CN102851382A - LAMP kit for rapid detection of Shigella - Google Patents
LAMP kit for rapid detection of Shigella Download PDFInfo
- Publication number
- CN102851382A CN102851382A CN2012103555101A CN201210355510A CN102851382A CN 102851382 A CN102851382 A CN 102851382A CN 2012103555101 A CN2012103555101 A CN 2012103555101A CN 201210355510 A CN201210355510 A CN 201210355510A CN 102851382 A CN102851382 A CN 102851382A
- Authority
- CN
- China
- Prior art keywords
- shigellae
- primer
- lamp
- test kit
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP (loop-mediated isothermal amplification) kit for rapid detection of Shigella. The kit is composed of an LAMP reaction solution, a standard positive template, and a negative quality control standard. The LAMP reaction solution contains a Bst DNA polymerase large fragment, primers, an LAMP10*buffer, a dNTPs solution, an MgSO4 solution and betaine. The primers include forward and reverse primers. The kit disclosed in the invention has the advantages of good specificity, high sensitivity, rapidness and convenience, high repeatability, and judgeable results obtained by naked eyes, etc., can perform rapid qualitative detection on Shigella in industrial food, and can be used to replace the continuously used traditional culture method and the serological diagnostic method.
Description
Technical field
The present invention relates to the LAMP test kit of a kind of rapid detection Shigellae, belong to the food inspection field.
Background technology
Shigella (ShigellaCastellani and Chalmers) is a class gram negative bacillus, is the most common pathogenic bacteria of human bacillary dysentery, the common name dysentery bacterium.Bacillary dysentery is modal infectious intestinal disease, and two season of autumn in summer, the patient was maximum.Contagium is mainly patient and carrier, the peroral infection such as the food by having polluted dysentery bacterium, drinking-water.Human to the Shigellae susceptible, 10～200 bacteriums can make 10～50% volunteers cause a disease.In general, the state of an illness of bacillary dysentery is heavier due to the Shigellae.Acute bacillary dysentery is more common in children's, and various dysentery bacterium all can cause.Morbidity is anxious, and the stomachache of being everlasting, diarrhoea do not occur, and present serious whole body toxicity symptom.Acute bacillary dysentery treatment is not thorough, or Abwehrkraft des Koepers is low, malnutritive or during with other chronic diseases, easily transfer to chronic.The course of disease is many more than two months, protracted course of disease or the time send out when healing.
The ring mediated isothermal amplification that development in recent years is got up (loop-mediated isothermal amplification, the advantages such as LAMP) technology is highly sensitive with it, speed fast, high specificity are being used widely aspect the gene qualitative detection, and have become one of important method of current viral nucleic acid qualitative detection.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology is a kind of novel isothermal nucleic acid amplification method, this method is for 4 special primers of 6 zone design of target gene, utilize a kind of archaeal dna polymerase (Bst archaeal dna polymerase) with strand displacement activity, be incubated approximately 60min at constant temperature (about 65 ℃), can finish nucleic acid amplification reaction, produce macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.This technology has does not need PCR instrument, amplified production not to need to uncap, and with the naked eye gets final product judged result and reaction times short, high specificity, the advantages such as sensitivity height.
The cultural method of traditional detection Shigellae needs separation, screening and biochemical identification, also needs in case of necessity serological identification, is generally 4～6d, wastes time and energy, and has the shortcomings such as sensitivity is low, poor specificity, false positive, time and effort consuming.Various conventional PCR method have the advantages such as susceptibility is strong, specificity is high, easy, quick, the report that has more application to detect in Shigellae, but owing to exist the PCR aftertreatment to produce the problem such as false positive that pollution causes and the special plant and instrument of needs has limited its application in grass-roots unit.Yin Ci Qi accurate, sensitive, quick, free of contamination Clinical Laboratory method to be developed.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiency that prior art exists, and LAMP test kit and the using method thereof of a kind of rapid detection Shigellae is provided.
