above-mentioned six primers, 6 regions of amplified target sequence, in 6 regions, any region and primer do not mate and all can not carry out nucleic acid amplification, therefore its specificity is high, and highly stable, form primer dimer probability low, ensure that carrying out smoothly of reaction;
(4) highly sensitive: the lowest detection limit can reach 5 ~ 6cfu/ pipe, than regular-PCR height 1-2 order of magnitude;
(5) broad spectrum: it detects, and target spot bcfD gene is all conservative in most salmonella type to be existed and have specificity;
(6) be applicable to Site Detection: visual inspection liquid turns turbid is the positive, clear is then negative; Observe colour-change according to fluorescence visual method, color becomes green, then contain Salmonellas in interpret sample; Color is orange, and interpret sample is not containing Salmonellas; Or using 2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
LAMP detection method of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, broad spectrum, be applicable to the advantages such as Site Detection, do not need complex instrument, detection for Salmonellas provides new technical support, can be used for Animal husbandry production unit, primary care health unit, entry and exit and the examination of each disease prevention and control center and detect Salmonellas, there are wide market outlook and larger economical, societal benefits, be suitable for applying on a large scale.
Accompanying drawing explanation
Fig. 1 is outer primer and the inner primer ratio optimization test-results figure of Salmonellas LAMP detection method of the present invention.
Fig. 2 is outer primer and the ring primer ratio optimization test-results figure of Salmonellas LAMP detection method of the present invention.
Fig. 3 is the default test-results figure of primer of Salmonellas LAMP detection method of the present invention.
Fig. 4 is different concns Mg in Salmonellas LAMP detection system of the present invention
2+test-results figure.
Fig. 5 is different concns BstDNA polymerase assay result figure in Salmonellas LAMP detection system of the present invention.
Fig. 6 is different concns dNTPs test-results figure in Salmonellas LAMP detection system of the present invention.
Fig. 7 is the differential responses humid test result figure of Salmonellas LAMP testing conditions of the present invention.
Fig. 8 is that Salmonellas LAMP detects gene bcfD enzyme and cuts qualification and outer primer to PCR the result figure; Wherein, swimming lane M is DL-5000marker; Swimming lane 1 gets 5 μ L electrophoresis result for after Salmonellas type strain ATCC14028LAMP product dilution 10 times; Swimming lane 2 is Hinf I digestion products electrophoresis result, swimming lane 3 be outer primer to PCR primer electrophoresis result, swimming lane 4 is negative control.
Fig. 9 is Salmonellas LAMP fluorescence visual detection result figure of the present invention.
Figure 10 is the sensitivity results figure of Salmonellas LAMP detection method of the present invention.
Figure 11 is the sensitivity results figure based on bcfD gene process of PCR detecting salmonella.
Figure 12 detects 15 strain Salmonellas type strain electrophoresis result figure in Salmonellas LAMP method specificity experiments of the present invention.
Figure 13 detects 10 strain nonsalmonella type strain electrophoresis result figure in Salmonellas LAMP method specificity experiments of the present invention.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
Embodiment 1 is based on the design of the LAMP detection primer of Salmonellas bcfD fimbriae gene:
Check order after the Salmonellas type strain ATCC14028 that laboratory is preserved is carried out nucleic acid amplification, carry out homology analysis by BLAST software, (sequence has uploaded to U.S.'s gene database for the broad spectrum of acquisition Salmonellas and specific conservative target sequence bcfD gene; GenBank accession number: KJ021967, as shown in SEQ ID NO.7), then according to this conservative target-gene sequence, utilize Photographing On-line software: Primer Explorer version4(
http:// primerexplorer.jp/e) carrying out the design of LAMP primer group, result optimizing obtains three groups of primer pairs, F3 and B3 is first group, FIP and BIP is second group, LF and LB is the 3rd group, and concrete primer sequence is as table 1.In application, three groups of primer pairs can arbitrary proportion used in combination, give in embodiment 2 reaction system and a kind ofly specifically optimize assembly exemplarily.
