CN114262707A - sgRNA, CRISPR/Cas12a system, kit, detection method and application for detecting campylobacter jejuni gene - Google Patents
sgRNA, CRISPR/Cas12a system, kit, detection method and application for detecting campylobacter jejuni gene Download PDFInfo
- Publication number
- CN114262707A CN114262707A CN202111681762.9A CN202111681762A CN114262707A CN 114262707 A CN114262707 A CN 114262707A CN 202111681762 A CN202111681762 A CN 202111681762A CN 114262707 A CN114262707 A CN 114262707A
- Authority
- CN
- China
- Prior art keywords
- campylobacter jejuni
- crispr
- sgrna
- cas12a
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a sgRNA, CRISPR/Cas12a system, a kit, a detection method and application for detecting campylobacter jejuni genes, and belongs to the technical field of bacteria detection. The detection kit comprises sgRNA for specifically detecting campylobacter jejuni genes, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID No. 1. The detection method has the advantages of good specificity, extremely high sensitivity, simple and rapid operation, low cost, no need of large-scale instruments and equipment, visualization advantage and contribution to popularization and application of the molecular detection technology for campylobacter jejuni in the basic level.
Description
Technical Field
The invention relates to the technical field of bacteria detection, in particular to a sgRNA and CRISPR/Cas12a system, a kit, a detection method and application for detecting campylobacter jejuni genes.
Background
Campylobacter jejuni (Campylobacter jejuni) is a gram-negative bacterium that grows microaerobically and is an important zoonosis pathogen affecting the food safety of animal products. It is one of three main human diarrhea pathogenic bacteria except salmonella and shigella. Campylobacter jejuni, once infected in humans, causes acute bacterial gastroenteritis, but also other complications such as meningitis, urinary tract infections, Guillain-Barre syndrome (GBS) and Fisher Syndrome (FS), bacteremia and autoimmune neuroparalysis. As an important food-borne pathogenic bacterium, its global incidence is even higher than some other common pathogens that also cause acute gastrointestinal infections, such as escherichia coli, shigella or salmonella. Infection by campylobacter jejuni has been reported in various parts of the world including europe, north america, australia, middle east, africa, and asia over the past decade, and both incidence and prevalence have been on an increasing trend. Poultry are used as main hosts of campylobacter jejuni, and commercially available chickens and their viscera are often contaminated by campylobacter jejuni, and raw pork, raw beef and raw mutton may also be contaminated by campylobacter jejuni. In addition, campylobacter jejuni can also cause human infections through water sources contaminated with animal feces or human-to-animal contact.
A common classical method for the identification of campylobacter jejuni is a biochemical identification method, which can be implemented by inoculating modified Camp-BAP agar or Skirrow agar at 42 + -1 deg.C in accordance with the national food safety Standard food microbiology test for campylobacter jejuni (GB 4789.9-2014), and microaerophilic (5% O.O.2,10％CO2And 85% N2) Culturing for 48h under the condition, wherein the higher culture temperature can inhibit some competitive flora in samples such as food and the like, and then combining biochemical experiments such as catalase, glycine tolerance, 3.5% sodium chloride intolerance, equestrian sodium and nitrate reduction and the like to complete identification. The International organization for standardization (ISO) in 2009 suggests the use of Bolton broth for the detection of Campylobacter jejuni, microaerophilic culture at 37 ℃ for 4-6h and then at 41.5 ℃ for 40-48 h. Detection of Campylobacter bacteria in Priston broth (Preston broth) at 41.5 deg.C from food with high background value such as chicken meat product, raw meat and raw milkCulturing for 24h under microaerophilic culture, and then performing isolation culture with active cefoperazone deoxycholate plate (CCDA). The identification method is complex in operation, long in time period and low in sensitivity, and cannot cope with the situation of urgent need of detection in an emergency. A single immunological method is easy to pollute and has serious cross reaction, and a conventional PCR detection method needs a PCR instrument, an electrophoresis instrument, a gel imaging system and other matched instruments.