For achieving the above object, the present invention by the following technical solutions:
The LAMP test kit of a kind of rapid detection Shigellae, this test kit comprises: a) LAMP reaction solution, b) standard positive template, c) negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 4 group-specific primerses:
(1) upstream outer primer F3:5 '-TCTGGAGGACATTGCCCG-3 '; (SEQ ID No.1)
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 '; (SEQ ID No.2)
Upstream inner primer FIP:5 '-
GCATGGTCTGGAAGGCCAGGAAGTCAGAACTCTCCATTTTGTGG-3′；（SEQ ID No.3）
Downstream inner primer BIP:5 '-TCGCAGAGAAACTTCAGCTCTCCCGGAGGTCATTTGCTGTCAC-3 '; (SEQ ID No.4)
(2) upstream outer primer F3:5 '-GGCAGGGAAATGTTCCGC-3 '; (SEQ ID No.5)
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 '; (SEQ ID No.6)
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTTCTGGAGGACATTGCCCG-3 '; (SEQ ID No.7)
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 '; (SEQ ID No.8)
(3) upstream outer primer F3:5 '-GCAGGGAAATGTTCCGCC-3 '; (SEQ ID No.9)
Downstream outer primer B3:5 '-CTTCTGACCATGGCTTCGG-3 '; (SEQ IDNo.10)
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTGAGGACATTGCCCGGGATA-3 '; (SEQ ID No.11)
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTAGGTCATTTGCTGTCACTCC-3 '; (SEQ ID No.12)
(4) upstream outer primer F3:5 '-CGCCTCGAAATTCTGGAGG-3 '; (SEQ ID No.13)
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 '; (SEQ ID No.14)
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTACATTGCCCGGGATAAAGTC-3 '; (SEQ ID No.15)
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 '; (SEQ ID No.16)
Specifically,
A) LAMP reaction solution
The LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.
In a concrete scheme of the present invention, the LAMP reaction solution is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs3.0 μ l, 50mmol/L MgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
B) standard positive template
Standard positive template is the pMD18-T-ipaH carrier that contains the nucleotide fragments formation of 351 base pairs of Shigellae high conservative gene ipaH gene, and this carrier can be bred in bacillus coli DH 5 alpha.
The nucleotides sequence of ipaH gene is classified as:
5′-CTCACATGGAACAATCTCCGGAAAACCCTCCTGGTCCATCAGGCATCTGAAGGCCTTTTCGATAATGATACCGGCGCTCTGCTCTCCCTGGGCAGGGAAATGTTCCGCCTCGAAATTCTGGAGGACATTGCCCGGGATAAAGTCAGAACTCTCCATTTTGTGGATGAGATAGAAGTCTACCTGGCCTTCCAGACCATGCTCGCAGAGAAACTTCAGCTCTCCACTGCCGTGAAGGAAATGCGTTTCTATGGCGTGTCGGGAGTGACAGCAAATGACCTCCGCACTGCCGAAGCCATGGTCAGAAGCCGTGAAGAGAATGAATTTACGGACTGGTTCTCCCTCTGGGGACCA-3′（SEQ ID No.17）
Testing used standard substance is the plasmid pMD18-T-ipaH that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
The principle of work of this test kit:
Use quick visualization provided by the invention to detect Shigellae LAMP test kit, (about 65 ℃) are incubated approximately 60min under constant temperature, can finish nucleic acid amplification reaction, and supervene macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.After reaction finishes, the centrifugal 30s of 12000r/min, pipe end white precipitate can detect by an unaided eye.In rapid detection Shigellae LAMP test kit provided by the invention, for the singularity in the Shigellae detection, different target fragments is carried out reaction system, such as primer, dNTPs, Mg
2+The optimization of concentration, trimethyl-glycine etc., pass through prioritization scheme, repeatedly experiment, set up the loop-mediated isothermal amplification method that detects Shigellae, and develop the LAMP test kit that detects Shigellae, the sensitivity of this test kit can detect 10 copies in each reaction system, can satisfy the requirement of rapid detection Shigellae.
