CN103409499A - LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella - Google Patents
LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella Download PDFInfo
- Publication number
- CN103409499A CN103409499A CN2013101182727A CN201310118272A CN103409499A CN 103409499 A CN103409499 A CN 103409499A CN 2013101182727 A CN2013101182727 A CN 2013101182727A CN 201310118272 A CN201310118272 A CN 201310118272A CN 103409499 A CN103409499 A CN 103409499A
- Authority
- CN
- China
- Prior art keywords
- reaction
- salmonellas
- fluorexon
- lamp
- salmonella
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella. According to the method, primers special for LAMP reaction and optimization, expected reagents and reaction conditions are adopted, two pairs of primers special for the LAMP reaction and the optimization are designed according to conserved sequence fimY genes of the salmonella. According to the method, an optimized prepared calcein MnCl2 mixed solution is taken as a fluorescence indicator, an LAMP reaction system is added before the reaction, and the result can be accurately judged with naked eyes without opening a cover after the one-step reaction. The method is efficient and rapid in reaction, has the characteristics that the operation is easy and convenient, the cost is low, the specificity is good, the university is wide, and the sensitivity is high, can be popularized in cultivation plants, local medical organizations, and laboratories for daily detection, and has wide application prospects and good economic benefits.
Description
Technical field
The invention belongs to the molecular biology for detection of bacterium in biological technical field, relate to a kind of Detection Methods of Salmonella that utilizes loop-mediated isothermal amplification technique.
Background technology
Salmonellas (Salmonella) is a kind of important infecting both domestic animals and human, Gram-negative pathogenic bacteria in enterobacteriaceae.Animal derived Salmonellas easily causes ingester's acute diarrhea, even breaks out food poisoning, causes gastro-enteritis, typhoid fever and paratyphoid, and wherein meat and poultry are the main medias that Salmonellas is propagated.In recent years, the harm that Salmonellas causes in the world is continuous ascendant trend, and on public hygienics, tool is of great significance.
Because Salmonellas serotype is various, all kinds of biochemical reaction complexity, set up at present multiple Detection Methods of Salmonella, as culture-based method, euzymelinked immunosorbent assay (ELISA), biosensor technology, nucleic acid amplification technologies, but these methods or program are loaded down with trivial details, time and effort consuming, or specificity is low, or susceptibility is poor, or the cost costliness etc., be not suitable for field quick detection and basic unit's popularization and application.
2000, Japanese scholars Notomi etc. invented a kind of brand-new nucleic acid amplification method---loop-mediated isothermal amplification technique (LAMP, loop-mediatedisothermalamplification).This method (60 ℃-65 ℃) under isothermal condition just can complete amplified reaction, it can 1h with interior constant temperature under DNA amplification to 10 specifically
9Individual copy, on the basis that keeps the round pcr advantage, further the specificity of intensified response, shorten detection time, reduces costs.Since development, be widely used in the detection of various bacteriophagees.2004, the Yoshikawa philosophy adopts LAMP and 2 kinds of methods of PCR to carry out the HHV-7 DNA cloning, while adopting magnesium pyrophosphate turbidity detection method, the sensitivity that records the LAMP reaction of 30 min is every pipe 500 copies, and the sensitivity of the LAMP of 60 min reaction is every pipe 250 copies, wherein only substrate is to have generated the LAMP product in the reaction of HHV-7 DNA, and at other substrate, the LAMP reaction can not occur all.2009, the reported first such as Wataru Yamazaki the LAMP detection method of differently curved bacillus in chicken.144 parts of separation being carried out respectively to the LAMP detection after the campylobacter jejuni Preston of chicken enrichment meat soup is cultivated cultivates and detects with tradition.With tradition, cultivate detection method and compare, LAMP detection sensitivity and specificity are respectively 98.5% and 97.4%, and positive and negative match-rate is respectively 97.1% and 98.7%.From the evaluation that is separated to of bacterial strain, traditional method needs 3-4 days, and the LAMP method shortens the time greatly, identifies and needs 90min from extracting of DNA, to identifying, altogether needs 24 hours from strains separation.2008, a pair of outer primer of design such as Li Wang and a pair of inner primer, 6 specific regions of specific recognition Salmonellas target gene invA.Under 65 ℃ of isothermal conditions, amplify the target dna sequence of 241bp, after agar electrophoresis, form special gradient band.Application LAMP detects Salmonellas and as goal gene, designs primer mainly with invA at present, exists the invA primer amplified to produce the limitation of the non-specific amplification fragment of non-Salmonellas.LAMP detection method result of determination after system has been reacted has four kinds of methods: the one, and adopt naked eyes directly to judge muddy method, because turbidity differs, the impact of the method subjective factors is larger, can not accurately judge; The 2nd, system adds the fluorescence dyes such as SYBRGreen I, HNB as reaction indicator after completion of the reaction, because SYBRGreen I, HNB etc. affect the LAMP reaction efficiency, adds therefore uncap after must reacting; The 3rd, system is uncapped after completion of the reaction and is carried out the agarose gel electrophoresis detection, produces the gradient band positive reaction namely occurs.Second and third kind method is due to LAMP high-level efficiency amplification, and making after reaction uncaps easily brings Aerosol Pollution, causes false positive to disturb.The 4th, adopt turbidimeter to detect in real time turbidity, the judgement reaction result, used turbidimeter expensive, and the operation relative complex.