Table 1 is based on the LAMP detection primer of Salmonellas bcfD fimbriae gene
Described LAMP detection method gained bcfD gene amplification fragment sequence (dotted line frame is denoted as HinfI restriction enzyme site) is as follows:
CCGGACAAACGATTCTGGTAAATTTCGGCGCATTATACAGCGGCAATTTCAACCATGCAGGCCAAAAGCCGGAGGGGGTACGAGCGAAAAAATTCAGCGTACCGGTAAAGTGCAGCGGTCTG
GCAGGTCAATTTAACAATGCGTCTTATCGCTACGCCGGATAGCCACGTTCCCCAGGCTATCGCTTCGGATAATGCCGATGTCGG(SEQ ID NO.7)
Embodiment 2 is based on the foundation of the molecular detection kit detection method of Salmonellas bcfD fimbriae gene:
Carry out LAMP detection with the various Salmonellas for three pairs of primer pair laboratories preservations Salmonellas being carried out to LAMP detection that embodiment 1 obtains, to obtain optimal reaction system and reaction conditions, concrete grammar is as follows:
(1) sample collecting: based on the Salmonellas molecular detection kit of bcfD gene, described sample comprises the involved bacterial strain from pig, ox, chicken, duck, goose cloaca and separate tissue thereof of 15 strain Salmonellas reference cultures used and 10 strain nonsalmonella reference cultures and clinical detection test in specificity verification experiment, and the live-bird animal of selling on the market and the animal derived product separation bacterial strain such as egg, milk.
(2) extraction of measuring samples genomic dna: extract according to a conventional method or test kit extraction.
One, the determination of optimal reaction system
1, ratio optimization and default experiment between primer
(1) optimization of ratio between primer
With Salmonellas type strain ATCC14028 genomic dna for template, LAMP amplification is carried out under the guiding of three pairs of primers of embodiment 1 acquisition, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 DEG C), 10mM KCl, 10mM (NH
4)
2sO
4, concentration expressed in percentage by volume is the triton x-100 of 0.1%, 0.8M trimethyl-glycine (betaine), the MgSO of 8mM
41.4mMdNTPs, 8000U/mLBstDNA polymerase1 μ L(is purchased from NEB company), being optimized for of the concentration ratio of outer primer and inner primer: the concentration of outer primer is set as 5pmol/ μ L, adds inner primer according to following ratio: 1:5,1:6 successively, 1:7,1:8,1:9, select optimum concn ratio.The selection optimum concn ratio of fixing outer primer and inner primer, the optimization of outer primer and ring primer concentration ratio: add ring primer according to following ratio successively: 1:2,1:3,1:4,1:5,1:6, select optimum concn ratio.Other composition: F3, B35pmol/ μ L; FIP, BIP40pmol/ μ L; DNTPs1.4mmol/L; Reaction conditions for being placed in 64 DEG C of isoperibol 50min, and in 80 DEG C of lasting 10min.Use 2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
Result as shown in Figure 1, in each reaction system, all can produce trapezoid-shaped strips, when the ratio of outer primer and inner primer is 1:8, reacts best, so the concentration ratio selecting outer primer and inner primer is the reaction system of 1:8.The concentration ratio of fixing inside and outside primer, by changing the concentration of ring primer, make the concentration ratio of the concentration of ring primer and inner primer between 1/8 ~ 6/8, result as shown in Figure 2, when the ratio of outer primer concentration and ring primer concentration is 5:8, brighter amplified band can be produced.So, determine that the concentration ratio of outer primer, inner primer and ring primer is 1:8:5.In fig. 1 and 2, swimming lane M is DL-5000marker; In Fig. 1, swimming lane 1-5 is respectively outer, inner primer than 1:5,1:6,1:7,1:8,1:9, swimming lane 6 is negative control; In Fig. 2, swimming lane 1-5 be outer, ring primer than 1:2,1:3,1:4,1:5,1:6, swimming lane 6 is negative control.