Use LAMP test kit of the present invention to detect the method for Shigellae, may further comprise the steps:
A) cultivate sample 1-4h to be checked with buffered peptone water (BPW) according to National Standard Method;
B) from testing sample, extract DNA with water-boiling method;
C) get b) step in sample DNA join in the reaction solution of LAMP test kit, 65 ℃ the insulation 1h; Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
D) after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
The rapid detection Shigellae LAMP test kit that provides in the present invention can carry out qualitative detection to Shigellae, and alternative traditional culture method of always continuing to use and serum method detection method.The present invention compared with prior art has the following advantages and effect:
1, compare with culture-based method, detection speed is fast, and only 1h adds the extraction preparation of sample DNA, altogether is no more than 5h.
2, specificity is good, and is highly sensitive;
3, step is simple, and is repeatable high;
4, can carry out simultaneously a plurality of sample detection.
Description of drawings
Fig. 1 is the centrifugal rear observation white precipitate result of Shigellae among the embodiment 1, among the figure:
1-standard positive template, 2-negative control, 3-Shigellae positive sample,
4-Shigellae positive sample, 5-Shigellae positive sample, 6-Shigellae negative sample,
7-Shigellae negative sample, 8-Shigellae negative sample;
Fig. 2 is Shigellae 1.5% agarose gel electrophoresis detected result figure among the embodiment 1, among the figure:
M-DNA Marker, 1-standard positive template, 2-negative control,
3-Shigellae positive sample, 4-Shigellae positive sample, 5-Shigellae positive sample,
6-Shigellae negative sample, 7-Shigellae negative sample, 8-Shigellae negative sample;
Fig. 3 is the centrifugal rear observation white precipitate result of Shigellae among the embodiment 2, among the figure:
The 1-standard positive template, the 2-negative control, 3-Shigellae positive sample,
4-Shigellae positive sample, 5-Shigellae positive sample, 6-Shigellae negative sample,
7-Shigellae negative sample, 8-Shigellae negative sample;
Fig. 4 is the centrifugal rear observation white precipitate result of Shigellae among the embodiment 3, among the figure:
1-standard positive template, 2-negative control, 3-Shigellae positive sample,
4-Shigellae positive sample, 5-Shigellae positive sample, 6-Shigellae negative sample,
7-Shigellae negative sample, 8-Shigellae negative sample;
Fig. 5 is the centrifugal rear observation white precipitate result of Shigellae among the embodiment 4, among the figure:
1-standard positive template, 2-negative control, 3-Shigellae positive sample,
4-Shigellae positive sample, 5-Shigellae positive sample, 6-Shigellae negative sample,
7-Shigellae negative sample, 8-Shigellae negative sample;
Fig. 6 is Shigellae LAMP test kit specificity experimental observation white precipitate result among the embodiment 5, among the figure:
1-standard positive template, 2-negative control, 3-shigella dysenteriae sample,
4-Shigella sonnei sample, 5-not formula Shigellae samples, 6-Salmonella paratyphi A sample,
7-Salmonella enteritidis sample, 8-streptococcus aureus sample; 9-Listeria monocytogenes sample;
Fig. 7 is that Shigellae LAMP test kit sensitivity experiment is observed the white precipitate result among the embodiment 6, among the figure:
1-dilution 10
-1Doubly, 2-dilution 10
-2Doubly, 3-dilution 10
-3Doubly,
4-dilution 10
-4Doubly, 5-dilution 10
-5Doubly, 6-dilution 10
-6Doubly,
7-dilution 10
-7Doubly, 8-dilution 10
-8Doubly, 9-dilution 10
-9Doubly,
10-dilution 10
-10Doubly.
