CN102851383A - LAMP kit for rapid detection of Salmonella - Google Patents
LAMP kit for rapid detection of Salmonella Download PDFInfo
- Publication number
- CN102851383A CN102851383A CN2012103556015A CN201210355601A CN102851383A CN 102851383 A CN102851383 A CN 102851383A CN 2012103556015 A CN2012103556015 A CN 2012103556015A CN 201210355601 A CN201210355601 A CN 201210355601A CN 102851383 A CN102851383 A CN 102851383A
- Authority
- CN
- China
- Prior art keywords
- primer
- salmonellas
- upstream
- downstream
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP (loop-mediated isothermal amplification) kit for rapid detection of Salmonella. The kit is composed of an LAMP reaction solution, a standard positive template, and a negative quality control standard. The LAMP reaction solution contains a Bst DNA polymerase large fragment, primers, an LAMP10*buffer, a dNTPs solution, an MgSO4 solution and betaine. The primers include forward and reverse primers. The kit disclosed in the invention has the advantages of good specificity, high sensitivity, rapidness and convenience, high repeatability, and judgeable results obtained by naked eyes, etc., can perform rapid qualitative detection on pathogenic Salmonella in industrial food, and can be used to replace the continuously used traditional culture method and the serological diagnostic method.
Description
Technical field
The present invention relates to the LAMP test kit of a kind of rapid detection Salmonellas (Salmonella), belong to the food inspection field.
Background technology
Salmonella (Salmonella) is one of important pathogen body that causes bacterial food poisoning, also is Pseudomonas the most complicated in the enterobacteriaceae, belongs to Gram-negative bacteria.2523 serotypes have been isolated in the whole world at present, and China has found 216.The various serotype of Salmonellas can cause poisoning, and is the most common with Salmonella enteritidis, Salmonella typhimurtum and Salmonella choleraesuis.The symptom of salmonella poisoning is main by acute gastroenteritis mainly, be generally four to 48 hours latent period, short-term is a few hours, is two days to three days for a long time, and early stage, symptom had nauseating, headache, malaise and feel cold etc., cardinal symptom has vomiting, diarrhoea, abdomen to ache, and ight soil is with purulence blood and mucus sometimes with the yellow-green colour watery stool, the temperature of general heating is at 38 degrees centigrade to 40 degrees centigrade, and the symptom of shiver with cold, convulsions, tic and stupor appears beating in the heavy patient.
The ring mediated isothermal amplification that development in recent years is got up (loop-mediated isothermal amplification, the advantages such as LAMP) technology is highly sensitive with it, speed fast, high specificity are being used widely aspect the gene qualitative detection, and have become one of important method of current viral nucleic acid qualitative detection.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology is a kind of novel isothermal nucleic acid amplification method, this method is for 4 special primers of 6 zone design of target gene, utilize a kind of archaeal dna polymerase (Bst archaeal dna polymerase) with strand displacement activity, be incubated approximately 60min at constant temperature (about 65 ℃), can finish nucleic acid amplification reaction, produce macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.But having, this technology do not need PCR instrument, naked eyes judged result and reaction times short, high specificity, the advantages such as sensitivity height.
The cultural method of traditional detection Salmonellas needs separation, screening and biochemical identification, also needs in case of necessity serological identification, is generally 4～6d, wastes time and energy, and has the shortcomings such as sensitivity is low, poor specificity, false positive, time and effort consuming.Various conventional PCR method have the advantages such as susceptibility is strong, specificity is high, easy, quick, the report that has more application to detect in Salmonellas, but owing to exist the PCR aftertreatment to produce the problem such as false positive that pollution causes and the special plant and instrument of needs has limited its application in grass-roots unit.Yin Ci Qi accurate, sensitive, quick, free of contamination Clinical Laboratory method to be developed.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiency that prior art exists, and LAMP test kit and the using method thereof of a kind of rapid detection Salmonellas is provided.
For achieving the above object, the present invention by the following technical solutions:
The LAMP test kit of a kind of rapid detection Salmonellas, this test kit comprises: a) LAMP reaction solution, b) standard positive template, c) negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 6 group-specific primerses:
(1) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 '; (SEQ ID No.1)
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 '; (SEQ ID No.2)
Upstream inner primer FIP:
5′-ATCCGCATCAATAATACCGGCCTTTGGTATGCCCGGTAAACAGA-3′；（SEQ ID No.3）
Downstream inner primer BIP:5 '-GAACGGCGAAGCGTACTGGACATCGCACCGTCAAAGGAA-3 '; (SEQ ID No.4)
(2) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 '; (SEQ ID No.5)
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 '; (SEQ ID No.6)
Upstream inner primer FIP:5 '-GCGCAGCATCCGCATCAATAATGGTATGCCCGGTAAACAGAT-3 '; (SEQ ID No.7)
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 '; (SEQ ID No.8)
(3) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 '; (SEQ ID No.9)
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 '; (SEQ ID No.10)
Upstream inner primer FIP:5 '-
GCGCAGCATCCGCATCAATAATATGCCCGGTAAACAGATGAG-3′；（SEQ ID No.11）
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 '; (SEQ ID No.12)
(4) upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 '; (SEQ ID No.13)
Downstream outer primer B3:5 '-GCGGAGGACAAATCCATACC-3 '; (SEQ ID No.14)
Upstream inner primer FIP:5 '-
CAGTACGCTTCGCCGTTCGCTTGATGCCGATTTGAAGGCC-3′；（SEQ ID No.15）
Downstream inner primer BIP:5 '-GGTGACGCTATTGCCGGCATCCACCGAAATACCGCCAAT-3 '; (SEQ ID No.16)
(5) upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 '; (SEQ ID No.17)
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 '; (SEQ ID No.18)
Upstream inner primer FIP:5 '-GGCTTTCCCTTTCCAGTACGCTAGGCCGGTATTATTGATGCG-3 '; (SEQ ID No.19)
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 '; (SEQ ID No.20)
(6) upstream outer primer F3:5 '-AGGCCGGTATTATTGATGCG-3 '; (SEQ ID No.21)
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 '; (SEQ ID No.22)
Upstream inner primer FIP:5 '-ACTTCATCGCACCGTCAAAGGAGAACGGCGAAGCGTACTG-3 '; (SEQ ID No.23)
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 '; (SEQ ID No.24)
Specifically,
A) LAMP reaction solution
The LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.
In a concrete scheme of the present invention, the LAMP reaction solution is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs3.0 μ l, 50mmol/L MgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
B) standard positive template
Standard positive template is the pMD18-T-invA carrier that contains the nucleotide fragments formation of 317 base pairs of Salmonellas high conservative gene invA gene, and this carrier can be bred in bacillus coli DH 5 alpha.
The nucleotides sequence of invA gene is classified as:
5′-CAGTTTATCGTTATTACCAAAGGTTCAGAACGCGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCTGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACCCGCCATGGTATGGATTTGTCCTCCGCTCTGTCTACTTA-3′（SEQ ID No.25）
Testing used standard substance is the plasmid pMD18-T-invA that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
The principle of work of this test kit:
Use quick visualization provided by the invention to detect Salmonellas LAMP test kit, (about 65 ℃) are incubated approximately 60min under constant temperature, can finish nucleic acid amplification reaction, and supervene macroscopic byproduct of reaction-white magnesium pyrophosphate precipitation.After reaction finishes, the centrifugal 30s of 12000r/min, pipe end white precipitate can detect by an unaided eye.In rapid detection Salmonellas LAMP test kit provided by the invention, for the singularity in the Salmonellas detection, different target fragments is carried out reaction system, such as primer, dNTPs, Mg
2+The optimization of concentration, trimethyl-glycine etc., pass through prioritization scheme, repeatedly experiment, set up the loop-mediated isothermal amplification method that detects Salmonellas, and develop the LAMP test kit that detects Salmonellas, the sensitivity of this test kit can detect 10 copies in each reaction system, can satisfy the requirement of rapid detection Salmonellas.
Use LAMP test kit of the present invention to detect the method for Salmonellas, may further comprise the steps:
A) cultivate sample 1-4h to be checked with buffered peptone water (BPW) according to National Standard Method;
B) from testing sample, extract DNA with water-boiling method;
C) get b) step in sample DNA join in the reaction solution of LAMP test kit, 65 ℃ the insulation 1h; Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously;
D) after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
Rapid detection Salmonellas LAMP test kit provided by the invention can carry out qualitative detection to Salmonellas, and alternative traditional culture method of always continuing to use and serum method detection method.The present invention compared with prior art has the following advantages and effect:
1, compare with culture-based method, detection speed is fast, and only 1h adds the extraction preparation of sample DNA, altogether is no more than 5h.
2, specificity is good, and is highly sensitive;
3, step is simple, and is repeatable high;
4, can carry out simultaneously a plurality of sample detection.
Description of drawings
Fig. 1 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 1, among the figure:
1-standard positive template, 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 2 is Salmonellas 1.5% agarose gel electrophoresis detected result figure among the embodiment 1, among the figure:
1-DNA Marker, 2-standard positive template, 3-negative control,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas positive sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample, 9-Salmonellas negative sample;
Fig. 3 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 2, among the figure:
1-standard positive template, 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 4 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 3, among the figure:
1-standard positive template, 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 5 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 4, among the figure:
1-standard positive template, 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 6 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 5, among the figure:
1-standard positive template, 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 7 is the centrifugal rear observation white precipitate result of Salmonellas among the embodiment 6, among the figure:
The 1-standard positive template, the 2-negative control, 3-Salmonellas positive sample,
4-Salmonellas positive sample, 5-Salmonellas positive sample, 6-Salmonellas negative sample,
7-Salmonellas negative sample, 8-Salmonellas negative sample;
Fig. 8 is Salmonellas LAMP test kit specificity experimental observation white precipitate result among the embodiment 7, among the figure:
1-standard positive template, 2-negative control, 3-Salmonella paratyphi A,
4-moscow' paratyphi B, 5-Salmonella enteritidis, 6-Salmonella choleraesuls,
7-shigella dysenteriae, 8-streptococcus aureus;
Fig. 9 is that Salmonellas LAMP test kit sensitivity experiment is observed the white precipitate result among the embodiment 8, among the figure:
1-dilution 10
-1Doubly, 2-dilution 10
-2Doubly, 3-dilution 10
-3Doubly,
4-dilution 10
-4Doubly, 5-dilution 10
-5Doubly, 6-dilution 10
-6Doubly,
7-dilution 10
-7Doubly, 8-dilution 10
-8Doubly, 9-dilution 10
-9Doubly,
10-dilution 10
-10Doubly.
Embodiment
Below in conjunction with the implementation example, further set forth the present invention.Be to be understood that, these embodiments only are used for explanation the present invention and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition such as chief editors such as J. Pehanorm Brookers, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
Embodiment 1:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, and reagent forms:
A) LAMP reaction mixture
The LAMP reaction mixture is by LAMP 10 * buffer 2.5 μ l, and 10 μ mol/L inner primer FIP, BIP be 2.0 μ l respectively, each 1.0 μ l of 10 μ mol/L outer primer F3, B3,10mmol/L dNTPs 3.0 μ l, 50mmol/LMgSO
43.0 μ l, 5.0mol/L trimethyl-glycine 4.5 μ l, Bst archaeal dna polymerase large fragment 1.0 μ l form, reaction solution cumulative volume 20 μ l.
Wherein primer sequence is as follows:
Upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:5 '-ATCCGCATCAATAATACCGGCCTTTGGTATGCCCGGTAAACAGA-3 ';
Downstream inner primer BIP:5 '-GAACGGCGAAGCGTACTGGACATCGCACCGTCAAAGGAA-3 ';
B) standard positive template
Standard positive template pMD18-T-invA is the pMD18-T-invA carrier that contains the nucleotide fragments formation of 317 base pairs of Salmonellas high conservative gene invA gene, and this carrier can be bred in bacillus coli DH 5 alpha.Testing used standard substance is the plasmid pMD18-T-invA that contains the purpose amplified fragments, uses alkaline lysis method of extracting after this plasmid transformation escherichia coli DH5 α propagation, through DNA purification kit purifying, and-20 ℃ of preservations.
C) negative quality control standard product
Negative quality control standard product are aseptic double-distilled water.
2. use described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect the method for Salmonellas, may further comprise the steps:
A, foodstuff samples pre-treatment: get 3 portions of positive food of Salmonellas of identifying through culture-based method, 3 portions of negative food of Salmonellas, taking by weighing respectively 25g(mL) sample puts into the aseptic homogeneous cup that fills 225mL BPW, with 8000r/min～10000r/min homogeneous 1min～2min, or place the aseptic homogenizing bag that fills 225mL BPW, pat 1min～2min with slap type homogenizer.If sample is liquid, do not need homogeneous, the vibration mixing gets final product.Aseptic technique goes to sample in the 500mL Erlenmeyer flask, as using homogenizing bag, can directly cultivate, and cultivates 1-4h in 36 ℃ ± 1 ℃.As be frozen prods, should thaw being no more than 15min below 45 ℃.
The preparation of b, bacterium template DNA: get respectively 100 μ L bacterial culturess, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
C, LAMP reaction: get respectively 5 μ l b) the sample supernatant joins in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min in the step.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
D, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 1).Get 5 μ l LAMP products and detect with 1.5% agarose gel electrophoresis, positive sample has band, and negative sample is then without band (seeing accompanying drawing 2).Accompanying drawing 1 is centrifugal rear observation white precipitate result, and accompanying drawing 2 is 1.5% agarose gel electrophoresis detected result.
E, conclusion: revision test is 3 times repeatedly, and the gained detected result is identical, and experimental group all has precipitation or electrophoretic band, and control group is all without precipitation or electrophoretic band, and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, the precipitation observation is consistent with electrophoresis detection method effect, and the detected result between the different batches has comparability, has good repeatability.
Embodiment 2:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:5 '-GCGCAGCATCCGCATCAATAATGGTATGCCCGGTAAACAGAT-3 ';
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Salmonellas are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 3), and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 3:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:5 '-GCGCAGCATCCGCATCAATAATATGCCCGGTAAACAGATGAG-3 ';
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Salmonellas are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 4), and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 4:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 ';
Downstream outer primer B3:5 '-GCGGAGGACAAATCCATACC-3 ';
Upstream inner primer FIP:5 '-CAGTACGCTTCGCCGTTCGCTTGATGCCGATTTGAAGGCC-3 ';
Downstream inner primer BIP:5 '-GGTGACGCTATTGCCGGCATCCACCGAAATACCGCCAAT-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Salmonellas are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 5), and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 5:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 ';
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 ';
Upstream inner primer FIP:5 '-GGCTTTCCCTTTCCAGTACGCTAGGCCGGTATTATTGATGCG-3 ';
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Salmonellas are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 6), and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 6:
1. novel quick visualization detects Salmonellas LAMP test kit composition and preparation, is that from the difference of embodiment 1 described test kit specific primer sequence is different, and the primer sequence of this test kit is as follows:
Upstream outer primer F3:5 '-AGGCCGGTATTATTGATGCG-3 ';
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 ';
Upstream inner primer FIP:5 '-ACTTCATCGCACCGTCAAAGGAGAACGGCGAAGCGTACTG-3 ';
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 ';
2. method and the embodiment 1 described method of using described PCR test kit based on the Salmonellas of causing a disease in the loop-mediated isothermal amplification technique rapid detection industrial food to detect Salmonellas are identical, revision test is 3 times repeatedly, the gained detected result is identical, experimental group all has precipitation, control group is all without precipitation (seeing accompanying drawing 7), and is consistent with expected results.Illustrate that this test kit detects Salmonellas respond well, and the detected result between the different batches has comparability, have good repeatability.
Embodiment 7: based on the specificity experiment of the PCR test kit of pathogenic Salmonellas in the loop-mediated isothermal amplification technique rapid detection industrial food
The preparation of a, dna profiling: the bacterium liquid 10 μ l of the Salmonella paratyphi A of the DNA validation verification of learning from else's experience respectively, moscow' paratyphi B, Salmonella enteritidis, Salmonella choleraesuls, shigella dysenteriae, streptococcus aureus, the centrifugal 2min of 12000r/min, remove supernatant, add 50 μ L sterilized waters, abundant mixing, 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get 5 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously.
C, result judge: the centrifugal 30S of 12000r/min after question response finishes, observe to have or not to precipitate producing (seeing accompanying drawing 8).Accompanying drawing 8 is Salmonellas LAMP test kit specificity experimental observation white precipitate result.
D, conclusion: result's demonstration only has positive criteria product, Salmonella paratyphi A, moscow' paratyphi B, Salmonella enteritidis, Salmonella choleraesuls adularescent precipitation, and shigella dysenteriae, streptococcus aureus and negative control do not have white precipitate.
Above-mentioned this test kit of description of test has good specificity.
Embodiment 8: rapid detection Salmonellas LAMP test kit sensitivity experiment
A, the Salmonellas nutrient solution of getting the 1ml incubated overnight are done 10 times of doubling dilutions, are diluted to 10
-9Get each dilution bacterium liquid 10 μ l, the centrifugal 2min of 12000r/min removes supernatant, adds 50 μ L sterilized waters, abundant mixing, and 100 ℃ of water-bath 10min, the centrifugal 2min of 12000r/min, supernatant is template DNA.
B, LAMP the reaction: get 5 μ l a) go on foot in the sample supernatant join in the 20 μ l LAMP reaction solutions 65 ℃ of constant-temperature amplification 60min.
C, result judge: whether reaction produces white precipitate at the bottom of the centrifugal 30s observation tube of 12000r/min after finishing, and the result shows 10
-1-10
-8Equal adularescent precipitation at the bottom of the sample tube, 10
-9-10
-10Then there is not white precipitate (seeing accompanying drawing 9) at the bottom of the sample tube.Accompanying drawing 9 is that Salmonellas LAMP test kit sensitivity experiment is observed the white precipitate result.
D, conclusion: the result shows that working as bacterium liquid is diluted to 10
-8In time, still can detect, and the lowest detection limit is 50CFU/ml.
Above-mentioned this test kit of description of test has good sensitivity.
Can illustrate from above-mentioned example, LAMP detection method specificity is good, highly sensitive, good reproducibility, easy and simple to handle, and the LAMP detection kit only needs just can finish less than 5 hours to the detection of sample, and traditional culture method approximately just can be finished about 1 week of need, therefore, use this test kit greatly to shorten detection time.
The operation of this test kit only needs 1 people can finish whole operating process, once can detect a plurality of (being needed to determine by the reality detection) sample, has so also reduced the waste of manpower.
SEQUENCE LISTING
＜110〉the true good fortune medical sci-tech in Wuhan Development Co., Ltd
＜120〉the LAMP test kit of rapid detection Salmonellas
<130>
<160> 25
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 1
cggcccgatt ttctctgg 18
<210> 2
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 2
cggcaatagc gtcacctt 18
<210> 3
<211> 44
<212> DNA
＜213〉artificial sequence
<400> 3
atccgcatca ataataccgg cctttggtat gcccggtaaa caga 44
<210> 4
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 4
gaacggcgaa gcgtactgga catcgcaccg tcaaaggaa 39
<210> 5
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 5
cggcccgatt ttctctgg 18
<210> 6
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 6
cggcaatagc gtcacctt 18
<210> 7
<211> 42
<212> DNA
＜213〉artificial sequence
<400> 7
gcgcagcatc cgcatcaata atggtatgcc cggtaaacag at 42
<210> 8
<211> 38
<212> DNA
＜213〉artificial sequence
<400> 8
gcgaacggcg aagcgtactg tcgcaccgtc aaaggaac 38
<210> 9
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 9
cggcccgatt ttctctgg 18
<210> 10
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 10
cggcaatagc gtcacctt 18
<210> 11
<211> 42
<212> DNA
＜213〉artificial sequence
<400> 11
gcgcagcatc cgcatcaata atatgcccgg taaacagatg ag 42
<210> 12
<211> 38
<212> DNA
＜213〉artificial sequence
<400> 12
gcgaacggcg aagcgtactg tcgcaccgtc aaaggaac 38
<210> 13
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 13
tgcccggtaa acagatgagt 20
<210> 14
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 14
gcggaggaca aatccatacc 20
<210> 15
<211> 40
<212> DNA
＜213〉artificial sequence
<400> 15
cagtacgctt cgccgttcgc ttgatgccga tttgaaggcc 40
<210> 16
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 16
ggtgacgcta ttgccggcat ccaccgaaat accgccaat 39
<210> 17
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 17
tgcccggtaa acagatgagt 20
<210> 18
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 18
agcggaggac aaatccatac 20
<210> 19
<211> 42
<212> DNA
＜213〉artificial sequence
<400> 19
ggctttccct ttccagtacg ctaggccggt attattgatg cg 42
<210> 20
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 20
aaggtgacgc tattgccggc ccaccgaaat accgccaat 39
<210> 21
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 21
aggccggtat tattgatgcg 20
<210> 22
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 22
agcggaggac aaatccatac 20
<210> 23
<211> 40
<212> DNA
＜213〉artificial sequence
<400> 23
acttcatcgc accgtcaaag gagaacggcg aagcgtactg 40
<210> 24
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 24
aaggtgacgc tattgccggc ccaccgaaat accgccaat 39
<210> 25
<211> 317
<212> DNA
＜213〉Salmonellas
<400> 25
cagtttatcg ttattaccaa aggttcagaa cgcgtcgcgg aagtcgcggc ccgattttct 60
ctggatggta tgcccggtaa acagatgagt attgatgccg atttgaaggc cggtattatt 120
gatgcggatg ctgcgcgcga acggcgaagc gtactggaaa gggaaagcca gctttacggt 180
tcctttgacg gtgcgatgaa gtttatcaaa ggtgacgcta ttgccggcat cattattatc 240
tttgtgaact ttattggcgg tatttcggtg gggatgaccc gccatggtat ggatttgtcc 300
tccgctctgt ctactta 317
Claims (4)
1. the LAMP test kit of a rapid detection Salmonellas is characterized in that, is comprised of LAMP reaction solution, standard positive template, negative quality control standard product; The LAMP reaction solution contains primer, and primer is any a group in following 6 group-specific primerses:
(1) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:
5′-ATCCGCATCAATAATACCGGCCTTTGGTATGCCCGGTAAACAGA-3′；
Downstream inner primer BIP:5 '-GAACGGCGAAGCGTACTGGACATCGCACCGTCAAAGGAA-3 ';
(2) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:5 '-GCGCAGCATCCGCATCAATAATGGTATGCCCGGTAAACAGAT-3 ';
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 ';
(3) upstream outer primer F3:5 '-CGGCCCGATTTTCTCTGG-3 ';
Downstream outer primer B3:5 '-CGGCAATAGCGTCACCTT-3 ';
Upstream inner primer FIP:5 '-GCGCAGCATCCGCATCAATAATATGCCCGGTAAACAGATGAG-3 ';
Downstream inner primer BIP:5 '-GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC-3 ';
(4) upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 ';
Downstream outer primer B3:5 '-GCGGAGGACAAATCCATACC-3 ';
Upstream inner primer FIP:5 '-CAGTACGCTTCGCCGTTCGCTTGATGCCGATTTGAAGGCC-3 ';
Downstream inner primer BIP:5 '-GGTGACGCTATTGCCGGCATCCACCGAAATACCGCCAAT-3 ';
(5) upstream outer primer F3:5 '-TGCCCGGTAAACAGATGAGT-3 ';
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 ';
Upstream inner primer FIP:5 '-GGCTTTCCCTTTCCAGTACGCTAGGCCGGTATTATTGATGCG-3 ';
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 ';
(6) upstream outer primer F3:5 '-AGGCCGGTATTATTGATGCG-3 ';
Downstream outer primer B3:5 '-AGCGGAGGACAAATCCATAC-3 ';
Upstream inner primer FIP:5 '-ACTTCATCGCACCGTCAAAGGAGAACGGCGAAGCGTACTG-3 ';
Downstream inner primer BIP:5 '-AAGGTGACGCTATTGCCGGCCCACCGAAATACCGCCAAT-3 '.
2. PCR test kit according to claim 1 is characterized in that, the LAMP reaction solution is by outer primer, the inner primer of 10 μ mol/L, 5mol/L trimethyl-glycine, the 50mmol/L MgSO of Bst archaeal dna polymerase large fragment, LAMP10 * buffer, 10 μ mol/L
4Form with 10mmol/L dNTPs.
3. PCR test kit according to claim 1 and 2, it is characterized in that, standard positive template is the pMD18-T-invA carrier that contains the nucleotide fragments formation of 317 base pairs of Salmonellas high conservative gene invA gene, and the nucleotide sequence of invA gene is shown in SEQ ID No.25.
4. right to use requires 1～3 described LAMP test kit to detect the method for Salmonellas, it is characterized in that, may further comprise the steps:
1. cultivate sample 4h to be checked with buffered peptone water according to National Standard Method;
2. from testing sample, extract DNA with water-boiling method;
3. DNA is joined in the reaction system of LAMP test kit 65 ℃ of insulation 1h; Do respectively positive control and negative control with standard positive template and negative quality control standard product simultaneously;
4. after reaction finished, centrifugal, the visual inspection precipitation was carried out qualitative analysis to sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103556015A CN102851383A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Salmonella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103556015A CN102851383A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Salmonella |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102851383A true CN102851383A (en) | 2013-01-02 |
Family
ID=47398357
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103556015A Pending CN102851383A (en) | 2012-09-21 | 2012-09-21 | LAMP kit for rapid detection of Salmonella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102851383A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN103627811A (en) * | 2013-12-11 | 2014-03-12 | 东北农业大学 | Kit for rapidly detecting salmonella in meat and application thereof |
| CN105219772A (en) * | 2015-11-15 | 2016-01-06 | 中国疾病预防控制中心传染病预防控制所 | One group of nucleotide sequence and the application in salmonella and shigella detect |
| CN108754001A (en) * | 2018-06-13 | 2018-11-06 | 华南理工大学 | Primer, kit and detection method based on polymerase spiral response Constant Temperature Detection salmonella |
| CN109182467A (en) * | 2018-08-24 | 2019-01-11 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection salmonella |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101153327A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting salmonella |
| CN101603071A (en) * | 2008-06-12 | 2009-12-16 | 陈福生 | The method of a kind of while rapid detection salmonella and shigella |
| CN102586438A (en) * | 2012-02-28 | 2012-07-18 | 武汉大学 | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms |
-
2012
- 2012-09-21 CN CN2012103556015A patent/CN102851383A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101153327A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting salmonella |
| CN101603071A (en) * | 2008-06-12 | 2009-12-16 | 陈福生 | The method of a kind of while rapid detection salmonella and shigella |
| CN102586438A (en) * | 2012-02-28 | 2012-07-18 | 武汉大学 | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN103627811A (en) * | 2013-12-11 | 2014-03-12 | 东北农业大学 | Kit for rapidly detecting salmonella in meat and application thereof |
| CN103627811B (en) * | 2013-12-11 | 2015-07-01 | 东北农业大学 | Kit for rapidly detecting salmonella in meat and application thereof |
| CN105219772A (en) * | 2015-11-15 | 2016-01-06 | 中国疾病预防控制中心传染病预防控制所 | One group of nucleotide sequence and the application in salmonella and shigella detect |
| CN108754001A (en) * | 2018-06-13 | 2018-11-06 | 华南理工大学 | Primer, kit and detection method based on polymerase spiral response Constant Temperature Detection salmonella |
| CN109182467A (en) * | 2018-08-24 | 2019-01-11 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection salmonella |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CN106434891A (en) | Method for rapidly detecting Shigella at constant temperature, primers used for method and kit | |
| CN102864228A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus | |
| CN102864226A (en) | LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN102816847B (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN102747165A (en) | Reagent kit and method for quickly detecting tilapia streptococcus agalactiae by using loop-mediated isothermal amplification technology | |
| CN102851382A (en) | LAMP kit for rapid detection of Shigella | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN102851381A (en) | LAMP kit for rapid detection of Listeria monocytogenes | |
| CN103952472B (en) | For the primer of Streptococcus iniae LAMP-LFD Visual retrieval and the application of probe and primer and probe | |
| CN111073986B (en) | Rapid constant-temperature detection method for salmonella, primer group and application | |
| CN103276061B (en) | Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof | |
| CN102864229A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting campylobacter jejuni | |
| CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| Mu et al. | Detection of Brucella S2 vaccine strain by a loop-mediated isothermal amplification (LAMP) method | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN104328206B (en) | The LAMP detection method and its primer special of clostridium difficile binary toxin and test kit | |
| CN106434900A (en) | Method for conducting rapid constant-temperature detection on vibrio vulnificus and vibrio cholerae simultaneously, primer and kit | |
| CN107287315B (en) | Detection kit for Shigella, detection method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130102 |