(2) the default test of primer
For the impact of checking wall scroll and single cover primer pair LAMP reaction devises the default test of primer, in reaction system, primer adds as follows successively: primer inner and outer ring primer has entirely, without upstream outer primer F3, without downstream outer primer B3, supreme, downstream outer primer F3, B3, without upstream inner primer FIP, without downstream inner primer BIP, supreme, downstream inner primer FIP, BIP, supreme lantern primer LF, without lower lantern primer LB, supreme, lower lantern primer LF, LB, inner and outer ring primer all without, negative control, analysis of key binding site and the effect of corresponding primer in LAMP reaction thereof.
As shown in Figure 3, inner primer serves Main Function to test to result, and only adds wall scroll inner primer and can not start LAMP reaction and carry out.The default of outer primer does not have inner primer obvious on LAMP reaction impact, and add wall scroll outer primer and also can start LAMP reaction, the default startup on LAMP of ring primer does not affect, the efficiency of just change LAMP reaction.In Fig. 3, swimming lane M is DL-5000marker; Swimming lane 1-11 is respectively primer inner and outer ring primer to be had entirely, without upstream outer primer F3, without downstream outer primer B3, without upstream and downstream outer primer F3, B3, without upstream inner primer FIP, without downstream inner primer BIP, without upstream and downstream inner primer FIP, BIP, supreme lantern primer LF, without lower lantern primer LB, without upstream and downstream ring primer LF, LB, inner and outer ring primer all without, swimming lane 12 is negative control.
2, the suitableeest Mg
2+the determination of concentration
The Mg of different concns is added in reaction system
2+, to determine best Mg
2+concentration, comprises the following steps:
(1) with Salmonellas type strain ATCC14028 genomic dna for template, LAMP amplification is carried out under the guiding of three pairs of primers of embodiment 1 acquisition, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 DEG C), 10mM KCl, 10mM (NH
4)
2sO
4, concentration expressed in percentage by volume is the triton x-100 of 0.1%, 0.8M trimethyl-glycine (betaine), adds the MgSO of (4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM) respectively
4, 1.4mM dNTPs, 8000U/mL Bst DNA polymerase, the primer amount added is: 5pmol F3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions for being placed in 64 DEG C of isoperibol 50min, and at 80 DEG C of lasting 10min.2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
(2) different concns Mg is contained above-mentioned
2+reaction system in, result contains 8mM MgSO
4the Detection results of reaction system best, as shown in Figure 4, in figure, swimming lane M is DL-5000marker to result; Swimming lane 1-7 is respectively the MgSO of concentration 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM
4, swimming lane 8 is negative control.
3, the determination of the suitableeest BstDNA polymerase reaction density
(1) with Salmonellas type strain ATCC14028 genomic dna for template, LAMP amplification is carried out under the guiding of three pairs of primers of embodiment 1 acquisition, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 DEG C), 10mM KCl, 10mM (NH
4)
2sO
4, concentration expressed in percentage by volume is the triton x-100 of 0.1%, 0.8M trimethyl-glycine (betaine), the MgSO of 8mM
41.4mmol/L dNTPs, 8000U/mL Bst DNA polymerase(is purchased from NEB company), design enzyme addition is followed successively by 0.0,0.6,0.8,1.0,1.2,1.4 μ L and is optimized exploration, the primer amount added is: 5pmol F3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions for being placed in 64 DEG C of isoperibol 35 ~ 50min, and at 80 DEG C of lasting 10min.Use 2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
(2) in (1) containing in the reaction system of different concns Bst DNA polymerase, as seen from Figure 5, when 8000U/mL Bst DNA polymerase addition is 1.0 μ L, effect is best.In Figure 5, swimming lane M is DL-5000marker; Swimming lane 1-6 respectively corresponding Bst DNApolymerase addition is followed successively by 0.0,0.6,0.8,1.0,1.2,1.4 μ L, and swimming lane numbers 7 is negative control.