The immunomagnetic bead separation technology is a technology for coupling a specific antibody with a magnetic bead with a certain size, combining a magnetic bead with a cell by utilizing the principle that the specific antibody can be combined with a cell surface antigen, and separating a magnetic bead-cell compound from the environment under the action of an external magnetic field to obtain a target cell. The method is completed at 65 ℃ only without additional instruments and equipment, but the method is easy to misjudge if judged by the turbidity of a product, and the other results are judged to be detected by uncovering, so that aerosol pollution is easily caused. The CRISPR/Cas12a protein can specifically cut a target sequence under the guidance of sgRNA and simultaneously activate the trans-cleavage activity, and randomly cut a probe to generate fluorescence, however, the sensitivity of detection by using a single CRISPR/Cas nucleic acid is very limited, and the detection sensitivity can be greatly improved by combining a nucleic acid amplification technology with the detection technology.
Disclosure of Invention
The invention aims to provide a sgRNA and CRISPR/Cas12a system, a kit, a detection method and application for detecting campylobacter jejuni genes, and aims to solve the problems that the existing campylobacter jejuni detection method is complicated in operation, long in time period and low in sensitivity, and cannot cope with the situation of urgent need of detection in an emergency.
The technical scheme for solving the technical problems is as follows:
the invention provides a sgRNA for specifically detecting campylobacter jejuni, wherein a nucleotide sequence of the sgRNA is shown in SEQ ID No. 1. The amino acid sequence of SEQ ID NO. 1: GAAUUUCUACUGUUGUAGAUCCUUUACAAGAAUGCACAAAUUUG are provided.
The invention provides application of the sgRNA in detecting campylobacter jejuni.
The invention also provides application of the sgRNA in preparation of a campylobacter jejuni detection product.
The invention provides a CRISPR/Cas12a system for detecting campylobacter jejuni, which comprises sgRNA and Cas12a protein.
Further, in the CRISPR/Cas12a system for detecting campylobacter jejuni, the CRISPR/Cas12a system further comprises a ssDNA probe labeled with FAM at the 5 'end and BHQ1 at the 3' end.
Further, in the CRISPR/Cas12a system for detecting Campylobacter jejuni, the nucleotide sequence of the ssDNA probe is shown as SEQ ID NO. 2. The amino acid sequence shown in SEQ ID NO. 2: FAM-TTTTTT-BHQ 1.
The invention also provides an isothermal amplification-CRISPR/Cas 12a system for detecting campylobacter jejuni, which comprises the CRISPR/Cas12a system and the isothermal amplification system;
the primer group of the isothermal amplification system comprises a forward outer primer, a reverse outer primer, a forward inner primer and a reverse inner primer;
the nucleotide sequence of the forward outer primer is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse outer primer is shown as SEQ ID NO. 4; the nucleotide sequence of the forward inner primer is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse inner primer is shown as SEQ ID NO. 6.
The amino acid sequence of SEQ ID NO. 3: GAAAAACAGGCGTTGTG are provided.
The amino acid sequence of SEQ ID NO. 4: CCTCTTCAGCAGGTTGAA are provided.
The amino acid sequence of SEQ ID NO. 5:
GCATTCTTGTAAAGGCAAAGCATTTTTGGAAATAGCGATAAAAAAATAGGAC。
the amino acid sequence of SEQ ID NO. 6:
TGCATGCTTGTGGTCATGATGTTTTCGCCATTAAAATTCTGACTTG
the invention also provides a kit for detecting campylobacter jejuni, which comprises the isothermal amplification-CRISPR/Cas 12a system and immunocapture magnetic beads.
Further, in the kit for detecting campylobacter jejuni, the immunocapture magnetic beads are modified with campylobacter jejuni antibodies.
The invention also provides a detection method of the kit for detecting campylobacter jejuni, which comprises the following steps:
capturing Campylobacter jejuni in a sample to be detected by using immunocapture magnetic beads, and cracking to obtain an amplification template DNA;
carrying out isothermal amplification reaction on the amplification template to obtain an amplification product;
adding the amplification product into the CRISPR/Cas12a system for enzyme digestion reaction to obtain a signal product; alignment of signal products was performed.