Embodiment
Below in conjunction with the implementation example, further set forth the present invention.Be to be understood that, these embodiments only are used for explanation the present invention and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition such as chief editors such as J. Pehanorm Brookers, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
Embodiment 1:
1. novel quick visualization detects Shigellae LAMP test kit composition and preparation, and reagent forms:
A) LAMP reaction mixture
The LAMP reaction mixture is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs 3.0 μ l, 50mmol/LMgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
Wherein primer sequence is as follows:
Upstream outer primer F3:5 '-TCTGGAGGACATTGCCCG-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-
GCATGGTCTGGAAGGCCAGGAAGTCAGAACTCTCCATTTTGTGG-3′；
Downstream inner primer BIP:5 '-TCGCAGAGAAACTTCAGCTCTCCCGGAGGTCATTTGCTGTCAC-3 ';
B) standard positive template
Standard positive template pMD18-T-ipaH is the pMD18-T-ipaH carrier that contains the nucleotide fragments formation of 351 base pairs of Shigellae high conservative gene ipaH gene, and this carrier can be bred in bacillus coli DH 5 alpha; Testing used standard substance is the plasmid pMD18-T-ipaH that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
2. use the described method that detects Shigellae based on the PCR test kit of Shigellae in the loop-mediated isothermal amplification technique rapid detection industrial food, may further comprise the steps:
A, foodstuff samples pre-treatment: get 3 portions of positive food of Shigellae of identifying through culture-based method, 3 portions of negative food of Shigellae, taking by weighing respectively 25g(mL) sample puts into the aseptic homogeneous cup that fills 225mL BPW, with 8000r/min～10000r/min homogeneous 1min～2min, or place the aseptic homogenizing bag that fills 225mL BPW, pat 1min～2min with slap type homogenizer.If sample is liquid, do not need homogeneous, the vibration mixing gets final product.Aseptic technique goes to sample in the 500mL Erlenmeyer flask, as using homogenizing bag, can directly cultivate, and cultivates 1-4h in 36 ℃ ± 1 ℃.As be frozen prods, should thaw being no more than 15min below 45 ℃.
The preparation of b, bacterium template DNA: get respectively 100 μ L bacterial culturess, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
C, LAMP reaction: get respectively 5 μ l b) the sample supernatant joins in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min in the step.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
D, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 1).Get 5 μ l LAMP products and detect with 1.5% agarose gel electrophoresis, positive sample has band, and negative sample is then without band (seeing accompanying drawing 2).Accompanying drawing 1 is centrifugal rear observation white precipitate result, and accompanying drawing 2 is 1.5% agarose gel electrophoresis detected result.
E, conclusion: revision test is 3 times repeatedly, and the gained detected result is identical, and experimental group all has precipitation or electrophoretic band, and control group is all without precipitation or electrophoretic band, and is consistent with expected results.Illustrate that this test kit detects Shigellae respond well, the precipitation observation is consistent with electrophoresis detection method effect, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 2:
1. novel quick visualization detects Shigellae LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-GGCAGGGAAATGTTCCGC-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTTCTGGAGGACATTGCCCG-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on Shigellae in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Shigellae are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 3), and is consistent with expected results.Illustrate that this test kit detects Shigellae respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 3:
1. novel quick visualization detects Shigellae LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-GCAGGGAAATGTTCCGCC-3 ';
Downstream outer primer B3:5 '-CTTCTGACCATGGCTTCGG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTGAGGACATTGCCCGGGATA-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTAGGTCATTTGCTGTCACTCC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on Shigellae in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Shigellae are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 4), and is consistent with expected results.Illustrate that this test kit detects Shigellae respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 4:
1. novel quick visualization detects Shigellae LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-CGCCTCGAAATTCTGGAGG-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTACATTGCCCGGGATAAAGTC-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on Shigellae in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Shigellae are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 5), and is consistent with expected results.Illustrate that this test kit detects Shigellae respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 5: based on the specificity experiment of the PCR test kit of Shigellae in the loop-mediated isothermal amplification technique rapid detection industrial food
The preparation of a, dna profiling: the shigella dysenteriae of the DNA validation verification of learning from else's experience respectively, Shigella sonnei, the bacterium liquid 10 μ l of formula Shigellae, Salmonella paratyphi A, Salmonella enteritidis, streptococcus aureus, Listeria monocytogenes not, the centrifugal 2min of 12000r/min, remove supernatant, add 50 μ L sterilized waters, abundant mixing, 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get 51 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
C, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 6).Accompanying drawing 6 is Shigellae LAMP test kit specificity experimental observation white precipitate result.