Summary of the invention
One of content of the present invention is to provide the primer special of the LAMP for detection of Salmonellas of good, the highly sensitive and highly versatile of a species specificity.
Salmonellas LAMP primer special provided by the invention is according to the Salmonellas specific and conserved sequence fimY gene design shown in nucleotides sequence list 1, for different serotypes (Salmonella enteritidis, white dysentery Salmonellas, the Salmonella typhimurium etc.) Salmonellas of the multiple testing sample of qualitative detection.
The present invention is mixed and is formed by two pairs of primers for the primer that Salmonellas LAMP detects.First pair of primer: primer 1(F3), its nucleotide sequence is as shown in sequence in sequence table 2; Primer 2 (B3), its nucleotide sequence is as shown in sequence in sequence table 3.Second pair of primer: primer 3(FIP), its nucleotide sequence is as shown in sequence in sequence table 4; Primer 4(BIP), its nucleotide sequence is as shown in sequence in sequence table 5.
2 pairs of primers (FIP and BIP) in described combination of primers: the mol ratio of (F3 and B3) is 8:1.
Two of content of the present invention is to overcome the deficiencies such as prior art complicated operation, false positive interference, and a kind of Salmonellas LAMP detection method of accurate, sensitive, quick, easy fluorexon fluorescent visual is provided.
Fluorexon fluorescent visual Salmonellas LAMP detection method provided by the invention comprises the following steps:
(1) with buffered peptone water BPW and ite Gelucystine enrichment liquid SC, treating the sample product according to " check of food safety national standard food microbiological analysis Salmonellas " (GB 4789.4-2010) cultivated 10 ~ 14 hours.
(2) boiling method 64 ℃ of isothermal reactions 1 hour from extract genomic dna above-mentioned enrichment liquid, join the LAMP reaction system that contains above-mentioned primer special.
(3) judged result after the reaction: fluorexon MnCl in system after reaction
2Mixing solutions becomes green fluorescence by orange, means to exist Salmonellas; Before and after reaction, do not have colour-change to be orange, mean not have Salmonellas.
The sample of above-mentioned participation reaction comprises: the samples such as chicken tissue sample, ight soil, meat of dying of illness.Above-mentioned 25ul reaction system specifically comprises: primers F IP and BIP 0.8uM, F3 and B3 0.1uM, testing sample DNA profiling 2ul, MgCl
24mM, trimethyl-glycine Betaine 0.8M, 10 * Thermpol reaction buffer, 2.5 ul, fluorexon MnCl
2Mixing solutions 2.5ul, dNTP 0.8mM, ddH
2O 2ul, Bst archaeal dna polymerase 320U/ml.
Fluorexon MnCl in the 25ul reaction system
2Mixing solutions is through Optimization.By concentration, be the fluorexon solution of 1mM and the MnCl of 4mM
2The solution equal-volume is mixed to get, and fluorexon solution final concentration is 50uM, MnCl
2The solution final concentration is 200 uM.This fluorescent indicator does not affect the LAMP reaction, before reaction, adds in system, directly according to the colour-change judged result, after having avoided uncapping, adds the false positive that fluorescent indicator brings to disturb after single step reaction.