4, the determination of the suitableeest dNTPs concentration
(1) with Salmonellas type strain ATCC14028 genomic dna for template, LAMP amplification is carried out under the guiding of three pairs of primers of embodiment 1 acquisition, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 DEG C), 10mM KCl, 10mM (NH
4)
2sO
4, concentration expressed in percentage by volume is 0.1% triton x-100,0.8M trimethyl-glycine (betaine), the MgSO of 8mM
4add dNTPs (10mmol/L) 2 μ L, 2.5 μ L, 3 μ L, 3.5 μ L, 4 μ L, 4.5 μ L, 5 μ L respectively, the concentration of the dNTPs in reaction system is adjusted to successively 0.8,1,1.2,1.4,1.6,1.8,2.0mmol/L, 8000U/mL Bst DNA polymerase(is purchased from NEB company), the primer amount added is: 5pmolF3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions for being placed in 64 DEG C of isoperibol 50min, and at 80 DEG C of lasting 10min.Use 2% concentration agarose gel electrophoresis detection, the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.
(2) in (1) reaction system containing different concns dNTPs, as seen from Figure 6, dNTPs concentration all can amplify target gene DNA from 0.8-2.0mmol/L, but can obtain homogeneous, stable band at 1.4mmol/L.Thus, best dNTPs concentration is defined as 1.4mmol/L.In Fig. 6, swimming lane M is DL-5000marker; The concentration of the dNTPs of swimming lane 1-7 respectively in corresponding reaction system is followed successively by 0.8,1,1.2,1.4,1.6,1.8,2.0mmol/L, swimming lane numbers 8 is negative control.
5, digestion verification LAMP reaction
Containing a HinfI(G in the extension increasing sequence of this test kit LAMP
▼aNTC/CTNA
▲g) restriction enzyme site, can carry out enzyme to Salmonellas LAMP amplified production and cut qualification (digestion products is 123bp and 88bp size two band), get 2 μ L LAMP amplified productions, add 1 μ L Hinf I, 2 μ L damping fluid and ddH
2o15 μ L, centrifugal after mixing lightly, under 37 DEG C of conditions, enzyme cuts 1h, 2.0% agarose gel electrophoresis observations.
In sum, optimal reaction system is defined as: the concentration ratio of outer primer, inner primer and ring primer is 1:8:5, Mg
2+concentration is 8mM, 8000U/mL Bst DNA polymerase addition in 25 μ L systems is 1.0 μ L, and best dNTPs concentration is defined as 1.4mmol/L.
Two, the determination of optimal reactive temperature
(1) with Salmonellas type strain ATCC14028 genomic dna for template, LAMP amplification is carried out under the guiding of three pairs of primers of embodiment 1 acquisition, wherein, 25 μ L LAMP reaction systems comprise: containing the genomic dna 2-3 μ L of Salmonellas, 20mM Tris-HCl(pH8.8,25 DEG C), 10mM KCl, 10mM (NH
4)
2sO
4, 0.1% triton x-100,0.8M trimethyl-glycine (betaine), the MgSO of 8mM
4, 1.4mmol/LdNTPs, 8000U/mL Bst DNA polymerase(is purchased from NEB company), the primer amount added is: 5pmolF3 and B3,40pmol FIP and BIP, 20pmol LF and LB; Reaction conditions is be placed in the isoperibol 50min that thermograde is 60.0 DEG C, 61.0 DEG C, 62.0 DEG C, 63.0 DEG C, 64.0 DEG C, 65.0 DEG C respectively, and at 80 DEG C of lasting 10min.2% concentration agarose gel electrophoresis detection, the positive then can present typical specificity scalariform band, and feminine gender is then without this phenomenon.
(2) as can be seen from Figure 7,2 ~ 7 swimming lanes all create trapezoid-shaped strips, can react under 60.0 DEG C ~ 65.0 DEG C temperature are described, when 64.0 DEG C of bands are the brightest, therefore select 64.0 DEG C as optimum temperuture.In Fig. 7, swimming lane M is DL-5000marker; Swimming lane 1-6 respectively corresponding temperature gradient is 60.0 DEG C, 61.0 DEG C, 62.0 DEG C, 63.0 DEG C, 64.0 DEG C, 65.0 DEG C, and swimming lane numbers 7 is negative control.