The main host of campylobacter jejuni is avian, and contamination is severe and unavoidable in the entire food processing chain "from farm to dining table". The existing detection method of campylobacter jejuni comprises the traditional separation culture identification and molecular detection methods such as PCR, qPCR and loop-mediated isothermal amplification (LAMP). Due to the microaerophilic property of campylobacter jejuni, the isolation culture and identification of campylobacter jejuni are more difficult than those of conventional facultative anaerobic pathogenic bacteria, and the molecular detection methods such as PCR and qPCR require corresponding equipment and are not suitable for field detection. The single LAMP has the application potential of on-site rapid detection due to the characteristic of isothermal amplification, but the result detection needs uncovering, so that false positive results such as aerosol pollution and the like are easily caused.
The invention has the following beneficial effects:
1. the LAMP amplification primers are designed aiming at the hipO gene of the campylobacter jejuni, the LAMP identification system of the campylobacter jejuni is established, and the sgRNA for detecting the campylobacter jejuni ICB-LAMP-CRISPR/Cas12a is designed aiming at the hipO gene of the campylobacter jejuni. Aiming at the hipO gene of the campylobacter jejuni, an ICB-LAMP-CRISPR/Cas12a detection amplification method for rapidly, accurately, one-tube and visually detecting the campylobacter jejuni is established. Binding of LAMP to CRISPR/Cas12a allows direct product detection without decap.
2. The invention combines the method of enriching the sample by immunocapture magnetic beads (ICB), LAMP amplification and CRISPR/Cas12a detection to form the detection kit and the detection method of ICB-LAMP-CRISPR/Cas12 a. The detection method has the advantages of good specificity, high sensitivity, simple and quick operation, low cost, no need of large-scale instruments and equipment, visualization, and contribution to popularization and application of the molecular detection technology for campylobacter jejuni in the basic level.
3. The detection method is an effective means in real-time monitoring of campylobacter jejuni in chicken farms and food safety detection, so that propagation of campylobacter jejuni in a production chain is controlled, cross contamination in the processes of hatching, breeding, transporting, slaughtering and product processing and the like of contaminated feed, breeding hens and chicks is reduced, and public health threats of the campylobacter jejuni are reduced.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 shows the capture of immunocapture magnetic beads in experimental example 1 at different time periods;
FIG. 2 shows the fluorescence response of different signal products in Experimental example 3;
fig. 3 is a fluorescent reaction of the signal product of sgRNA4 in experimental example 3 at different time periods;
FIG. 4 is a graph showing the effect of the concentration of immunocapture magnetic beads on the fluorescence intensity of a signal product in test example 4;
FIG. 5 is an assay specific for the detection method of the present invention;
FIG. 6 shows the detection of isolates of chicken house-derived strains by the detection method of the present invention.
Detailed Description
The principles and features of the present invention are described below in conjunction with the embodiments and the accompanying drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
It should be noted that the milky white color with higher concentration in the drawings of the present invention is the fluorescence effect specifically indicated by the present invention.
Test example 1 construction of immunocapture magnetic beads (ICB)
Magnetic bead pretreatment: the magnetic beads are oscillated for 1min in a vortex mode to enable the magnetic beads to be fully oscillated and resuspended; and (3) putting 500 mu L of magnetic bead suspension into a 1.5mL EP tube, putting the EP tube into a magnetic separation rack, enriching the magnetic beads, and removing the supernatant. 1mL of precooled Wash Buffer A at 4 ℃ was added for magnetic separation, the supernatant was discarded, the EP tube was removed from the magnetic separator, and the washing was repeated once.
Antibody coupling: and (3) carrying out magnetic separation on the magnetic bead suspension pretreated by the magnetic beads, adding 500 mu L of campylobacter jejuni antibody solution into an EP (EP) tube, and whirling for 30s to uniformly mix the magnetic bead suspension. The EP tube was vortexed for 15s, placed on a vertical mixer, and mixed for 2h at room temperature. Magnetic beads are enriched by a magnetic separation frame, and flow-through liquid is preserved.