Adopt above scheme, the present invention has the following advantages:
(1) effectively avoid false positive to disturb: in system, to add fluorexon MnCl before reaction
2The mixing solutions fluorescent indicator, do not affect amplification efficiency, but both naked eyes were watched reaction result, the Aerosol Pollution that has added dyestuff to bring after having avoided again uncapping, thus effectively avoid false positive to disturb.
(2) good, the highly versatile of specificity: the present invention has selected 2 pairs of best primers with the design of Salmonellas fimY conserved sequence finishing screen, can accurately get rid of the interference of the similar enterobacteriaceae lactobacteriaceae of other Physiology and biochemistry, all can effectively increase to multiple different serotypes Salmonellas (Salmonella enteritidis, white dysentery Salmonellas, Salmonella typhimurium etc.).
(3) the result evaluation is accurate, convenient: the fluorexon MnCl that adopts the optimum concn ratio of Optimization of the present invention
2Mixing solutions, feminine gender and positive reaction color differentiating are obvious, accurately judged result.
(4) highly sensitive: the sensitivity of fluorexon fluoroscopic examination result is suitable with the PCR electrophoretic detection, and the sensitivity of quantitative real time PCR Instrument detected result is slightly high, is fluorexon fluoroscopic examination and the sensitivity of PCR electrophoresis detection 10 times.
(5) easy and simple to handle: only need to extract genomic dna with boiling method cracking bacterium, then join in reaction system, in 64 ℃ of thermostat water baths, single step reaction got final product the naked eyes result of determination in 1 hour.
(6) fast efficient amplification: whole reaction can complete in 1 hour, and reaction efficiency is apparently higher than PCR.
(7) in sum, the present invention does not need complex instrument and operation, can detect efficient in water bath with thermostatic control, quick, special, delicately Salmonellas, and result is judged easy to be visual.Can be used for examination and the detection Salmonellass such as livestock-raising production unit, laboratory routine testing, medical grass-roots unit, demonstrate wide application prospect and larger economic benefit.
(8) next in conjunction with example, the specific embodiment of the present invention is described in further details.
The accompanying drawing explanation
Fig. 1 is the specific detection result of fluorexon fluorescent visual Salmonellas LAMP detection method of the present invention.
Fig. 2 is the versatility detected result of fluorexon fluorescent visual Salmonellas LAMP detection method of the present invention.
Fig. 3 is the sensitivity detected result of fluorexon fluorescent visual Salmonellas LAMP detection method of the present invention.
Fig. 4 is the sensitivity detected result of salmonella PCR electrophoretic detection.
Embodiment
Embodiment implements to carry out take technical solution of the present invention under prerequisite, in embodiment, not specified, is ordinary method, and next just concrete example is described in detail.
The special primer design of enforcement 1, Salmonellas LAMP detection method
From U.S. geneseq database Genbank, all Salmonellas fimY genes are downloaded in retrieval, by Blast software, carry out homology analysis, the Salmonellas specificity that obtains one section 381bp is guarded the fimY sequence (No. Genbank: AM933172.1, detailed sequence is shown in nucleotides sequence list 1) as target sequence, utilize PrimerExplorer V4 software (Japanese Rong Yan Co., Ltd.) designed, designed primer.Article 4, in primer 2 be inner primer (FIP and BIP), 2 is outer primer (F3 and B3).Inner primer FIP comprises complementary sequence and F2 sequence, the i.e. F1c-F2 in F1 zone; Inner primer BIP comprises the complementary sequence in B1c sequence and B2 zone, i.e. B1c-B2.Outer primer F3 and B3 lay respectively at outside the zone of F2 and B2.Concrete sequence is shown in nucleotide sequence table 2 ~ table 5.
The preparation of enforcement 2, salmonella gene group DNA profiling
Adopt boiling method to extract genomic dna, concrete grammar is as follows:
(1) the bacterium liquid of getting 37 ℃ of cultivations in 10 ~ 14 hours of 1ml is in 1.5ml Eppendorf pipe, and the centrifugal 5min of 5000rpm, abandon supernatant, distilled water washing 2 times,
(2) precipitation is suspended in the 50ul distilled water, after the piping and druming of rifle head mixes, in boiling water, boils 10 min,
(3) take out immediately the Eppendorf pipe, be positioned over-80 ℃ of freezing 15 min,
(4) take out immediately the Eppendorf pipe, in boiling water, boil 1 min, the centrifugal 3min of 10000rpm, get supernatant, and-20 ℃ save backup.
The foundation of enforcement 3, fluorexon fluorescent visual Salmonellas LAMP detection method
One, the preliminary foundation of fluorexon fluorescent visual Salmonellas LAMP detection method
The initial reaction system is: the 2 couples of primers F IP of Salmonellas specific and conserved sequence fimY gene and BIP 0.8uM, F3 and B3 0.1uM, testing sample genomic dna template 2ul, MgCl
23mM, trimethyl-glycine Betaine 0.4M, 10 * Thermpol reaction buffer 2.5ul, 10 * SYBRGreen I 2.5ul, dNTP 0.6mM, ddH
2O 5.5ul, Bst archaeal dna polymerase 320U/ml.The initial reaction condition is: 63 ℃ of isothermal reactions 1 hour.Because the optimization of LAMP reaction system and reaction conditions is adopted quantitative real time PCR Instrument and is detected in real time fluorescence analysis, therefore the fluorescence dye in the initial reaction system is for can be used for IQ
TMThe SYBRGreen I fluorescence dye of 5 quantitative real time PCR Instrument optical system detection fluorescence.
Two, the foundation of fluorexon fluorescent visual Salmonellas LAMP detection method optimum response system and reaction conditions
IQ
TMThe alternative turbidimeter of 5 quantitative real time PCR Instrument optical system carries out the detection of LAMP reaction efficiency by real-time detection SYBR Green I fluorescence, and Salmonellas LAMP detection method of the present invention adopts IQ
TM5 quantitative real time PCR Instrument optical systems are carried out reaction system and reaction condition optimization.Successively to Mg
2+(2uM, 3uM, 4uM, 5uM, 6uM), trimethyl-glycine Betaine(0M, 0.4M, 0.8M, 1.2M), dNTP(0.6mM, 0.8mM, 1 mM, 1.2 mM, 1.4 mM), Bst archaeal dna polymerase (224U/ml, 256U/ml, 288 U/ml, 320 U/ml, 352 U/ml) concentration gradient and temperature of reaction are (60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃) gradient is optimized, determine that the optimum response system is: the 2 couples of primers F IP of Salmonellas specific and conserved sequence fimY gene and BIP 0.8uM, F3 and B3 0.1uM, testing sample DNA profiling 2ul, MgCl
24mM, trimethyl-glycine Betaine 0.8M, 10 * Thermpol reaction buffer, 2.5 ul, 10 * SYBR Green I 2.5ul, dNTP 0.8mM, ddH
2O 2ul, Bst archaeal dna polymerase 320U/ml.Optimum reaction condition is: 64 ℃ of isothermal reactions 1 hour.Owing in practical application, adopting the visual judgement reaction result of naked eyes, therefore detect on the reaction system basis determined at quantitative real time PCR Instrument, the 10 * SYBRGreen I in system is replaced to fluorexon MnCl
2Mixing solutions, and to fluorexon solution (0.50mM, 1mM) and MnCl
2The mixing of solution (1mM, 2mM, 3mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10 mM) different concns equal-volume is optimized, and obtains fluorexon (1mM) and MnCl
2Solution (4mM) equal-volume is best fluorescent indicator after mixing.The optimum response system of determining fluorexon fluorescent visual Salmonellas LAMP detection method is: the 2 couples of primers F IP of Salmonellas specific and conserved sequence fimY gene and BIP 0.8uM, F3 and B3 0.1uM, testing sample DNA profiling 2ul, MgCl
24mM, trimethyl-glycine Betaine 0.8M, 10 * Thermpol reaction buffer, 2.5 ul, fluorexon MnCl
2Mixing solutions 2.5ul, dNTP 0.8mM, ddH
2O 2ul, Bst archaeal dna polymerase 320U/ml.Optimum reaction condition is: 64 ℃ of isothermal reactions 1 hour.