D, conclusion: result's demonstration only has positive controls, shigella dysenteriae, Shigella sonnei, not formula Shigellae adularescent precipitates, and Salmonella paratyphi A, Salmonella enteritidis, streptococcus aureus, Listeria monocytogenes and negative control do not have white precipitate.
Above-mentioned this test kit of description of test has good specificity.
Embodiment 6: rapid detection Shigellae LAMP test kit sensitivity experiment
A, the shigella dysenteriae nutrient solution of getting the 1ml incubated overnight are done 10 times of doubling dilutions, are diluted to 10
-10Get each dilution bacterium liquid 10 μ l, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get 5 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.
C, result judge: whether reaction produces white precipitate at the bottom of the centrifugal 30s observation tube of 12000r/min after finishing, and the result shows 10
-1-10
-8Equal adularescent precipitation at the bottom of the sample tube, 10
-9-10
-10Then there is not white precipitate (seeing accompanying drawing 7) at the bottom of the sample tube.Accompanying drawing 7 is that Shigellae LAMP test kit sensitivity experiment is observed the white precipitate result.
D, conclusion: the result shows that working as bacterium liquid is diluted to 10
-8In time, still can detect, and the lowest detection limit is 50CFU/ml.
Above-mentioned this test kit of description of test has good sensitivity.
Can illustrate from above-mentioned example, LAMP detection method specificity is good, highly sensitive, good reproducibility, easy and simple to handle, and the LAMP detection kit only needs just can finish less than 5 hours to the detection of sample, and traditional culture method approximately just can be finished about 1 week of need, therefore, use this test kit greatly to shorten detection time.
The operation of this test kit only needs 1 people can finish whole operating process, once can detect a plurality of (being needed to determine by the reality detection) sample, has so also reduced the waste of manpower.
SEQUENCE LISTING
＜110〉the true good fortune medical sci-tech in Wuhan Development Co., Ltd
＜120〉the LAMP test kit of rapid detection Shigellae
<130>
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 1
tctggaggac attgcccg 18
<210> 2
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 2
gcttctgacc atggcttcg 19
<210> 3
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 3
gcatggtctg gaaggccagg aagtcagaac tctccatttt gtgg 44
<210> 4
<211> 43
<212> DNA
＜213〉artificial sequence
<400> 4
tcgcagagaa acttcagctc tcccggaggt catttgctgt cac 43
<210> 5
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 5
ggcagggaaa tgttccgc 18
<210> 6
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 6
gcttctgacc atggcttcg 19
<210> 7
<211> 40
<212> DNA
＜213〉artificial sequence
<400> 7
ggtctggaag gccaggtaga cttctggagg acattgcccg 40
<210> 8
<211> 40
<212> DNA
＜213〉artificial sequence
<400> 8
tgctcgcaga gaaacttcag cttgctgtca ctcccgacac 40
<210> 9
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 9
gcagggaaat gttccgcc 18
<210> 10
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 10
cttctgacca tggcttcgg 19
<210> 11
<211> 41
<212> DNA
＜213〉artificial sequence
<400> 11
ggtctggaag gccaggtaga ctgaggacat tgcccgggat a 41
<210> 12
<211> 42
<212> DNA
＜213〉artificial sequence
<400> 12
tgctcgcaga gaaacttcag ctaggtcatt tgctgtcact cc 42
<210> 13
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 13
cgcctcgaaa ttctggagg 19
<210> 14
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 14
gcttctgacc atggcttcg 19
<210> 15
<211> 42
<212> DNA
＜213〉artificial sequence
<400> 15
ggtctggaag gccaggtaga ctacattgcc cgggataaag tc 42
<210> 16
<211> 40
<212> DNA
＜213〉artificial sequence
<400> 16
tgctcgcaga gaaacttcag cttgctgtca ctcccgacac 40
<210> 17
<211> 351
<212> DNA
＜213〉Shigellae
<400> 17
ctcacatgga acaatctccg gaaaaccctc ctggtccatc aggcatctga aggccttttc 60
gataatgata ccggcgctct gctctccctg ggcagggaaa tgttccgcct cgaaattctg 120
gaggacattg cccgggataa agtcagaact ctccattttg tggatgagat agaagtctac 180
ctggccttcc agaccatgct cgcagagaaa cttcagctct ccactgccgt gaaggaaatg 240
cgtttctatg gcgtgtcggg agtgacagca aatgacctcc gcactgccga agccatggtc 300
agaagccgtg aagagaatga atttacggac tggttctccc tctggggacc a 351
Claims (4)
1. the LAMP test kit of a rapid detection Shigellae is characterized in that, is comprised of LAMP reaction solution, standard positive template, negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 4 group-specific primerses:
(1) upstream outer primer F3:5 '-TCTGGAGGACATTGCCCG-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-
GCATGGTCTGGAAGGCCAGGAAGTCAGAACTCTCCATTTTGTGG-3′；
Downstream inner primer BIP:5 '-TCGCAGAGAAACTTCAGCTCTCCCGGAGGTCATTTGCTGTCAC-3 ';
(2) upstream outer primer F3:5 '-GGCAGGGAAATGTTCCGC-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTTCTGGAGGACATTGCCCG-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 ';
(3) upstream outer primer F3:5 '-GCAGGGAAATGTTCCGCC-3 ';
Downstream outer primer B3:5 '-CTTCTGACCATGGCTTCGG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTGAGGACATTGCCCGGGATA-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTAGGTCATTTGCTGTCACTCC-3 ';
(4) upstream outer primer F3:5 '-CGCCTCGAAATTCTGGAGG-3 ';
Downstream outer primer B3:5 '-GCTTCTGACCATGGCTTCG-3 ';
Upstream inner primer FIP:5 '-GGTCTGGAAGGCCAGGTAGACTACATTGCCCGGGATAAAGTC-3 ';
Downstream inner primer BIP:5 '-TGCTCGCAGAGAAACTTCAGCTTGCTGTCACTCCCGACAC-3 '.
2. LAMP test kit according to claim 1 is characterized in that, the LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.
3. LAMP test kit according to claim 1 and 2 is characterized in that, standard positive template is the pMD18-T-ipaH carrier that contains the nucleotide fragments formation of 351 base pairs of Shigellae high conservative gene ipaH gene,
The nucleotides sequence of ipaH gene is classified as shown in the SEQ ID No.17.
4. right to use requires 1～3 described LAMP test kit to detect the method for Shigellae, it is characterized in that, may further comprise the steps:
1. cultivate sample 4h to be checked with buffered peptone water according to National Standard Method;
2. from testing sample, extract DNA with water-boiling method;
3. DNA is joined in the reaction system of LAMP test kit 65 ℃ of insulation 1h; Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
4. after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103555101A CN102851382A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Shigella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103555101A CN102851382A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Shigella |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102851382A true CN102851382A (en) | 2013-01-02 |
Family
ID=47398356
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103555101A Pending CN102851382A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Shigella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102851382A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328208A (en) * | 2014-11-24 | 2015-02-04 | 武汉明曼基因工程有限公司 | Rapid detection kit of Shigella and application of rapid detection kit |
| CN105219772A (en) * | 2015-11-15 | 2016-01-06 | 中国疾病预防控制中心传染病预防控制所 | One group of nucleotide sequence and the application in salmonella and shigella detect |
| CN105755141A (en) * | 2016-04-20 | 2016-07-13 | 浙江省疾病预防控制中心 | Kit for fast detecting live Shigella in food and application of kit |
| CN106434891A (en) * | 2015-09-02 | 2017-02-22 | 上海产业技术研究院 | Method for rapidly detecting Shigella at constant temperature, primers used for method and kit |
| CN107904320A (en) * | 2017-12-19 | 2018-04-13 | 温和心 | Detect shiga Salmonella loop-mediated isothermal amplification experiment primer sets and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101008036A (en) * | 2007-01-15 | 2007-08-01 | 深圳市第二人民医院 | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology |
| CN101153326A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting shigella |
| CN102586438A (en) * | 2012-02-28 | 2012-07-18 | 武汉大学 | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms |
-
2012
- 2012-09-21 CN CN2012103555101A patent/CN102851382A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101008036A (en) * | 2007-01-15 | 2007-08-01 | 深圳市第二人民医院 | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology |
| CN101153326A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting shigella |
| CN102586438A (en) * | 2012-02-28 | 2012-07-18 | 武汉大学 | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328208A (en) * | 2014-11-24 | 2015-02-04 | 武汉明曼基因工程有限公司 | Rapid detection kit of Shigella and application of rapid detection kit |
| CN106434891A (en) * | 2015-09-02 | 2017-02-22 | 上海产业技术研究院 | Method for rapidly detecting Shigella at constant temperature, primers used for method and kit |
| CN106434891B (en) * | 2015-09-02 | 2020-02-18 | 上海产业技术研究院 | Method, primer and kit for rapidly detecting shigella at constant temperature |
| CN111020048A (en) * | 2015-09-02 | 2020-04-17 | 上海产业技术研究院 | Rapid constant-temperature detection method, primer group and kit for Shigella |
| CN111073989A (en) * | 2015-09-02 | 2020-04-28 | 上海产业技术研究院 | Rapid isothermal detection method for shigella nucleic acid and application thereof |
| CN111073989B (en) * | 2015-09-02 | 2023-05-02 | 上海产业技术研究院 | Rapid constant-temperature detection method and application of shigella nucleic acid |
| CN105219772A (en) * | 2015-11-15 | 2016-01-06 | 中国疾病预防控制中心传染病预防控制所 | One group of nucleotide sequence and the application in salmonella and shigella detect |
| CN105755141A (en) * | 2016-04-20 | 2016-07-13 | 浙江省疾病预防控制中心 | Kit for fast detecting live Shigella in food and application of kit |
| CN107904320A (en) * | 2017-12-19 | 2018-04-13 | 温和心 | Detect shiga Salmonella loop-mediated isothermal amplification experiment primer sets and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434886B (en) | Method for rapidly detecting yersinia pseudotuberculosis at constant temperature, primer and application | |
| CN102864228A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus | |
| CN102864226A (en) | LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus | |
| CN106967816B (en) | RPA specific primer for detecting vibrio parahaemolyticus in food, kit and application | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN102816847B (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN102851382A (en) | LAMP kit for rapid detection of Shigella | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella | |
| CN103468811A (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN102851381A (en) | LAMP kit for rapid detection of Listeria monocytogenes | |
| CN111073986B (en) | Rapid constant-temperature detection method for salmonella, primer group and application | |
| CN102864229A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni | |
| Zhang et al. | Rapid and sensitive detection of Staphylococcus aureus via an all-in-one staggered strand exchange amplification platform | |
| CN103571943A (en) | Nucleic acid detection method for salmonella typhimurium | |
| CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| Mu et al. | Detection of Brucella S2 vaccine strain by a loop-mediated isothermal amplification (LAMP) method | |
| CN105603081B (en) | Non-diagnosis-purpose qualitative and quantitative detection method for intestinal microorganisms | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN104328206B (en) | The LAMP detection method and its primer special of clostridium difficile binary toxin and test kit | |
| CN108004334B (en) | Quadruple fluorescent PCR primer group, probe group, kit and method for detecting four pathogenic bacteria in drinking water | |
| da Costa et al. | Loop-mediated isothermal amplification (LAMP) for the detection of Listeria monocytogenes and major pathogenic serotypes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130102 |