Sealing the magnetic beads: add 1mL Blocking Buffer to the EP tube, vortex for 30s, place the EP tube in a magnetic separation rack, enrich for magnetic beads, discard the supernatant. The operation was repeated four times. Then 1mL of Blocking Buffer was added to the EP tube, vortexed for 30s, and the EP tube was placed in a vertical mixer and reacted for 2h at room temperature. The EP tube is placed in a magnetic separation frame, magnetic beads are enriched, and the supernatant is discarded. Add 1mL of ultrapure water to the EP tube, mix well, enrich the magnetic beads with a magnetic rack, discard the supernatant.
Determining the antigen capturing time of the immunomagnetic beads: mix 8X 103Adding the CFU/mL campylobacter jejuni solution into the coupled magnetic bead solution combined with the campylobacter jejuni specific antibody in the step 1.3, placing the solution in a horizontal shaking table at 100 revolutions per minute for incubation at room temperature, performing magnetic separation every 10 minutes, and then passing through a flat plateThe number of bacteria in the supernatant was counted.
As shown in FIG. 1, the ICB constructed in the present invention is shown in the same manner as 8X 103The upper limit of capture was reached after 20 minutes incubation of CFU/mL Campylobacter jejuni solution.
Test example 2 method for screening specific target genes and establishing LAMP amplification
Designing a primer: based on the published hipO Gene of Campylobacter jejuni (Gene ID: 905276), a specific primer set was designed based on the principle of primer design and the principle of LAMP amplification technique. The primer group comprises a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP and a reverse inner primer BIP; the sequence of the forward outer primer F3 is shown as SEQ ID NO. 3; the sequence of the reverse outer primer B3 is shown as SEQ ID NO. 4; the sequence of the forward inner primer FIP is shown as SEQ ID NO. 5; the sequence of the reverse inner primer BIP is shown as SEQ ID NO.6, and the specific nucleotide sequence is shown as table 1:
TABLE 1
LAMP amplification reaction:
extraction of DNA: extracting and recovering by using a small quantity extraction kit of bacterial genome DNA of Tiangen Biotechnology (Beijing) Co., Ltd, comprising the following steps:
firstly, 5mL of the bacterial culture solution is taken, centrifuged at 10,000rpm for 1 minute, and the supernatant is completely sucked as far as possible.
② adding 200 mu L buffer solution GA into the thallus sediment, and oscillating until the thallus is suspended completely.
③ adding 20 mu L of protease K solution into the tube, and mixing evenly.
Adding 220 microliter of buffer solution GB, shaking for 15 seconds, standing at 70 ℃ for 10 minutes, cleaning the solution, and centrifuging briefly to remove water beads on the inner wall of the tube cover.
Fifthly, 220 mu L of absolute ethyl alcohol is added, the mixture is fully shaken and evenly mixed for 15 seconds, at this time, flocculent precipitate can appear, and the mixture is centrifuged briefly to remove water drops on the inner wall of the tube cover.
Sixthly, adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed into a collecting pipe), centrifuging at 12,000rpm for 30 seconds, pouring off waste liquid, and placing an adsorption column CB3 into the collecting pipe.
Seventhly, 500 mu L of buffer GD is added into the adsorption column CB3, centrifugation is carried out at 12,000rpm for 30 seconds, waste liquid is poured out, and the adsorption column CB3 is placed into a collection tube.
Eighthly, 600 microliter of rinsing liquid PW is added into an adsorption column CB3, centrifugation is carried out at 12,000rpm for 30 seconds, waste liquid is poured out, and the adsorption column CB3 is placed into a collecting pipe.
Ninthly, repeating the operation step 8.
Adsorption column CB3 was returned to the collection tube and centrifuged at 12,000rpm for 2 minutes to discard the waste. The adsorption column CB3 was left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.
LAMP amplification system: the above-mentioned DNA was subjected to LAMP reaction. 10 μ L of the reagent system comprises: 1 μ L Isothermal Amplification Buffer II, 6mM Mg2+320U/mL Bst3.0DNA polymerase, 1.2mM dNTPs, 0.2. mu.M outer primer (F3/B3), 1.6. mu.M inner primer (FIP/BIP), 5. mu.L genomic DNA (gDNA), and enucleated enzyme water to 10. mu.L. Reaction conditions are as follows: amplifying at 65 ℃ for 30 min.