Choose the enterobacteriaceae lactobacteriaceae similar to the Salmonellas physiological and biochemical property (Serratia, intestinal bacteria, Bacillus proteus, Shigellae, pseudomonas aeruginosa, klebsiella) boiling method and extract genomic dna.With the positive contrast of Salmonella enteritidis genomic dna, with the negative contrast of distilled water, carry out the LAMP reaction according to optimum response system and reaction conditions in enforcement 3.
Fluorexon fluorescence developing detected result has positive amplification for only having Salmonella enteritidis LAMP reaction solution to become green fluorescence by orange, showing; Before and after other enterobacteriaceae lactobacteriaceae and negative control reaction, the LAMP reaction solution is orange, without colour-change, shows and positive amplification do not occur.Specifically see Fig. 1, wherein 1-8 be respectively Salmonella enteritidis positive control, Serratia, intestinal bacteria, Bacillus proteus, Shigellae, pseudomonas aeruginosa, klebsiella, distilled water negative control.
Choose 7 kinds of common serotype Salmonellass of difference (Salmonella enteritidis, white dysentery Salmonellas, Salmonella typhimurium, Salmonella paratyphi A, Arizona Salmonellas, salmonella typhi, Salmonella choleraesuls) boiling method and extract genomic dna.With the negative contrast of distilled water, carry out the LAMP reaction according to optimum response system and reaction conditions in enforcement 3.
Fluorexon fluorescence developing detected result is that 7 kinds of different serotypes Salmonellas LAMP reaction solutions become green fluorescence by orange, shows and all has positive amplification; Before and after the negative control reaction, the LAMP reaction solution is orange, without colour-change, shows and positive amplification do not occur.Specifically see Fig. 2, wherein 1-8 be respectively Salmonella enteritidis, white dysentery Salmonellas, Salmonella typhimurium, Salmonella paratyphi A, Arizona Salmonellas, salmonella typhi, Salmonella choleraesuls, distilled water negative control.
Boiling method extracts Salmonella enteritidis reference culture genomic dna, and carry out 10 times of gradient dilutions, obtaining respectively concentration is the Salmonella enteritidis genomic dna of 442ng/ul, 44.2ng/ul, 4.42ng/ul, 442pg/ul, 44.2pg/ul, 4.42pg/ul, 0.442pg/ul, 0.0442pg/ul.Different gradient DNA concentration is carried out to the LAMP reaction according to optimum response system and reaction conditions in enforcement 3.
Fluorexon fluorescence developing detected result is that the Salmonella enteritidis LAMP reaction solution of 442ng/ul-4.42pg/ul all becomes green fluorescence, and colour-change does not appear in the concentration LAMP reaction solution of 0.442pg/ul, 0.0442pg/ul, is orange.Specifically see Fig. 3, wherein 1-9 concentration are respectively 442ng/ul, 442ng/ul, 44.2ng/ul, 4.42ng/ul, 442pg/ul, 44.2pg/ul, 4.42pg/ul, 0.442pg/ul, 0.0442pg/ul.
Choose the Salmonella enteritidis genomic dna of implementing 442ng/ul-0.0442pg/ul concentration in 6, with the negative contrast of distilled water, carry out PCR.The 25ul reaction system is: Taq MasterMix 12.5ul, each 1ul of primers F 3 and B3, DNA profiling 2ul, distilled water 2ul.Reaction conditions is: 95 ℃/5min; 95 ℃/30s, 56 ℃/30s, 72 ℃/45s; 72 ℃/10min, 30 circulations.
React laggard row agarose gel electrophoresis, conform to re-set target, the Salmonella enteritidis of 442ng/ul-4.42pg/ul concentration has band near 250bp, and brightness weakens gradually, and 0.442pg/ul, 0.0442pg/ul concentration are without band.Specifically see Fig. 4, wherein 1-9 concentration are respectively 442ng/ul, 44.2ng/ul, 4.42ng/ul, 442pg/ul, 44.2pg/ul, 4.42pg/ul, 0.442pg/ul, 0.0442pg/ul, and M is Tranks2K plus DNA Marker.Show, Salmonellas LAMP fluorexon fluorescence developing detects suitable with PCR sensitivity, and the sensitivity that quantitative real time PCR Instrument detects is a little more than the above two.
The nucleotides sequence list
[0041]
Sequence table
<1>1
<2>381
<3>DNA
<4 > artificial sequence
<5>
<6>
<7>1
tgtggggaaggttaaggagggtgataagttgtttaagccggtaaactacacgatgataaggtacgctttgctgacgtgct
atttcttttaaagaggcaccttgcgctaaagtttcaatcatcaaccagtcagtacggctaaagctttccgataagcgagg
tttggcggctgataacaaggcttcgcgtacagaggccagattttgtcgtcgcgacagaacaaaaaaacgcccagccatac
ggataaactgtgttatagcgggggttttatctgataccagcaggtaaatctggatatcgctttgttgccaactgagcgcg
cgtagctggttaagcgcctcaatacaggagacaggtagcgcctccatatctacaatcagtt
<8>2
<9>20
<10>DNA
<11 > artificial sequence
<12>
<13>
<14>2
gggaaggttaaggagggtga
<15>3
<16>20
<17>DNA
<18 > artificial sequence
<19>
<20>
<21>3
gctgggcgtttttttgttct
<22>4
<23>42
<24>DNA
<25 > artificial sequence
<26>
<27>
<28>4
actttagcgcaaggtgcctcttagccggtaaactacacgatg
<29>5
<30>42
<31>DNA
<32 > artificial sequence
<33>
<34>
<35>5
ttccgataagcgaggtttggcgcgacaaaatctggcctctgt
Claims (8)
1. the primer special detected for Salmonellas LAMP, the combination of primers according to the special conserved sequence fimY of Salmonellas gene (seeing nucleotides sequence list 1) design, for qualitative detection different serotypes (Salmonella enteritidis, white dysentery Salmonellas, Salmonella typhimurium etc.) Salmonellas.
2. in claim 1, comprise 2 pairs of primer specials in desired combination of primers, each primer pair (FIP and BIP): the mol ratio of (F3 and B3) is 8:1.
3. 2 pairs of concrete primer sequences are shown in nucleotides sequence list 2 ~ table 5.
4. fluorexon fluorescent visual Salmonellas LAMP detection method comprises the following steps:
(1) with buffered peptone water BPW and ite Gelucystine enrichment liquid SC, cultivated sample to be checked 10 ~ 14 hours according to " check of food safety national standard food microbiological analysis Salmonellas " (GB 4789.4-2010);
(2) boiling method is from extracting bacterial genomes DNA above-mentioned enrichment liquid, joins in the LAMP reaction system that contains above-mentioned primer 64 ℃ of isothermal reactions 1 hour, with Salmonella enteritidis, makes positive and distilled water simultaneously and makes negative control;
(3) judged result after the reaction: the fluorexon MnCl after reaction in system
2Mixing solutions becomes green fluorescence by orange, means to exist Salmonellas; Before and after reaction, there is no colour-change, is all orange, means not have Salmonellas.
5. according to claim 4, one of feature of fluorexon fluorescent visual LAMP detection method of the present invention is that the sample that participates in reaction comprises the samples such as chicken tissue sample, ight soil, meat of dying of illness.
6. according to claim 4,5 described, two of the feature of fluorexon fluorescent visual LAMP detection method of the present invention is that above-mentioned 25ul reaction system specifically comprises: primers F IP and BIP 0.8uM, F3 and B3 0.1uM, testing sample DNA profiling 2ul, MgCl
24mM, trimethyl-glycine Betaine0.8M, 10 * Thermpol reaction buffer, 2.5 ul, fluorexon MnCl
2Mixing solutions 2.5ul, dNTP0.8mM, ddH
2O 2ul, BstDNA polysaccharase 320U/ml.
7. according to claim 4,5,6 described, three of the feature of fluorexon fluorescent visual LAMP detection method of the present invention is Optimization fluorexon MnCl
2Mixing solutions, as fluorescent indicator, adds system before reaction.
8. fluorexon MnCl according to claim 7,
2Mixing solutions is the fluorexon solution of 1mM and the MnCl of 4mM by concentration
2The solution equal-volume is mixed to get, and fluorexon solution final concentration is 50uM, MnCl
2The solution final concentration is 200 uM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013101182727A CN103409499A (en) | 2013-04-08 | 2013-04-08 | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013101182727A CN103409499A (en) | 2013-04-08 | 2013-04-08 | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103409499A true CN103409499A (en) | 2013-11-27 |
Family
ID=49602541
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013101182727A Pending CN103409499A (en) | 2013-04-08 | 2013-04-08 | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409499A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107209119A (en) * | 2014-12-30 | 2017-09-26 | 韩国陶瓷技术院 | Water content detection sensor, defects detection sensor and utilize its sensor array |
| CN107988401A (en) * | 2017-12-29 | 2018-05-04 | 广东环凯微生物科技有限公司 | The dry powdered LAMP quick detection kits of salmonella |
| CN109402271A (en) * | 2017-08-14 | 2019-03-01 | 中国科学院微生物研究所 | For detecting the primer system and kit and their application and the method for detecting salmonella of salmonella |
| CN114262707A (en) * | 2021-12-30 | 2022-04-01 | 四川大学 | sgRNA, CRISPR/Cas12a system, kit, detection method and application for detecting campylobacter jejuni gene |
-
2013
- 2013-04-08 CN CN2013101182727A patent/CN103409499A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| WANG DEGUO等: "Drawback of loop-mediated isothermal amplification", 《AFRICAN JOURNAL OF FOOD SCIENCE》 * |
| YONGZHEN WANG等: "Development and evaluation of a Loop-mediated isothermal amplification（LAMP）method for detecting foodborn salmonella in raw milk", 《ADVANCED MATERIALS RESEARCH》 * |
| 张跃伟等: "荧光显色在环介导等温扩增（LAMP）检测猪繁殖与呼吸综合征病毒的应用", 《农业生物技术学报》 * |
| 王福厚等: "环介导恒温扩增（LAMP）——检测沙门氏菌", 《中国动物检疫》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107209119A (en) * | 2014-12-30 | 2017-09-26 | 韩国陶瓷技术院 | Water content detection sensor, defects detection sensor and utilize its sensor array |
| CN109402271A (en) * | 2017-08-14 | 2019-03-01 | 中国科学院微生物研究所 | For detecting the primer system and kit and their application and the method for detecting salmonella of salmonella |
| CN107988401A (en) * | 2017-12-29 | 2018-05-04 | 广东环凯微生物科技有限公司 | The dry powdered LAMP quick detection kits of salmonella |
| CN114262707A (en) * | 2021-12-30 | 2022-04-01 | 四川大学 | sgRNA, CRISPR/Cas12a system, kit, detection method and application for detecting campylobacter jejuni gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367500B (en) | Method for rapidly detecting vibrio vulnificus at constant temperature, primer and application | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN107686863A (en) | The method that loop-mediated isothermal amplification technique detects three kinds of Urogenital Mycoplasmas | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN101899521A (en) | Loop-mediated isothermal amplification (LAMP) detection method of Angiostrongylus cantonensis | |
| CN107338314B (en) | Closed-tube visual eel-derived aeromonas hydrophila loop-mediated isothermal amplification detection method | |
| CN102643919B (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| CN102888458A (en) | Method for quickly detecting (Streptococcus agalactiae)sip with high sensitivity | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN103898222A (en) | Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method | |
| CN101368203B (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN101348835B (en) | Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology | |
| CN106367493A (en) | Method for rapidly detecting salmonella at constant temperature, primer and applications of primer | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN103014156A (en) | Loop mediated isothermal amplification detection primer group, detection method and kit for enterococcus faecalis | |
| CN106367501A (en) | Method for rapidly detecting salmonella at constant temperature, primer and kit | |
| CN101892313B (en) | Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology | |
| CN102643923B (en) | Primer group and kit for rapidly detecting Listeria monocytogenes by utilizing LAMP (Loop-mediated Isothermal Amplification) technology | |
| CN102643924B (en) | Primer group and kit for rapidly detecting Listeria monocytogenes by utilizing LAMP (Loop-mediated Isothermal Amplification) technology | |
| CN106367499B (en) | Method, primer and kit for rapidly detecting vibrio vulnificus at constant temperature | |
| CN103215375B (en) | Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight | |
| CN102643922B (en) | Primer and kit for rapidly detecting listeria monocytogenes by using loop mediated isothermal amplification technique | |
| CN102676673B (en) | Primer group for detecting listeria monocytogenes and quick detection kit of loop-mediated isothermal amplification technology | |
| CN111378770A (en) | Kit for detecting mycoplasma pneumoniae | |
| CN111378768A (en) | Kit for detecting bordetella pertussis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131127 |