Embodiment 3 sensitivity evaluation is tested
Test the present embodiment LAMP detection method of the present invention and regular-PCR method detect the sensitivity of Salmonellas.Method is: first clinical Salmonellas and other negative strains are carried out cultivating (carrying out with reference to GB4789.4-2010), by the bacterium after cultivation, (original concentration is 5.6 × 10
7cfu/ μ L) carry out 10 times of gradient dilutions, DNA is extracted according to the method in embodiment 2, carry out LAMP and PCR respectively to detect, wherein PCR primer is the outer primer (F3 and B3) of LAMP method, the bacterium liquid of dilution is carried out slat chain conveyor counting simultaneously, the sensitivity minimization of slat chain conveyor count results and this test kit LAMP is contrasted.Wherein: LAMP detection reaction system is as shown in table 2.
Table 2LAMP detection reaction system
Above-mentioned reaction system is formulated in PCR pipe, arranges positive control and negative control simultaneously; LAMP reaction conditions: brief centrifugation after the mixing of the PCR pipe containing reaction system above-mentioned configuration completed, is placed in water-bath 64 DEG C reaction 50min, and at 80 DEG C of lasting 10min.
PCR detection system is as shown in table 3.
Table 3PCR detection system
Above-mentioned reaction system is formulated in PCR pipe, arranges positive control and negative control simultaneously; PCR reaction conditions: centrifugal after the mixing of the PCR pipe containing reaction system that above-mentioned configuration is completed, PCR detection system Amplification is specially: first 94 DEG C of denaturation 5min, and start amplification cycles afterwards, the program of each circulation is: 94 DEG C of sex change 20s, 58 DEG C of annealing 15s, 72 DEG C extend 15s; Totally 35 circulations; After loop ends, 72 DEG C extend 10min, 4 DEG C of persistences.
Result judges: above-mentioned reaction tubes is placed in respectively water-bath and regular-PCR instrument conditioned response separately, and this LAMP reacts end product and uses 2% concentration agarose gel electrophoresis detection, and the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.PCR reaction product uses 2% concentration agarose gel electrophoresis, and positive findings is visible specific band clearly at 211bp size place, and feminine gender does not then have.
Result: the LAMP detection method minimum detectability 5.6cfu/ μ L of this test kit, the minimum detectability of PCR detection method is 56cfu/ μ L, and result shows that test kit of the present invention has very high sensitivity and clinical detection is worth.Electrophoresis result is shown in Figure 10 and Figure 11.
As shown in Figure 10, in figure: the template concentrations of swimming lane 1 ~ 9:DNA is respectively 5.6 × 10
7cfu/ μ L, 5.6 × 10
6cfu/ μ L, 5.6 × 10
5cfu/ μ L, 5.6 × 10
4cfu/ μ L, 5.6 × 10
3cfu/ μ L, 5.6 × 10
2cfu/ μ L, 5.6 × 10
1cfu/ μ L, 5.6 × 10
0cfu/ μ L5.6 × 10-
1cfu/ μ L; Swimming lane M:5000bp molecular weight standard, swimming lane 10 is negative control.Can see band more clearly at eight lanes, corresponding DNA concentration is 5.6cfu/ μ L, and can't see amplified band completely after eight lanes.Therefore, judge that LAMP detection sensitivity is as 5.6cfu/ μ L, has higher sensitivity and using value.
As shown in figure 11, in figure: the template concentrations of swimming lane 1 ~ 7:DNA is respectively 5.6 × 10
6cfu/ μ L, 5.6 × 10
5cfu/ μ L, 5.6 × 10
4cfu/ μ L, 5.6 × 10
3cfu/ μ L, 5.6 × 10
2cfu/ μ L, 5.6 × 10
1cfu/ μ L, 5.6 × 10
0cfu/ μ L; Swimming lane M:5000bp molecular weight standard, swimming lane 8 is negative control.Can see slightly dark band at the 6th article of swimming lane, corresponding DNA concentration is 56cfu/ μ L, and the 7th article of swimming lane can't see amplified band completely.Therefore, judge that the detection sensitivity of PCR is as 56cfu/ μ L.
Embodiment 4 specificity verification is tested
Carry out the specificity assessment of LAMP detection method by the method for embodiment 2, bacterial strain uses therefor and strain number are see table 4.By reference culture Salmonella paratyphi A, moscow' paratyphi B, Salmonella typhimurium, moscow' paratyphi C, Salmonella choleraesuls, Newport Salmonellas, Salmonella enteritidis, S. pullonum, salmonella typhi, salmonella dublin, mountain Fu Dengbao Salmonellas, Strasbourg Salmonellas, two Arizona Salmonellas, Arizona Salmonellas, Bang Geer Salmonellas, bacillus ceylonensis A, Proteus mirabilis, Vibrio parahemolyticus, listeria monocytogenes, intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, campylobacter jejuni, Klebsiella pneumonia, campylobacter jejuni is cultivated, extract genomic dna, LAMP detection is carried out according to embodiment 1, 64 DEG C of reaction 50min, result as shown in Figure 12 and Figure 13, Salmonellas is various demonstrates specific amplification, nonsalmonella is all without non-specific amplification.In Figure 12, swimming lane 1-16 is respectively Salmonella paratyphi A, moscow' paratyphi B, Salmonella typhimurium, moscow' paratyphi C, Salmonella choleraesuls, Newport Salmonellas, Salmonella enteritidis, S. pullonum, salmonella typhi, salmonella dublin, mountain Fu Dengbao Salmonellas, Strasbourg Salmonellas, two Arizona Salmonellas, Arizona Salmonellas, Bang Geer Salmonellas, negative control; In Figure 13, swimming lane 1-11 is respectively Salmonellas type strain ATCC14028, bacillus ceylonensis A, Proteus mirabilis, Vibrio parahemolyticus, listeria monocytogenes, intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, shigella flexneri, Klebsiella pneumonia, campylobacter jejuni, negative control.
Related strain information involved in table 4 evaluation test process of the present invention
Note: in table results one hurdle: "+" represents positive; "-" represents negative.
Embodiment 5 prepares the Salmonellas molecular detection kit based on bcfD gene
By 10 × Lamp buffer, 8000U/mL BstDNA polysaccharase, 10mM dNTPs, detect primer sets (outer primer F3 and B3:5pmol/ μ L, inner primer FIP and BIP:40pmol/ μ L, ring primer LF and LB:20pmol/ μ L), distilled water, fluorescence dye (10 × SYBR Green I), positive control, negative control, wherein: 10 × Lamp buffer contains 200mM Tris-HCl(pH8.8, 25 DEG C), 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and 1% triton x-100, and as the genomic dna 2 μ L of the Salmonellas of positive control, jointly not packing containing the LAMP amplification system (distilled water) of DNA as negative control, be equipped with products instruction (indicating staining and electrophoretic method two kinds of detection methods) again, obtain the Salmonellas molecular detection kit based on bcfD gene.
Embodiment 6 clinical practice sample detection
(1) sample collecting: based on the Salmonellas molecular detection kit of bcfD gene, described sample comprise from pig, ox, chicken, duck, goose, etc. the Salmonellas that is separated of livestock and poultry and other negative bacterial strain and animal tissues thereof and movement, and the animal derived product such as the live-bird animal of selling on the market and meat, egg, milk.
(2) extraction of measuring samples genomic dna: extract according to a conventional method or test kit extraction.
(3) LAMP detection reaction system is as shown in table 5.
Table 5LAMP detection reaction system
Above-mentioned reaction system is formulated in PCR pipe, arranges positive control and negative control simultaneously;
LAMP reaction conditions: centrifugal after the mixing of the PCR pipe containing reaction system above-mentioned configuration completed, is placed in water-bath 64 DEG C reaction 50min, and at 80 DEG C of lasting 10min.