Test example 3 enzyme digestion method for establishing ICB-LAMP-CRISPR/Cas12a
Optimization of CRISPR/Cas12a detection system
6 sgRNA sequences and ssDNA probes for the hipO gene were designed, and the specific sequences are shown in table 1.
At 8X 10 with ICB Capture3DNA released by CFU/mL campylobacter jejuni is used as a template for LAMP amplification, and LAMP amplification reaction is carried out at the tube bottom. The LAMP reaction product of 10 mu L in total is used as an enzyme digestion substrate, and the sgRNA cleavage activity is screened by adopting a CRISPR/Cas12a reaction system of 20 mu L. In order to avoid aerosol propagation caused by uncapping operation after LAMP amplificationThe CRISPR/Cas12a reaction system is arranged in the cover of the PCR tube and comprises 166.67nM
Lba Cas12a, 1.83. mu.M sgRNA, 4U/. mu.L RNase inhibitor, 2. mu.L NEBuffer, 1.67. mu.M FAM-BHQ 1-labeled ssDNA probe, and DEPC water. After the 30min LAMP reaction was completed, the PCR reaction tube was mixed by inversion and digested at 37 ℃ for 10 min. The fluorescence signal is collected by a CFX96Touch Real-Time PCR detection system, and the visualization result is realized by a transmission light source with the excitation wavelength of 485 nm.
As shown in fig. 2, the sgRNA screening result of the CRISPR/Cas12a detection system shows that, in the present invention, there is almost no fluorescence generated in sgRNA1-3 and sgRNA5-6 fluorescence reaction, sgRNA4 generates fluorescence, and sgRNA4 can generate brighter fluorescence under the transmission light source with the excitation wavelength of 485nm, and sgRNA4 is used for detection in subsequent experiments.
In order to further shorten the detection Time, the CFX96Touch Real-Time PCR detection system is used for collecting the fluorescence generation process for Real-Time monitoring, and the fluorescence intensity at different Time points is photographed and recorded by a mobile phone.
As shown in FIG. 3, in the present invention, the fluorescence intensity increased with the increase of the incubation time and reached a maximum value around 30 min. According to the fluorescence intensity of different time points, the enzyme digestion result can be visually judged within 10 min.
Test example 4 sensitivity analysis of the detection method of the present invention
The campylobacter jejuni diluted by 10-fold gradient is enriched by immunocapture magnetic beads, DNA is released by heating after magnetic separation, LAMP-CRISPR/Cas12a detection is carried out, and the reaction system and the reaction procedure are as described above.
As shown in FIG. 4, the sensitivity detection result of the ICB-LAMP-CRISPR/Cas12a identification system shows that the sensitivity of the ICB-LAMP-CRISPR/Cas12a identification system in the invention is 8CFU/mL bacterial liquid.
Test example 5 analysis of specificity of the detection method of the present invention
The detection is carried out on campylobacter jejuni, campylobacter coli, escherichia coli, shigella, salmonella enteritidis, klebsiella pneumoniae and proteus mirabilis according to the optimal reaction condition of the LAMP reaction system and the optimal cleavage reaction condition of CRISPR/Cas12a, so as to verify the specificity of the detection on campylobacter jejuni.
As shown in FIG. 5, in the invention, the detection of the ICB-LAMP-CRISPR/Cas12a identification system shows that the fluorescence generated by the detection of campylobacter jejuni is positive, and the detection of campylobacter coli, escherichia coli, shigella, salmonella enteritidis, klebsiella pneumoniae and proteus mirabilis is negative and non-fluorescent.
Test example 6 detection of Chicken farm-derived isolate by the detection method of the present invention
31 identified campylobacter jejuni chicken farm-derived isolates were subjected to ICB enrichment of campylobacter jejuni, magnetic separation was performed, DNA was released by heating, and then the samples were tested using the LAMP-CRISPR/Cas12a of the present invention to verify the ability of ICB-LAMP-CRISPR/Cas12a to test campylobacter jejuni isolates.
