CN104212885B - The LAMP kit of vibrio cholera in a kind of aquatic products - Google Patents
The LAMP kit of vibrio cholera in a kind of aquatic products Download PDFInfo
- Publication number
- CN104212885B CN104212885B CN201410292452.1A CN201410292452A CN104212885B CN 104212885 B CN104212885 B CN 104212885B CN 201410292452 A CN201410292452 A CN 201410292452A CN 104212885 B CN104212885 B CN 104212885B
- Authority
- CN
- China
- Prior art keywords
- primer
- vibrio cholera
- sequence
- lamp
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the LAMP test kit of vibrio cholera in a kind of aquatic products, including following reagent component: reaction buffer, the detection specific primer of vibrio cholera, Bst archaeal dna polymerase, vibrio cholera DNA positive template and ultra-pure water；The specific primer of described detection vibrio cholera includes a pair inner primer FIP and BIP and a pair outer primer F3 and B3。The present invention has high specificity, and sensitivity is high, and simple and rapid feature can be used for basic unit and detects vibrio cholera in real time, fast and accurately。
Description
Technical field
The present invention relates to aquatic product bio detection technique field, particularly to the LAMP kit of vibrio cholera in a kind of aquatic products。
Background technology
Cholera is by vibrio cholera (Vibriocholera, VC) severe intestinal caused passes disease, this disease onset is anxious, it is fast to propagate, coverage is wide, belong to international quarantine infectious disease, it is listed in one of category A infectious disease in China, it is one of main food-borne pathogenic microorganism, threatens the mankind constantly and bring harm to the mankind。At present, this bacterium is most to import and export one of pathogenic bacterium that aquatic products must examine。
In detection food, the method main (SN/T1022-2010) in the conventional way of pathogenic microorganism is main at present, i.e. isolation and identification method, the method required time is long, generally need 5-7 days, sometimes up to 10-15 days,, also easily there is missing inspection, be difficult to meet the needs of Rapid identification in not only length consuming time。There is the multiple method report of detection vibrio cholera in recent years, such as elisa (ELISA), SABC, PCR method etc., but normal PCR detection needs to extend through degeneration annealing, adds that the whole process of DNA extraction probably needs just can obtain a result for 2-4 hour。These methods have defect on cost, sensitivity, operation convenience, limit they practical applications aborning to a certain extent。Compared with other molecular biology for detection, LAMP, as a kind of new nucleic acid amplification technologies, has that experiment condition is low, highly sensitive and the advantage such as high specificity, is subject to favor popularization and application in the detection of microorganism。What be applied to vibrio cholera at present has 3 patents, Chinese invention patent application if application number is 200910107466.0 is open " loop-mediated isothermal amplification technique LAMP detects vibrio cholera mdh gene and detection kit thereof " (Authorization Notice No. CN101892293A), application number is open " the vibrio cholera detection primer of Chinese invention patent application of 200710030446.9, detection method, detection kit " (Authorization Notice No.: CN101153332B), application number is the Chinese invention patent application open " LAMP detection kit of vibrio cholera and detection method thereof " (Authorization Notice No. CN103160606A) of 201310119610.9。But the LAMP method detection adopted adds dyestuff ability judged result or adopts the development of agarose gel electrophoresis ultraviolet analysis after needing 1 hour, there is the Aerosol Pollution caused and to deficiencies such as reaction lack monitor in real time of uncapping in this, it is impossible to testing result is made and judges accurately。
Summary of the invention
It is an object of the invention to provide the LAMP kit of vibrio cholera in a kind of aquatic products, have high specificity, sensitivity is high, and simple and rapid feature can be used for basic unit and detects vibrio cholera in real time, fast and accurately。
The technical solution adopted for the present invention to solve the technical problems is:
The LAMP kit of vibrio cholera in a kind of aquatic products, including following reagent component: reaction buffer, the detection specific primer of vibrio cholera, BstDNA polymerase, vibrio cholera DNA positive template and ultra-pure water；The specific primer of described detection vibrio cholera includes a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence (SEQIDNo.1) of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence (SEQIDNo.2) of inner primer BIP is:
5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence (SEQIDNo.3) of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence (SEQIDNo.4) of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
The present invention adopts ring mediated isothermal amplification (LAMP) technology, and devises two pairs of specific primers (inner primer FIP and BIP, outer primer F3 and B3) for vibrio cholera vcc gene order, thus develops the LAMP kit of detection vibrio cholera。The specific primer of the detection vibrio cholera of the present invention is for the detection high specificity of vibrio cholera, highly sensitive。
The available LAMP of LAMP kit provided by the invention implements transmissometer and vibrio cholera LAMP reaction primer, reaction system and reaction process is carried out airtight monitoring analysis real-time, quantitative, omnidistance, achieve LAMP primer efficient, specific amplification vibrio cholera, establish the LAMP method of visual vibrio cholera, it can only carry out the specific amplification of nucleic acid from vibrio cholera positive sample, not with other common pathogenic bacterium generation nonspecific reactions。The application present invention only can need to detect vibrio cholera by the system application of sample set up in real time, obtains testing result fast and accurately, offers convenience for simply and quickly detecting vibrio cholera。
As preferably, the reagent component of described LAMP kit also includes the visual test agent of fluorescence, and the visual test agent of described fluorescence is calcein。LAMP kit adds the visual test agent of fluorescence can realize Visual retrieval。
As preferably, the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the inner primer BIP1 μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of outer primer B31 μ L, the 8U/ μ L of outer primer F31 μ L, the 20pmol/ μ L of 20pmol/ μ L, sample DNA or vibrio cholera DNA positive template 2 μ L, ultra-pure water complements to 25 μ L。
As preferably, the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the outer primer B31 μ L of outer primer F31 μ L, the 20pmol/ μ L of inner primer BIP1 μ L, the 20pmol/ μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of 8U/ μ L, calcein 1 μ L, sample DNA or vibrio cholera DNA positive template 2 μ L, ultra-pure water complements to 25 μ L。Sample DNA during detection sample, positive control vibrio cholera DNA positive template。
As preferably, described reaction buffer comprises following components: the Tris-HCl20mmol/L of pH8.8, potassium chloride 10mmol/L, magnesium sulfate 8mmol/L, ammonium sulfate 10mmol/L, glycine betaine 0.8mol/L, dNTPs1.4mmol/L, tween 20 0.1%。
A kind of detect the specific primer of vibrio cholera in aquatic products, including a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence (SEQIDNo.1) of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence (SEQIDNo.2) of inner primer BIP is:
5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence (SEQIDNo.3) of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence (SEQIDNo.4) of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
The invention has the beneficial effects as follows:
1, high specificity: all no positive result of negative control bacterial strain detected is out, consistent with PCR testing result。
2, highly sensitive: lowest detection is limited to 22cfu/mL。
3, obtain a result rapidly: the whole process of regular-PCR just can be obtained a result at 2-4 hours, and general LAMP method also wants 1 hour, and the present invention only needs 30 minutes to 50 minutes。
4, Visual retrieval, does not pollute: the fluorescent dye for observing is addition before reaction, and the commercial dyes calcein of addition realizes Visual retrieval, and without uncapping in detection process。
5, product can be detected in real time: utilize real-time transmissometer can analyze the result of LAMP reaction in real time, reach monitoring in real time and judge the purpose of product。
Accompanying drawing explanation
Fig. 1 is the specific detection result of LAMP kit of the present invention, and wherein Fig. 1 a is block diagram, Fig. 1 b is amplification curve diagram。
Fig. 1 a abscissa 1-8 is respectively as follows: vibrio cholera 1, vibrio parahaemolytious 2, colon bacillus 3, staphylococcus aureus 4, Vibrio vulnificus 5, vibrio mimicus 6, vibrio alginolyticus 7, vibrio fluvialis 8。
Fig. 2 is the sensitivity Detection result of LAMP kit of the present invention, and wherein Fig. 2 a is block diagram, Fig. 2 b is amplification curve diagram。
Fig. 2 a abscissa 2-8 is different vibrio cholera concentration respectively: 2.2 × 105Cfu/mL(post 2), 2.2 × 104Cfu/mL(post 3), 2.2 × 103Cfu/mL(post 4), 2.2 × 102Cfu/mL(post 5), 2.2 × 101Cfu/mL(post 6), 2.2 × 100Cfu/mL(post 7), 2.2 × 10-1Cfu/mL(post 8)。
The post 2-post 6 of 5 S shape amplification curve from left to right corresponding diagram 1a of Fig. 2 b。
Fig. 3 is the fluorescent visual testing result of LAMP kit of the present invention, in figure: left pipe is vibrio cholera is template, and right pipe is negative control (or blank)。
Detailed description of the invention
Below by specific embodiment, and in conjunction with accompanying drawing, technical scheme is described in further detail。
In the present invention, if not refering in particular to, the raw material adopted and equipment etc. all can be buied from market or commonly used in the art。Method in following embodiment, if no special instructions, is the conventional method of this area。
1, vibrio cholera (vibrio cholera VBO, purchased from Huankai Microbes Tech Co., Ltd., Guangdong)。
Negative control bacterium is all purchased from Chinese industrial Culture Collection:
Vibrio parahaemolytious (ATCC17802), colon bacillus (ATCC25922), staphylococcus aureus (ATCC6538), Vibrio vulnificus (ATCC27562), vibrio mimicus (CICC10474), vibrio alginolyticus (ATCC17749), vibrio fluvialis (ATCC33809)。
2, main agents and instrument: nutrient broth is purchased from Beijing Luqiao Technology Co., Ltd.；Bacterial genomes DNA extraction agent box is purchased from invitrogen company；Real-time transmissometer (LA-320C) is Japan's Rong Yan chemical products。
3, design of primers, synthesis: primer, according to vibrio cholera vcc gene order (NCBI), utilizes PrimerExplorerV4 software (Japan Rong Yan Co., Ltd.) design, Shanghai Sangon Biological Engineering Technology And Service Co., Ltd synthesizes。
The sequence (SEQIDNo.1) of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence (SEQIDNo.2) of inner primer BIP is:
5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence (SEQIDNo.3) of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence (SEQIDNo.4) of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
4, the extraction of sample DNA:
Sample treatment: water intaking product class sample 25g and 225mL basic peptone water (compound method: peptone 20g, sodium chloride 20g, distilled water 1000mL, pH value is reconciled to 8.6 ± 0.2(25 DEG C) after mixing, 121 DEG C of sterilizing 15min) mix with beater, make rearmounted 36 ± 1 DEG C of mixed liquor and cultivate 8-18h。Obtain enrichment liquid。
DNA extraction: taking the centrifugal 3min of above-mentioned enrichment liquid 1mL, 12000rpm, abandon supernatant, the genomic DNA that gained precipitation extracts sample according to the description of bacterial genomes DNA extraction agent box obtains sample DNA。
5, detection in real time: adopt the reagent constituents of the present invention to be made into LAMP detection system, the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the interior BIP1 μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of outer primer B31 μ L, the 8U/ μ L of outer primer F31 μ L, the 20pmol/ μ L of 20pmol/ μ L, sample DNA 2 μ L, ultra-pure water complements to 25 μ L。
65 DEG C of amplified reactions, LAMP reaction carries out airtight complete monitoring at real-time transmissometer (LA-320C, Rong Yan company of Japan), and transmissometer monitors amplification situation in real time。
6, test kit specific detection:Adopt the method for step 5 respectively to vibrio cholera, and negative control: vibrio parahaemolytious, colon bacillus, staphylococcus aureus, Vibrio vulnificus, vibrio mimicus, vibrio alginolyticus, vibrio fluvialis detect, observed result, the specificity of the method for inspection is changed according to turbidity。
As Fig. 1 result shows, amplification occur about 30min vibrio cholera, turbidity substantially rises (Fig. 1 b), and LAMP testing result is positive；All there is not amplification in all the other 7 strain bacterial strains, and LAMP testing result is negative。
Vibrio cholera (positive group) occurs in that blue column amplified band (Fig. 1 a), and makes module be changed into redness by blueness, and S type amplification curve (Fig. 1 b) occurs；There is not blue column amplified band (Fig. 1 a) in negative control group, and module is still shown as blue, amplification curve (Fig. 1 b) does not occur。
7, test kit sensitivity technique:Take 10 times of gradient dilutions of 1mL pure culture bacterium solution (vibrio cholera being seeded to nutrient broth, cultivate 18-24h for 36 DEG C ± 1 DEG C) to 10-1, and carrying out count of bacteria, original bacterial concentration is 2.2 × 107Cfu/mL, extracts cholera vibrio gene group DNA by the method for step 4, carries out LAMP amplification by the method for step 5, analyze its sensitivity。
Result display (see figure 2), 2.2 × 105cfu/mL~2.2×10-1After the bacterium solution amplification of cfu/mL gradient dilution, Haze curve occurs, it was shown that positive in LAMP；2.2cfu/mL, 2.2 × 10-1There is not amplification in cfu/mL concentration level dilution bacterium solution, negative in LAMP。The above results shows that lowest detection is limited to 22cfu/mL。
8, fluorescent visual detection:The reagent constituents adopting the present invention is made into LAMP detection system, the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the outer primer B31 μ L of outer primer F31 μ L, the 20pmol/ μ L of inner primer BIP1 μ L, the 20pmol/ μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of 8U/ μ L, calcein 1 μ L, vibrio cholera DNA positive template 2 μ L, ultra-pure water complements to 25 μ L。
After reacting 60min at 65 DEG C, under uviol lamp, observe color。
The response situation that the left pipe of Fig. 3 is is template with vibrio cholera, right pipe is negative control (or blank), left pipe (positive group) occurs in that green fluorescence, right pipe (blank group or negative control group) is still light orange fluorescence, it was shown that the test kit of the present invention can facilitate basic unit to use, after adding sample, with cheap water-bath operation, get final product rapid examination result, and without uncapping, it is to avoid pollute。
9, aquatic products sample actually detected:Utilize the test kit detection marine product 50 parts of the present invention, including shellfish 10 parts, shrimps 20 parts and Fish 20 class (tested marine product sample is verified according to industry standard SN/T1022-2010), 3 parts of detection vibrio cholera in 50 parts of products, testing result is consistent with SN/T1022-2010 cultural method testing result。Verify the dependable with function of test kit of the present invention。
The LAMP kit (in real time detection) of vibrio cholera in the aquatic products of the present invention, including following reagent component: reaction buffer, the detection specific primer of vibrio cholera, BstDNA polymerase, vibrio cholera DNA positive template and ultra-pure water；The specific primer of described detection vibrio cholera includes a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence of inner primer BIP is: 5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
The LAMP kit (fluorescent visual detection) of vibrio cholera in the aquatic products of the present invention, including following reagent component: reaction buffer, the detection specific primer of vibrio cholera, BstDNA polymerase, vibrio cholera DNA positive template, ultra-pure water and calcein；The specific primer of described detection vibrio cholera includes a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence of inner primer BIP is: 5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
Embodiment described above is the one preferably scheme of the present invention, not the present invention is done any pro forma restriction, also has other variant and remodeling under the premise without departing from the technical scheme described in claim。
Sequence table
<110>complex art service centre of Zhoushan Entry-Exit Inspection and Quarantine Bureau
<120>LAMP kit of vibrio cholera in a kind of aquatic products
<130>2014.06
<160>4
<170>PatentInversion3.3
<210>1
<211>42
<212>DNA
<213>artificial sequence
<400>1
aacaagcttgtgtagccacggctacaagatttacagcccgcg42
<210>2
<211>40
<212>DNA
<213>artificial sequence
<400>2
ggttttacgcaccaacggcaaagcatcgagcacagtttgt40
<210>3
<211>20
<212>DNA
<213>artificial sequence
<400>3
ttcacaagcagcttgtgaga20
<210>4
<211>20
<212>DNA
<213>artificial sequence
<400>4
cgcttcaccagtatagcgag20
Claims (5)
1. the LAMP kit of vibrio cholera in aquatic products, it is characterised in that include following reagent component: reaction buffer, the detection specific primer of vibrio cholera, BstDNA polymerase, vibrio cholera DNA positive template and ultra-pure water；The specific primer of described detection vibrio cholera includes a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence of inner primer BIP is: 5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '；
Described reaction buffer comprises following components: the Tris-HCl20mmol/L of pH8.8, potassium chloride 10mmol/L, magnesium sulfate 8mmol/L, ammonium sulfate 10mmol/L, glycine betaine 0.8mol/L, dNTPs1.4mmol/L, tween 20 0.1%。
2. LAMP kit according to claim 1, it is characterised in that: the reagent component of described LAMP kit also includes the visual test agent of fluorescence, and the visual test agent of described fluorescence is calcein。
3. LAMP kit according to claim 1, it is characterized in that: the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the inner primer BIP1 μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of outer primer B31 μ L, the 8U/ μ L of outer primer F31 μ L, the 20pmol/ μ L of 20pmol/ μ L, sample DNA or vibrio cholera DNA positive template 2 μ L, ultra-pure water complements to 25 μ L。
4. LAMP kit according to claim 2, it is characterized in that: the concrete configuration of the LAMP detection system of 25 μ L is: reaction buffer 16 μ L, the inner primer FIP1 μ L of 40pmol/ μ L, the outer primer B31 μ L of outer primer F31 μ L, the 20pmol/ μ L of inner primer BIP1 μ L, the 20pmol/ μ L of 40pmol/ μ L, the BstDNA polymerase 1 μ L of 8U/ μ L, calcein 1 μ L, sample DNA or vibrio cholera DNA positive template 2 μ L, ultra-pure water complements to 25 μ L。
5. one kind is detected the specific primer of vibrio cholera in aquatic products, it is characterised in that include a pair inner primer FIP and BIP and a pair outer primer F3 and B3；
The sequence of inner primer FIP is:
5 '-AACAAGCTTGTGTAGCCACGGCTACAAGATTTACAGCCCGCG-3 '；
The sequence of inner primer BIP is: 5 '-GGTTTTACGCACCAACGGCAAAGCATCGAGCACAGTTTGT-3 '；
The sequence of outer primer F3 is: 5 '-TTCACAAGCAGCTTGTGAGA-3 '；
The sequence of outer primer B3 is: 5 '-CGCTTCACCAGTATAGCGAG-3 '。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410292452.1A CN104212885B (en) | 2014-06-26 | 2014-06-26 | The LAMP kit of vibrio cholera in a kind of aquatic products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410292452.1A CN104212885B (en) | 2014-06-26 | 2014-06-26 | The LAMP kit of vibrio cholera in a kind of aquatic products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104212885A CN104212885A (en) | 2014-12-17 |
| CN104212885B true CN104212885B (en) | 2016-06-22 |
Family
ID=52094788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410292452.1A Active CN104212885B (en) | 2014-06-26 | 2014-06-26 | The LAMP kit of vibrio cholera in a kind of aquatic products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104212885B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964787B (en) * | 2015-09-02 | 2022-08-26 | 上海旺旺食品集团有限公司 | Rapid constant-temperature detection method and kit for cronobacter sakazakii |
| CN105969853B (en) * | 2016-05-12 | 2020-01-21 | 中国科学院微生物研究所 | Composition for rapidly detecting aquatic pathogenic bacteria and preparation method thereof |
| CN106222274B (en) * | 2016-08-05 | 2020-01-31 | 集美大学 | quick detection method for hollisgilettia |
| CN106636381A (en) * | 2016-12-07 | 2017-05-10 | 广西壮族自治区兽医研究所 | Loop-mediated isothermal amplification kit of vibrio cholerae and application of loop-mediated isothermal amplification kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160606A (en) * | 2013-04-08 | 2013-06-19 | 北京出入境检验检疫局检验检疫技术中心 | LAMP (loop-mediated isothermal amplification) detection kit of vibrio cholerae and detection method thereof |
-
2014
- 2014-06-26 CN CN201410292452.1A patent/CN104212885B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160606A (en) * | 2013-04-08 | 2013-06-19 | 北京出入境检验检疫局检验检疫技术中心 | LAMP (loop-mediated isothermal amplification) detection kit of vibrio cholerae and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Loop mediated isothermal amplication(LAMP) of genes sequence and simple visual detection of products;Tomita N et al;《Nat Protoc》;20081231;第3卷(第5期);摘要 * |
| 泥鳅病原霍乱弧菌PCR与LAMP检测方法的比较研究;张晓君等;《海洋与沼泽》;20130130;第44卷(第1期);摘要、第210页右栏-211页左栏,212页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104212885A (en) | 2014-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020048B (en) | Rapid constant-temperature detection method, primer group and kit for shigella | |
| CN104212885B (en) | The LAMP kit of vibrio cholera in a kind of aquatic products | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| CN111073986B (en) | Rapid constant-temperature detection method for salmonella, primer group and application | |
| CN104513857A (en) | Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus | |
| CN114540516B (en) | LAMP double-strand detection probe, kit and detection method for staphylococcus aureus | |
| CN111004854B (en) | Rapid constant temperature detection method, primer set and kit for vibrio vulnificus and vibrio cholerae simultaneously | |
| CN111073985B (en) | Rapid constant-temperature detection method, primer group and kit for salmonella | |
| CN111088377B (en) | Rapid constant temperature detection method for staphylococcus aureus, primer set and application | |
| CN110229915A (en) | A kind of staphylococcus aureus detection of nucleic acids primer sets and its detection method | |
| CN114262707B (en) | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application | |
| CN104894284A (en) | Primer, reagent box and method for detecting staphylococcus aureus and mecA | |
| CN104988219A (en) | Primers, reagent box and method used for detecting staphylococcus aureus and blaz | |
| Bi et al. | Rapid and Sensitive Detection of Vibrio natriegens in Portunus trituberculatus with the Loop-Mediated Isothermal Amplification Test |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 316000 222 Changguo Road, Dinghai, Zhoushan, Zhejiang Patentee after: Zhoushan customs comprehensive technical service center Address before: 316000 222 Changguo Road, Dinghai, Zhoushan, Zhejiang Patentee before: COMPREHENSIVE TECHNOLOGY SERVICE CENTER OF ZHOUSHAN ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU |
|
| CP01 | Change in the name or title of a patent holder |