(4) result judges: above-mentioned reaction tubes is placed in water-bath reaction, and this LAMP reacts end product and uses 2% concentration agarose gel electrophoresis detection, and the positive then can present typical special scalariform band, and feminine gender is then without this phenomenon.Statistics is in table 6.
Table 6338 routine clinical practice sample detection result
In (5) 338 routine clinical feces of livestock and poultry samples and meat product, with Salmonellas GB detection method (GB4789.4 – 2010) method detection time used for 6-7 days, adopt test kit of the present invention to detect the omnidistance time used and be about 4 hours.As can be seen from Table 5, detect 21 routine Salmonellass altogether with GB detection method positive, adopt the detection method of test kit of the present invention to detect 21 routine Salmonellass positive, consistent with National Standard Method.As can be seen here, the detection method that test kit of the present invention is set up is cultivated on accurate, the reliable advantage basis of detection method detected result simpler, quick for clinical practice detection Salmonellas in maintenance tradition, being worthy to be popularized, is the detection method with good application prospect.
Should be understood that, for those of ordinary skills, can be improved according to the above description or convert, and all these improve and convert the protection domain that all should belong to claims of the present invention.
Claims (3)
1., based on a Salmonellas molecular detection kit for bcfD gene, it is characterized in that, comprising:
(1) 10 × Lamp buffer; It is the triton x-100 of 1% that described 10 × Lamp buffer contains 200mM Tris-HCl, 100mM Repone K, 100mM ammonium sulfate, 20mM magnesium sulfate, 8M trimethyl-glycine and concentration expressed in percentage by volume;
(2) 8000U/mL BstDNA polysaccharase;
(3)10mM dNTPs；
(4) Lamp primer sets: outer primer concentration is 5pmol/ μ L, outer primer is F3 and B3, F3 sequence be 5 '-CCGGACAAACGATTCTGGTA-3 ', B3 sequence is 5 '-CCGACATCGGCATTATCCG-3 '; Inner primer concentration is 40pmol/ μ L, and inner primer is FIP and BIP, FIP sequence be 5 '-TGCACTTTACCGGTACGCTGAATACAGCGGCAATTTCAACCA-3 ', BIP sequence is 5 '-CGGTCTGGATTCGCAGGTCAAAGCGATAGCCTGGGGAAC-3 '; Ring primer concentration is 20pmol/ μ L, and ring primer is LF and LB, LF sequence be 5 '-TACCCCCTCCGGCTTTTG-3 ', LB sequence is 5 '-ACAATGCGTCTTATCGCTACG-3 ';
(5) distilled water;
(6) fluorescence dye: 10 × SYBR Green I;
(7) positive control: Salmonellas type strain genomic dna;
(8) negative control: distilled water.
2. the nondiagnostic detection method of the Salmonellas molecular detection kit based on bcfD gene according to claim 1, it is characterized in that, its step is as follows:
(1) extraction of measuring samples genomic dna: extract according to a conventional method or test kit extraction;
(2) LAMP detection reaction system is as shown in the table:
(3) reaction system in (2) is formulated in PCR pipe, positive control and negative control are set simultaneously;
(4) LAMP reaction conditions: by containing centrifugal after the PCR pipe mixing of reaction system, be placed in isoperibol 64 DEG C reaction 50min, and at 80 DEG C of lasting 10min, take out; Use 2% concentration agarose gel electrophoresis detection, the positive can present typical special scalariform band, negative without this phenomenon.
3. the nondiagnostic detection method of the Salmonellas molecular detection kit based on bcfD gene according to claim 2, is characterized in that,
Adopt fluorescence visual method, in reaction system, add 10 × SYBR Green I 2.5 μ L, reaction system total amount keeps 25.0 μ L constant;
LAMP reaction conditions: by containing centrifugal after the PCR pipe mixing of reaction system, be placed in isoperibol 64 DEG C reaction 50min, and at 80 DEG C of lasting 10min, take out; Visual inspection liquid becomes muddy, containing Salmonellas in interpret sample; Or observation colour-change, color becomes green, containing Salmonellas in interpret sample; Color is orange, and interpret sample is not containing Salmonellas.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410137471.7A CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410137471.7A CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898222A CN103898222A (en) | 2014-07-02 |
| CN103898222B true CN103898222B (en) | 2015-09-09 |
Family
ID=50989787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410137471.7A Active CN103898222B (en) | 2014-04-04 | 2014-04-04 | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898222B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218806A (en) * | 2019-06-27 | 2019-09-10 | 华南农业大学 | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726575A (en) * | 2015-03-13 | 2015-06-24 | 江苏省家禽科学研究所 | LAMP kit for rapidly detecting salmonella in avian borne samples |
| CN105219870A (en) * | 2015-11-02 | 2016-01-06 | 广东省第二人民医院 | False-negative salmonella constant temperature fluorescent detector primers group, test kit and detection method can be avoided |
| CN107034211B (en) * | 2017-05-09 | 2020-05-05 | 广州海力特生物科技有限公司 | PCR reaction system and kit for high GC fragment amplification |
| CN109182467A (en) * | 2018-08-24 | 2019-01-11 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection salmonella |
| CN110592250A (en) * | 2019-11-01 | 2019-12-20 | 中国人民解放军总医院 | LAMP primer combination for detecting intestinal pathogenic bacteria and application thereof |
| CN117051021A (en) * | 2023-08-01 | 2023-11-14 | 扬州大学 | Salmonella typhimurium recombinant strain for non-inducible expression of salmonella pullorum Bcf pili and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199665A (en) * | 2011-03-29 | 2011-09-28 | 镇江出入境检验检疫局检验检疫综合技术中心 | LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella |
-
2014
- 2014-04-04 CN CN201410137471.7A patent/CN103898222B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218806A (en) * | 2019-06-27 | 2019-09-10 | 华南农业大学 | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898222A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898222B (en) | A kind of Salmonellas molecular detection kit based on bcfD gene and nondiagnostic detection method thereof | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| Zandi et al. | Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN103409546B (en) | Kit for detecting streptococcus suis type 2 and application of kit | |
| CN105648055B (en) | A kind of fowl source salmonella multiple PCR detection kit and its nondiagnostic detection method | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102154497B (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN102010913B (en) | Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof | |
| Milton et al. | Novel saltatory rolling circle amplification assay for rapid and visual detection of Campylobacter jejuni in chicken meat | |
| CN103320435A (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN104988232B (en) | Application for the primer and probe sequence and primer and probe of Edwardsiella tarda LAMP LFD detections | |
| Liu et al. | Multiplex PCR assay based on the citE2 gene and intergenic sequence for the rapid detection of Salmonella Pullorum in chickens | |
| CN104263841A (en) | Real-time fluorescence LAMP (loop-mediated isothermal amplification) detection method and kit for phytophthora parasitica in potatoes | |
| Zhai et al. | Propidium monoazide real-time PCR amplification for viable Salmonella species and Salmonella Heidelberg in pork | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN104726575A (en) | LAMP kit for rapidly detecting salmonella in avian borne samples | |
| Müştak et al. | Detection and differentiation of Salmonella Enteritidis and Salmonella Typhimurium by multiplex quantitative PCR from different poultry matrices | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN103937889B (en) | A kind of Arcanobacterium pyogenes LAMP detection primer and detection method | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN103421904B (en) | Listeria monocytogenes LAMP (loop-medicated isothermal amplification) visualized detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20160707 Address after: 225127 No. 15 shepherd Road, Hanjiang Industrial Park, Jiangsu, Yangzhou Patentee after: Vacbio Co., Ltd. Address before: 225000 Jiangsu Province, Yangzhou city Guangling District mulberry Road No. 46 Patentee before: Jinagsu Poultry lnstitute |