CN104894284A - Primer, reagent box and method for detecting staphylococcus aureus and mecA - Google Patents
Primer, reagent box and method for detecting staphylococcus aureus and mecA Download PDFInfo
- Publication number
- CN104894284A CN104894284A CN201510363950.5A CN201510363950A CN104894284A CN 104894284 A CN104894284 A CN 104894284A CN 201510363950 A CN201510363950 A CN 201510363950A CN 104894284 A CN104894284 A CN 104894284A
- Authority
- CN
- China
- Prior art keywords
- primer
- meca
- streptococcus aureus
- detect
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.
Description
Technical field
The present invention relates to the primer of a kind of detection streptococcus aureus and gene mecA; The invention still further relates to a kind of double fluorescent PCR detection kit for detecting streptococcus aureus and the new woods gene mecA of resistance to methoxy comprising above-mentioned primer, the invention still further relates to a kind of method adopting mentioned reagent box to detect streptococcus aureus and the new woods gene mecA of resistance to methoxy.
Background technology
Staphylococcus is the one in gram-positive cocci, is distributed widely in nature, as in air, water, feed and some food, is also present in the body surface of humans and animals, pharynx nasalis and enteron aisle.Pathogenic staphylococcus often causes various suppurative illness, septicemia or pyaemia septica, when contaminated food products, can cause food poisoning.Within 1974, Staphylococcus is divided into three kinds: streptococcus aureus, staphylococcus epidermidis, Staphylococcus saprophyticus pin.Wherein streptococcus aureus staphylococcus.aureus virulence is the strongest, also most important.Streptococcus aureus is except often causing the suppurative inflammation of skin, tissue and organ, and its enterotoxin produced can be infected with food and cause food poisoning.
Due to antibiotic use, bacterium also constantly makes a variation in order to self-growth, just defines the resistance of bacteria medicine, original effective antibacterials curative effect when running into the microbial infection of resistance is declined even completely invalid.Streptococcus aureus remains one of modal bacterium of domestic and foreign hospitals Acquired Infection so far.Along with β-Nei phthalein amine microbiotic is in clinical widespread use, methicillin-resistant staphylococcus aureus MRSA ratio in the staphylococcus of clinical separation constantly increases, and MRSA is almost to all β-Nei phthalein amine microbiotic resistances.1996, there is again the first MRSA that vancomycin sensitive is declined.Once to drug resistance of vancomycin, clinical can drug of choice thing will be very limited, thus cause the difficulty in treatment.Study reliable detection method, accurately, timely detect it, for controlling, sending out of resistant organism is very important.
The goal gene that the present invention selects is L-glutamic acid Fe3+ reduction synthetic enzyme glutamate synthase-ferredoxin large subunit, gltB, sequence homology is relatively conservative, can streptococcus aureus and other food-borne pathogens be distinguished preferably.Also be the target gene detecting streptococcus aureus in 1870-2007 " in food pathogenic microbes detect method real-time PCR methodology ".
The another one goal gene that the present invention selects is mecA gene, this negative gene duty Renicillin binding protein 2a (PBP2a), it reduces beta-lactam antibiotics avidity, and PBP2a and intrinsic PBP2 acting in conjunction, although make bacterium also can synthetic cell wall in the environment of beta-lactam antibiotics, make bacterium to penicillin, cynnematin and carbapenem antibiotic resistance.MecA gene is positioned at Staphylococcal chromosome cassette mec staphylococcal cassette chromosome mec to be called for short in the peculiar fragment of SCC mec side DNA.SCC mec is a removable genomic islands genomic islands carrying mec gene complex, GI, methicillin resistance and other antibiotic resistance genes constantly accumulate at this, form resistance island resistance island, RI, causes MRSA to the dual resistance of microbiotic.
Although conventional bacteria resistance method can meet clinical part needs, still there are some shortcomings in these methods, and such as detection time, longer and detected result was not accurate enough etc.Therefore, a series of quick bacteria qualification or molecular detection technology along with the application development in recent years of Protocols in Molecular Biology in Clinical Laboratory field, the feature of these class methods is quick and accurate, within several hours, generally just can obtain detected result, substantially reduce detection time.For streptococcus aureus and mecA genes involved, researchist has carried out Standard PCR and fluorescence PCR method research, but conventional PCR method carries out electrophoresis after needing pcr amplification, not only complex operation, and easily cause pollution, also need the fluorochrome using possibility carcinogenic, and although probe method fluorescence PCR method is sensitive and accurate, but its testing cost is higher, and reagent validity period is short, is easy to degraded.
Summary of the invention
The object of the invention is, in order to overcome weak point of the prior art, to provide a kind of primer for detecting streptococcus aureus and mecA;
Another object of the present invention is to provide one and comprises above-mentioned primer and component and reasonable ratio, easy to use, detects quick, accurately, is applicable to the test kit that double fluorescent PCR detects streptococcus aureus and the new woods gene mecA of resistance to methoxy;
Another object of the present invention is to provide a kind of method adopting mentioned reagent box to detect streptococcus aureus and mecA gene, and the method is easy and simple to handle, quick, and cost is low, and detected result is accurate.
In order to achieve the above object, the present invention adopts following scheme:
Detect a primer of streptococcus aureus and mecA, it is characterized in that the sequence of this primer is respectively:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Detect a test kit of streptococcus aureus and mecA, it is characterized in that in this test kit, 20 μ L reaction systems comprise following component:
The sequence of wherein said upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
The sequence of described downstream primer gltBR: GGATAATGAAGGGAAACC
The sequence of described upstream primer mecAF: GTTGTAGTTGTCGGGTTT
The sequence of described downstream primer mecAR: TTTATCGGACGTTCAGTC.
A kind of test kit detecting streptococcus aureus and mecA as above, is characterized in that in this test kit, 20 μ L reaction systems comprise following component:
Detect a method of streptococcus aureus and mecA, it is characterized in that comprising the following steps:
A, extraction sample DNA;
B, test kit as above is utilized to carry out pcr amplification to the sample DNA in steps A;
After C, amplification, high resolving power melting curve analysis is carried out to product, and in conjunction with amplification curve result of determination.
The method of detection streptococcus aureus described above and mecA, is characterized in that the response procedures of pcr amplification in step B carries out according to the following steps:
(1) 92 DEG C ~ 96 DEG C denaturation 30s;
(2) 92 DEG C ~ 95 DEG C sex change 10s ~ 30s, 54 DEG C ~ 64 DEG C annealing 10s ~ 30s, 72 DEG C of 10s ~ 30s, carry out 35 ~ 45 circulations altogether;
(3) 72 DEG C extend 10s ~ 30s.
The method of detection streptococcus aureus described above and mecA, is characterized in that the melting curve analysis of high resolving power described in step C, carries out according to the following steps:
(1) 92 DEG C ~ 96 DEG C sex change 1min;
(2) 40 DEG C of renaturation 1min;
(3) then initial melting temperature (Tm) 60 DEG C ~ 65 DEG C, start program heats up and melts to 90 DEG C ~ 95 DEG C, and in fusion processes, detects fluorescent signal in real time, 15 ~ 25 times/second.
The method of detection streptococcus aureus described above and mecA, is characterized in that the concrete steps extracting sample DNA described in steps A are as follows:
Get the centrifugal 2min of 1.5mL culture 10000rpm; Throw out adds the TE damping fluid of 500 μ L, and piping and druming makes it Eddy diffusion, the centrifugal 3min of 8000r/min repeatedly, remove most supernatant, the lysozyme soln of the 50mg/mL of 200 μ l, the Proteinase K of 30 μ L 10%SDS and 15 μ L is added, after vortex mixing, in 37 DEG C of incubation 1h in precipitation; Add the 5mol/L NaCl of 100 μ L, fully mix, then add 80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing; Add isopyknic phenol/chloroform/primary isoamyl alcohol mixing, centrifugal 4-5min, proceeds to supernatant in a new pipe, adds the Virahol of 0.8 times of volume, and mixing is until DNA precipitates gently; After 70% washing with alcohol of precipitation 1mL, add TE solubilize precipitation.
The preparation of Plays product template of the present invention:
With conventional PCR method amplification drug resistant gene goal gene.PCR primer is through 1% gel electrophoresis analysis, adopt PCR primer to reclaim test kit to reclaim PCR primer, PCR primer after purifying is connected with carrier pMD18-T, to connect product conversion to competent cell, screening obtains single bacterium colony, and picking individual colonies is to containing antibiotic liquid nutrient medium, incubated overnight, extract plasmid, with the recombinant plasmid dna extracted for template carries out PCR qualification, and order-checking qualification is carried out to recombinant plasmid.Extract the positive recombinant plasmid that checking is correct, and measure its concentration, by its 10 times of doubling dilutions.
Sensitivity and Specificity test in the present invention:
Adopt the method such as order-checking to carry out sequence verification to positive amplification product, result positive amplification Product Sequence carries out Blast when comparing, sequence all with Genbank aim sequence very high homology.The positive plasmid template DNA that 10 times are diluted is added previous reaction system, carries out sensitivity experiments.The each drug resistant gene detection sensitivity of result all lower than 0.1pg, and has fine repeatability.In good linear relationship between each drug resistant gene dilution template concentrations and Cp value, R
2all be greater than 0.95, illustrate that the method has good tolerance range and satisfactory stability.
The present invention compared with prior art, has the following advantages:
1) reagent constituents of the present invention and reasonable ratio, easy to use, detects quick, accurately, is applicable to fluorescent PCR and detects streptococcus aureus and mecA gene;
2) detection method simplifies testing process, substantially reduces sense cycle, and detection time shortens about two days than traditional culture assays method;
3) the whole process of detection method, PCR primer, without the need to proceeding to other analytical equipment again, realizes stopped pipe operation, avoids crossed contamination, and can complete quantitative analysis simultaneously.
4) adopt detection method to detect streptococcus aureus and mecA gene, easy and simple to handle, quick, cost is low, and detected result is accurate.
Accompanying drawing explanation
Fig. 1 is the amplification curve diagram only having gene mecA to detect;
Fig. 2 be only have gene mecA to detect HRM analysis chart;
Fig. 3 is the amplification curve diagram only having streptococcus aureus gltB gene to detect;
Fig. 4 is the HRM analysis chart only having streptococcus aureus gltB gene to detect;
Fig. 5 is the amplification curve diagram that gltB gene and mecA gene detect simultaneously;
Fig. 6 is the HRM analysis chart that gltB gene and mecA gene detect simultaneously;
Embodiment
Below in conjunction with embodiment, the present invention is described further:
Embodiment 1
Double fluorescent PCR of the present invention detects the primer of streptococcus aureus gltB gene and gene mecA, comprising:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 2
A kind of test kit detecting streptococcus aureus and mecA of the present invention, wherein in this test kit, 20 μ L reaction systems comprise following component:
Wherein:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 3
The present invention detects the test kit of streptococcus aureus and mecA, wherein 20.0 μ L
Reaction system is composed of the following components:
Wherein:
Wherein primer sequence is as follows:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 4
20 μ L reaction systems are prepared composed of the following components in test kit of the present invention:
Wherein primer sequence is as follows:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 5
20 μ L reaction systems are prepared composed of the following components in test kit of the present invention:
Wherein primer sequence is as follows:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 6
20 μ L reaction systems are prepared composed of the following components in test kit of the present invention:
Wherein primer sequence is as follows:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 7
20 μ L reaction systems are prepared composed of the following components in test kit of the present invention:
Wherein primer sequence is as follows:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
Embodiment 8
1, the present invention detects the method for streptococcus aureus and mecA, comprises the following steps:
A, extraction sample DNA;
B, carry out fluorescent PCR amplification to the sample DNA in steps A, wherein reaction system is composed of the following components:
The sequence of wherein said upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
The sequence of described downstream primer gltBR: GGATAATGAAGGGAAACC
The sequence of described upstream primer mecAF: GTTGTAGTTGTCGGGTTT
The sequence of described downstream primer mecAR: TTTATCGGACGTTCAGTC.
Described fluorescent PCR amplification is carried out according to the following steps:
(1) 92 DEG C ~ 96 DEG C denaturation 30s;
(2) 92 DEG C ~ 96 DEG C sex change 5s ~ 10s, 55 DEG C ~ 63 DEG C annealing 20s ~ 40s, carry out 35 ~ 45 circulations altogether.
C, to amplification after product carry out HRM analyze after result of determination.
Wherein HRM analysis is carried out to pcr amplification product, carries out according to the following steps:
(1) 92 DEG C ~ 96 DEG C sex change 1min;
(2) 40 DEG C of renaturation 1min;
(3) then initial melting temperature (Tm) 60 DEG C ~ 65 DEG C, start program heats up and melts to 92 DEG C ~ 96 DEG C, and in fusion processes, detects fluorescent signal in real time, 15 ~ 25 times/second.
Embodiment 4
Get the centrifugal 2min of 1.5mL culture 10000rpm; Throw out adds the TE damping fluid of 500 μ L, and piping and druming makes it Eddy diffusion, the centrifugal 3min of 8000r/min repeatedly, remove most supernatant, the lysozyme soln of the 50mg/mL of 200 μ l, the Proteinase K of 30 μ L 10%SDS and 15 μ L is added, after vortex mixing, in 37 DEG C of incubation 1h in precipitation; Add the 5mol/L NaCl of 100 μ L, fully mix, then add 80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing; Add isopyknic phenol/chloroform/primary isoamyl alcohol mixing, centrifugal 4-5min, proceeds to supernatant in a new pipe, adds the Virahol of 0.8 times of volume, and mixing is until DNA precipitates gently; After 70% washing with alcohol of precipitation 1mL, add TE solubilize precipitation.Get 1 μ L extract and join following reaction system,
The sequence of wherein said upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
The sequence of described downstream primer gltBR: GGATAATGAAGGGAAACC
The sequence of described upstream primer mecAF: GTTGTAGTTGTCGGGTTT
The sequence of described downstream primer mecAR: TTTATCGGACGTTCAGTC.
Carry out fluorescent PCR amplification, carry out according to the following steps:
(1) 92 DEG C ~ 96 DEG C denaturation 30s;
(2) 92 DEG C ~ 96 DEG C sex change 5s ~ 10s, 55 DEG C ~ 63 DEG C annealing 20s ~ 40s, carry out 35 ~ 45 circulations altogether.
A, to amplification after product carry out HRM analyze after result of determination.
HRM analysis is carried out to pcr amplification product, carries out according to the following steps:
(1) 92 DEG C ~ 96 DEG C sex change 1min;
(2) 40 DEG C of renaturation 1min;
(3) then initial melting temperature (Tm) 60 DEG C ~ 65 DEG C, start program heats up and melts to 92 DEG C ~ 96 DEG C, and in fusion processes, detects fluorescent signal in real time, 15 ~ 25 times/second.
The preparation of Plays DNA masterplate of the present invention:
With conventional PCR method amplification drug resistant gene goal gene gltB and mecA.PCR primer is through 1% gel electrophoresis analysis, adopt PCR primer to reclaim test kit to reclaim PCR primer, PCR primer after purifying is connected with carrier pMD18-T, to connect product conversion to competent cell, screening obtains single bacterium colony, and picking individual colonies is to containing antibiotic liquid nutrient medium, incubated overnight, extract plasmid, with the recombinant plasmid dna extracted for template carries out PCR qualification, and order-checking qualification is carried out to recombinant plasmid.Extract the positive recombinant plasmid that checking is correct, and measure its concentration, by its 10 times of doubling dilutions.
Interpretation of result
If fluorescent pcr amplification has obvious amplification curve, Ct value <35, and also melting curve has a specificity crest, and Tm value is 74.23 ± 0.15 DEG C, can be judged to streptococcus aureus and detect positive.
If fluorescent pcr amplification has obvious amplification curve, Ct value <35, melting curve has a specificity crest, and Tm value is 76.81 ± 0.15 DEG C, can be judged to mecA and detect positive.
If fluorescent pcr amplification has obvious amplification curve, Ct value <35, and have two crests, Tm value is respectively 76.81 ± 0.15 DEG C, can be judged to streptococcus aureus and mecA all detects the positive
If fluorescent pcr amplification curve is obvious, 35<Ct value <40, repeat once, if still have obvious upcurve, then have a goal gene at least for detecting, according to aforementioned melting curve analysis figure crest, a situation arises and Tm value carries out corresponding judgement simultaneously.
If the obvious Ct value >40 of fluorescent pcr amplification curve, or be judged to streptococcus aureus without obvious amplification curve and mecA all detects feminine gender.
Sensitivity and Specificity test in the present invention:
Adopt the method such as order-checking to carry out sequence verification to positive amplification product, result positive amplification Product Sequence carries out Blast when comparing, sequence all with Genbank aim sequence very high homology.The positive plasmid template DNA that 10 times are diluted is added previous reaction system, carries out sensitivity experiments.The each drug resistant gene detection sensitivity of result all lower than 0.1pg, and has fine repeatability.In good linear relationship between each drug resistant gene dilution template concentrations and Cp value, R
2all be greater than 0.95, illustrate that the method has good tolerance range and satisfactory stability.
More than show and describe ultimate principle of the present invention and principal character and advantage of the present invention.The technician of the industry should understand; the present invention is not restricted to the described embodiments; what describe in above-described embodiment and specification sheets just illustrates principle of the present invention; without departing from the spirit and scope of the present invention; the present invention also has various changes and modifications, and these changes and improvements all fall in the claimed scope of the invention.Application claims protection domain is defined by appending claims and equivalent thereof.
Claims (7)
1. detect a primer for streptococcus aureus and gene mecA, it is characterized in that the sequence of this primer is respectively:
Upstream primer gltBF:TAATCTTTAGTAGTACCGAAGC
Downstream primer gltBR:GGATAATGAAGGGAAACC
Upstream primer mecAF:GTTGTAGTTGTCGGGTTT
Downstream primer mecAR:TTTATCGGACGTTCAGTC.
2. detect a test kit for streptococcus aureus and gene mecA, it is characterized in that in this test kit, 20 μ L reaction systems comprise following component:
The sequence of wherein said upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
The sequence of described downstream primer gltBR: GGATAATGAAGGGAAACC
The sequence of described upstream primer mecAF: GTTGTAGTTGTCGGGTTT
The sequence of described downstream primer mecAR: TTTATCGGACGTTCAGTC.
3. a kind of test kit detecting streptococcus aureus and mecA according to claim 2, is characterized in that in this test kit, 20 μ L reaction systems comprise following component:
4. detect a method of streptococcus aureus and mecA, it is characterized in that comprising the following steps:
A, extraction sample DNA;
B, test kit as claimed in claim 2 or claim 3 is utilized to carry out pcr amplification to the sample DNA in steps A;
After C, amplification, high resolving power melting curve analysis is carried out to product, and in conjunction with amplification curve result of determination.
5. detect the method for streptococcus aureus and mecA according to claim 4, it is characterized in that the response procedures of pcr amplification in step B carries out according to the following steps:
(1) 92 DEG C ~ 96 DEG C denaturation 30s;
(2) 92 DEG C ~ 95 DEG C sex change 10s ~ 30s, 54 DEG C ~ 64 DEG C annealing 10s ~ 30s, 72 DEG C of 10s ~ 30s, carry out 35 ~ 45 circulations altogether;
(3) 72 DEG C extend 10s ~ 30s.
6. detect the method for streptococcus aureus and mecA according to claim 5, it is characterized in that the melting curve analysis of high resolving power described in step C, carry out according to the following steps:
(1) 92 DEG C ~ 96 DEG C sex change 1min;
(2) 40 DEG C of renaturation 1min;
(3) then initial melting temperature (Tm) 60 DEG C ~ 65 DEG C, start program heats up and melts to 90 DEG C ~ 95 DEG C, and in fusion processes, detects fluorescent signal in real time, 15 ~ 25 times/second.
7. detect the method for streptococcus aureus and mecA according to claim 6, it is characterized in that the concrete steps extracting sample DNA described in steps A are as follows:
Get the centrifugal 2min of 1.5mL culture 10000rpm; Throw out adds the TE damping fluid of 500 μ L, and piping and druming makes it Eddy diffusion, the centrifugal 3min of 8000r/min repeatedly, remove most supernatant, the lysozyme soln of the 50mg/mL of 200 μ l, the Proteinase K of 30 μ L 10%SDS and 15 μ L is added, after vortex mixing, in 37 DEG C of incubation 1h in precipitation; Add the 5mol/L NaCl of 100 μ L, fully mix, then add 80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing; Add isopyknic phenol/chloroform/primary isoamyl alcohol mixing, centrifugal 4-5min, proceeds to supernatant in a new pipe, adds the Virahol of 0.8 times of volume, and mixing is until DNA precipitates gently; After 70% washing with alcohol of precipitation 1mL, add TE solubilize precipitation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363950.5A CN104894284A (en) | 2015-06-25 | 2015-06-25 | Primer, reagent box and method for detecting staphylococcus aureus and mecA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363950.5A CN104894284A (en) | 2015-06-25 | 2015-06-25 | Primer, reagent box and method for detecting staphylococcus aureus and mecA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104894284A true CN104894284A (en) | 2015-09-09 |
Family
ID=54027235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510363950.5A Pending CN104894284A (en) | 2015-06-25 | 2015-06-25 | Primer, reagent box and method for detecting staphylococcus aureus and mecA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104894284A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779582A (en) * | 2015-12-02 | 2016-07-20 | 上海市计量测试技术研究院 | Polynucleotide, method and kit for methicillin-resistant staphylococcus aureus (MRSA) detection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104388554A (en) * | 2014-11-05 | 2015-03-04 | 蔡先全 | Kit for detecting eight staphylococcus aureus drug-resistance genes and detection method |
-
2015
- 2015-06-25 CN CN201510363950.5A patent/CN104894284A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104388554A (en) * | 2014-11-05 | 2015-03-04 | 蔡先全 | Kit for detecting eight staphylococcus aureus drug-resistance genes and detection method |
Non-Patent Citations (2)
| Title |
|---|
| 中华人民共和国国家质量监督检验检疫总局: "SN/T 1870-2007 食品中致病菌检测方法 实时PCR法", 《中华人民共和国出入境检验检疫行业标准》 * |
| 黄辉等: "MecA 基因在耐甲氧西林金黄色葡萄球菌对β-内酰胺类抗生素耐药中的作用", 《中南大学学报（医学版）》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779582A (en) * | 2015-12-02 | 2016-07-20 | 上海市计量测试技术研究院 | Polynucleotide, method and kit for methicillin-resistant staphylococcus aureus (MRSA) detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434882B (en) | Method for rapidly detecting cronobacter sakazakii at constant temperature, primer and application | |
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CN106987653B (en) | LAMP (loop-mediated isothermal amplification) detection primer for potato late blight bacteria and visual detection method thereof | |
| CN103966353B (en) | A kind of detect the rugged Cronobacter sakazakii of slope method and test kit and primer | |
| CN104862406A (en) | Primer and probe for on-site rapid detection of mycobacterium tuberculosis complex and kit thereof | |
| CN102851385B (en) | Primer group utilizing LAMP to detect vibrio alginolyticus and rapid diagnosis kit employing primer group | |
| Li et al. | Rapid detection of Brucella spp. and elimination of carryover using multiple cross displacement amplification coupled with nanoparticles-based lateral flow biosensor | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| Mu et al. | The fluorescent probe-based recombinase-aided amplification for rapid detection of Escherichia coli O157: H7 | |
| CN103667251A (en) | Method for detecting food-borne pathogenic bacteria at high throughput | |
| CN108531631A (en) | One kind is for detecting enteropathogenic E. Coli O157:The RPA-LFD primer pairs and probe of H7 and its application | |
| CN103361429A (en) | LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN104894283A (en) | Primer, reagent box and method for detecting salmonella and integron (int) | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| CN104212901A (en) | Composition for detecting drug resistance of staphylococcus aureus | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN105525023A (en) | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method | |
| CN106434935B (en) | Compositions and methods for identifying Pasteurella multocida and/or Haemophilus parasuis | |
| Xia et al. | Rapid detection of Escherichia coli O157: H7 by loop-mediated isothermal amplification coupled with a lateral flow assay targeting the z3276 genetic marker | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| CN104212885B (en) | The LAMP kit of vibrio cholera in a kind of aquatic products | |
| CN102851382A (en) | LAMP kit for rapid detection of Shigella | |
| CN105483219A (en) | Mycobacterium tuberculosis complex nucleic acid detection method and kit | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150909 |
|
| RJ01 | Rejection of invention patent application after publication |