As shown in FIG. 6, in the present invention, the ICB-LAMP-CRISPR/Cas12a identification system was verified in 31 identified Campylobacter jejuni chicken house-derived isolates. The ICB-LAMP-CRISPR/Cas12a detection method can be applied to the detection of Campylobacter jejuni in chicken farms, and the ICB-LAMP-CRISPR/Cas12a detection is more convenient and faster, has higher sensitivity and specificity, and can observe the detection result visually and macroscopically.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Sichuan university
<120> sgRNA, system, kit, detection method and application for detecting campylobacter jejuni gene
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaacacggag accacaagaa gcacaaag 28
<210> 2
<211> 6
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(6)
<223> ssDNA 5 '-end labeled FMA and 3' -end labeled BHQ1
<400> 2
<210> 3
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcattcttgt aaaggcaaag catttttgga aatagcgata aaaaaatagg ac 52
<210> 6
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgcatgcttg tggtcatgat gttttcgcca ttaaaattct gacttg 46
<210> 7
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gaacacggag acaagaagca caaagcca 28
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gaacacggag agcaaaggca aa 22
<210> 9
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gaacacggag acagcaagca aaaagaagag a 31
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gaacacggag aaaggcaaag gcacg 25
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gaacacggag acaaaggcaa aggca 25
Claims (10)
1. An sgRNA for specifically detecting campylobacter jejuni, characterized in that the nucleotide sequence of the sgRNA is shown in SEQ ID No. 1.
2. The sgRNA of claim 1, for use in detecting Campylobacter jejuni.
3. The use of the sgRNA of claim 1 in the preparation of a campylobacter jejuni detection product.
4. A CRISPR/Cas12a system for detecting Campylobacter jejuni, comprising the sgRNA of claim 1 and a Cas12a protein.
5. The CRISPR/Cas12a system for detecting Campylobacter jejuni according to claim 4, wherein the CRISPR/Cas12a system further comprises a ssDNA probe labeled with FAM at the 5 'end and BHQ1 at the 3' end.
6. The CRISPR/Cas12a system for detecting Campylobacter jejuni according to claim 5, wherein the nucleotide sequence of the ssDNA probe is shown in SEQ ID No. 2.
7. An isothermal amplification-CRISPR/Cas 12a system for detecting Campylobacter jejuni, which comprises the CRISPR/Cas12a system as claimed in claim 4 and an isothermal amplification system;
the primer group of the isothermal amplification system comprises a forward outer primer, a reverse outer primer, a forward inner primer and a reverse inner primer;
the nucleotide sequence of the forward outer primer is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse outer primer is shown as SEQ ID NO. 4; the nucleotide sequence of the forward inner primer is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse inner primer is shown as SEQ ID NO. 6.
8. A kit for detecting Campylobacter jejuni, comprising the isothermal amplification-CRISPR/Cas 12a system of claim 7 and immunocapture magnetic beads.
9. The kit for detecting campylobacter jejuni according to claim 8, wherein the immunocapture magnetic beads are modified with campylobacter jejuni antibodies.
10. A detection method based on the kit for detecting campylobacter jejuni according to claim 8 or 9, comprising the steps of:
capturing Campylobacter jejuni in a sample to be detected by using immunocapture magnetic beads, and cracking to obtain an amplification template DNA;
carrying out isothermal amplification reaction on the amplification template to obtain an amplification product;
adding the amplification product into the CRISPR/Cas12a system for enzyme digestion reaction to obtain a signal product; alignment of signal products was performed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111681762.9A CN114262707B (en) | 2021-12-30 | 2021-12-30 | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111681762.9A CN114262707B (en) | 2021-12-30 | 2021-12-30 | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114262707A true CN114262707A (en) | 2022-04-01 |
| CN114262707B CN114262707B (en) | 2023-04-28 |
Family
ID=80832970
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111681762.9A Active CN114262707B (en) | 2021-12-30 | 2021-12-30 | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114262707B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103409499A (en) * | 2013-04-08 | 2013-11-27 | 四川大学 | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella |
| CN106922154A (en) * | 2014-08-06 | 2017-07-04 | 基因工具股份有限公司 | The gene editing of the engineered nucleic acid enzyme guided using RNA derived from campylobacter jejuni CRISPR/CAS systems |
| US20180305773A1 (en) * | 2017-04-12 | 2018-10-25 | The Broad Institute, Inc. | Crispr effector system based diagnostics for malaria detection |
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| WO2021243276A1 (en) * | 2020-05-29 | 2021-12-02 | University Of Florida Research Foundation | Crispr/cas chain reaction systems and methods for amplifying the detection sensitivity of crispr-based target detection |
| WO2021240443A1 (en) * | 2020-05-27 | 2021-12-02 | King Abdullah University Of Science And Technology | Iscan: an rt-lamp-coupled crispr-cas module for rapid, sensitive detection of sars-cov-2 |
| CN113999921A (en) * | 2021-11-23 | 2022-02-01 | 中国医学科学院输血研究所 | Method and kit for rapidly and visually detecting Shigella flexneri |
-
2021
- 2021-12-30 CN CN202111681762.9A patent/CN114262707B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103409499A (en) * | 2013-04-08 | 2013-11-27 | 四川大学 | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella |
| CN106922154A (en) * | 2014-08-06 | 2017-07-04 | 基因工具股份有限公司 | The gene editing of the engineered nucleic acid enzyme guided using RNA derived from campylobacter jejuni CRISPR/CAS systems |
| US20180305773A1 (en) * | 2017-04-12 | 2018-10-25 | The Broad Institute, Inc. | Crispr effector system based diagnostics for malaria detection |
| WO2021240443A1 (en) * | 2020-05-27 | 2021-12-02 | King Abdullah University Of Science And Technology | Iscan: an rt-lamp-coupled crispr-cas module for rapid, sensitive detection of sars-cov-2 |
| WO2021243276A1 (en) * | 2020-05-29 | 2021-12-02 | University Of Florida Research Foundation | Crispr/cas chain reaction systems and methods for amplifying the detection sensitivity of crispr-based target detection |
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| CN113999921A (en) * | 2021-11-23 | 2022-02-01 | 中国医学科学院输血研究所 | Method and kit for rapidly and visually detecting Shigella flexneri |
Non-Patent Citations (6)
Also Published As
| Publication number | Publication date |
|---|---|
| CN114262707B (en) | 2023-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Macé et al. | Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks | |
| CA2779197C (en) | Method of removing polymerase chain reaction (pcr) inhibitors from a sample using .beta.-cyclodextrin and activated charcoal coated with bentonite | |
| CN112538544A (en) | Detection method and application of food-borne pathogenic bacteria standard strain viable bacteria with specific molecular targets | |
| Bavisetty et al. | Rapid pathogen detection tools in seafood safety | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| WO2019173838A1 (en) | Methods for detecting microorganisms using microorganism detection protein and other applications of cell binding components | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN105671210A (en) | LAMP technology-based primer, kit and detection method for detecting Plum pox virus | |
| CN113999921B (en) | Method and kit for rapidly and visually detecting shigella flexneri | |
| El Baaboua et al. | A review of current knowledge and gaps about campylobacter methods: from culture to characterization | |
| CN104212885B (en) | The LAMP kit of vibrio cholera in a kind of aquatic products | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| CN114262707A (en) | sgRNA, CRISPR/Cas12a system, kit, detection method and application for detecting campylobacter jejuni gene | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN106755550B (en) | PCR detection method for vibrio alginolyticus in aquaculture animal | |
| CN113817854A (en) | Method for visually detecting salmonella gene by using single-labeled ssDNA probe | |
| CN112941212A (en) | Universal primer group, kit and method for on-site detection of brucella | |
| Cao et al. | Rapid detection of Vibrio metschnikovii in aquatic products by real-time PCR | |
| JP5006607B2 (en) | Method for avoiding inhibition in nucleic acid amplification reaction | |
| Kretzer et al. | Sample preparation–an essential prerequisite for high-quality bacteria detection | |
| CN101824483B (en) | Detection kit for vibrio cholerae O139 group and detection method thereof | |
| CN105986029B (en) | Liquid chip method for identifying pig source food source bacteria | |
| JP5134071B2 (en) | Method for avoiding inhibition in nucleic acid amplification reaction | |
| JP4674073B2 (en) | Method for avoiding inhibition in nucleic acid amplification reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |