CN107287315B - Detection kit for Shigella, detection method and application - Google Patents
Detection kit for Shigella, detection method and application Download PDFInfo
- Publication number
- CN107287315B CN107287315B CN201710552746.7A CN201710552746A CN107287315B CN 107287315 B CN107287315 B CN 107287315B CN 201710552746 A CN201710552746 A CN 201710552746A CN 107287315 B CN107287315 B CN 107287315B
- Authority
- CN
- China
- Prior art keywords
- shigella
- detection
- detection kit
- probe
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, and particularly discloses a detection kit for Shigella, a detection method and application. The method has strong specificity, high sensitivity, and detection limit of 3.5 × 10‑3ng/mu L, the detection can be completed only in 20min at the constant temperature of 39 ℃, the detection time is only 7-12min, the effective detection of the shigella in the food sample can be realized, the method can be used for field detection, and a new method is provided for the detection of the shigella in food and food-borne public health events.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a detection kit for shigella, a detection method and application.
Background
Food-borne diseases are currently important public health problems of concern all over the world, and tens of millions of people suffer from diseases caused by the infection of food-borne pathogenic bacteria and death caused by serious diseases in developed countries and developing countries every year. Shigella (Shigella) is one of the main food-borne pathogenic bacteria, and is the leading cause of infectious diarrhea in China. The Shigella is composed of 4 gram-negative, non-motile, spore-forming rod-shaped bacteria, which are Shigella boydii, Shigella dysenteriae, Shigella flexneri and Shigella sonnei, respectively. Shigella, being more virulent, can cause bacillary dysentery in humans, and can manifest mild dysentery, fever, abdominal cramps, and severe fluid loss.
The current molecular biology detection method can effectively overcome part of disadvantages of the traditional detection method and is favored by most researchers, wherein the Recombinase Polymerase Amplification (RPA) technology is widely concerned due to the advantages of strong specificity, high sensitivity, short reaction time, simple operation and the like, and has great development prospect.
The traditional Shigella detection mainly depends on bacterial culture and a series of biochemical identification, the detection period is long, and rapid detection cannot be realized. Various methods for detecting shigella have been established. The conventional detection procedures need enrichment, selective plate separation culture, biochemical test, serological separation identification and the like, the time consumption is long, the operation is complicated, and the requirements of large-batch sample detection or sudden public health event processing are difficult to meet. In the aspect of molecular biological detection, commonly used methods include Polymerase Chain Reaction (PCR), loop-mediated isothermal amplification (LAMP), gene chip technology, and the like. The PCR reaction consists of three basic steps of denaturation, annealing and extension, electrophoresis detection is carried out after the reaction is finished, products need to be purified or sequenced and analyzed when necessary, and generally, experienced technicians are required to operate the PCR reaction, and an expensive PCR instrument is required. When the target fragment is amplified by LAMP, the LAMP depends on DNA polymerase with strand displacement property and 4-6 primers capable of identifying six specific regions of a target sequence, the design of the primers is relatively complicated, and an amplification product presents a gradient band through electrophoresis detection and is not easy to distinguish from a non-specific band.
Disclosure of Invention
Aiming at the problems of complex detection program, complicated primer design, expensive instrument and the like of the existing Shigella, the invention provides a detection kit for Shigella.
Furthermore, the invention also provides a detection method and application for Shigella.
In order to achieve the purpose of the invention, the embodiment of the invention adopts the following technical scheme:
a detection kit for Shigella is used for real-time fluorescence RPA detection of Shigella, takes Shigella invasion plasmid antigen H gene as a target gene, designs a pair of primers and a probe according to a conserved sequence thereof,
wherein, the sequences of the pair of primers and the probe are as follows:
an upstream primer: 5'-CTGCATGGCTGGAAAAACTCAGTGCCTCTG-3'
A downstream primer: 5'-GTTCTGACTTTATCCCGGGCAATGTCCTCC-3'
And (3) probe: 5'-CCATCAGGCATCTGAAGGCCTTTTCGA-FAM-dT-THF-A-BHQ 1-dT-GATACCGGCGCTCTGCTC-C3-3'.
Further, the invention also provides a detection method for Shigella, which is a real-time fluorescence RPA method and at least comprises the following steps:
and 3, determining whether the shigella exists in the sample to be detected by judging whether the reaction result is positive or not.
The research takes Shigella invasive plasmid antigen H gene (ipaH) as a target gene, and designs a specific primer and an exo probe according to a conserved sequence of the target gene, thereby establishing a real-time RPA method for rapidly detecting Shigella in food.
Compared with the prior art, the establishment of the real-time fluorescence RPA method for detecting Shigella provided by the invention has the following advantages: (1) the operation is simple and convenient, the detection can be carried out on a machine only after the enrichment and the extraction of nucleic acid, and all reagents are stored in a reaction tube in the form of freeze-dried powder; (2) the reaction time is short, thermal denaturation is not needed, and the reaction can be completed within 20 min; (3) the reaction result can be directly observed without electrophoresis detection; (4) use of a portable fluorescence detection device. The Genie III isothermal amplification fluorescence detection system used in the research is compact, small, light and durable, is only about 1.75kg, is operated by a touch screen without being connected with a computer, is internally provided with a long endurance lithium battery, can work outdoors all day long in a power-free environment, and can be used for field detection of microbial food poisoning events.
Further, the invention also provides application of the detection kit or the detection method in the technical field of shigella detection.
In the research, the established real-time RPA method is used for detecting different samples of the artificially polluted Shigella, and when the sample pollution amount is 46CFU/25g and the bacteria are increased for 6 hours, the Shigella can be detected in chicken. The real-time RPA and real-time PCR detection results in the present study are consistent, but the time required for the detection of the former is significantly shorter than that of the latter.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to these drawings without creative efforts.
FIG. 1 is a graphical representation of the results of real-time RPA sensitivity tests provided by embodiments of the present invention;
FIG. 2 is a graphical representation of the results of real-time PCR sensitivity tests provided by comparative examples of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
A detection kit for Shigella is used for real-time fluorescence RPA detection of Shigella, takes Shigella invasion plasmid antigen H gene as a target gene, designs a pair of primers and a probe according to a conserved sequence thereof,
wherein, the sequences of the pair of primers and the probe are as follows:
an upstream primer: 5'-CTGCATGGCTGGAAAAACTCAGTGCCTCTG-3'
A downstream primer: 5'-GTTCTGACTTTATCCCGGGCAATGTCCTCC-3'
And (3) probe: 5'-CCATCAGGCATCTGAAGGCCTTTTCGA-FAM-dT-THF-A-BHQ 1-dT-GATACCGGCGCTCTGCTC-C3-3'.
Preferably, the detection kit further comprises a lyophilized enzyme preparation and a magnesium acetate solution.
Preferably, the reaction system of the detection kit comprises the following components: mu.L of 10. mu.M forward primer, 2. mu.L of 10. mu.M reverse primer, 0.6. mu.L of 10. mu.M probe, 12.5. mu.L of 20% polyethylene glycol, 1. mu.L of viral DNA template, 29.4. mu.L of ddH2O。
Preferably, the lyophilized enzyme preparation comprises 1mM deoxyribonucleoside triphosphate, 90 ng/. mu.L single-stranded binding protein, 120 ng/. mu.L recA recombinase, 30 ng/. mu.L Bsu DNA polymerase, 30 ng/. mu.L Exo-exonuclease, 100mmol/L trihydroxymethyl glycine, polyethylene glycol at a concentration of 20% by volume, 5mM dithiothreitol, and 100 ng/. mu.L creatine kinase.
The invention also provides a detection method for Shigella, which is a real-time fluorescence RPA method and at least comprises the following steps:
and 3, determining whether the shigella exists in the sample to be detected by judging whether the reaction result is positive or not.
Preferably, the isothermal amplification reaction is performed in an isothermal amplification fluorescence detector set at a temperature of 39 ℃ for 20 min.
Preferably, the final concentration of the upstream primer and the final concentration of the downstream primer of the Shigella are both 0.4. mu.M, and the final concentration of the probe is 0.12. mu.M.
Preferably, the extraction of the DNA of shigella comprises the steps of: inoculating Shigella sonnei pure culture bacteria into 8-12mL of nutrient broth, and culturing at 34-36 deg.C for 16-18 h; centrifuging 1mL of bacterial liquid at 10000rpm for 1min, and removing supernatant; and (3) extracting bacterial genome DNA from the bacterial precipitation according to a bacterial DNA extraction kit method, and immediately using the bacterial genome DNA after extraction or storing the bacterial genome DNA at the temperature of minus 20 ℃ for later use.
Preferably, the nucleic acid concentration of the extracted bacterial genomic DNA is determined using a ultramicro spectrophotometer.
The invention also provides application of the detection kit or the detection method in the field of shigella detection.
The following examples are provided to better illustrate the embodiments of the present invention.
The real-time fluorescence RPA method for detecting Shigella provided in the present embodiment and comparative example is established by using the following main reagents and devices: bacterial culture media such as Shigella enrichment broth, Xylose Lysine Deoxycholate (XLD) agar, nutrient broth and the like are purchased from Beijing Luqiao technology, Inc.; bacterial genome DNA extraction kits and the like purchased from Tiangen Biotechnology (Beijing) Ltd; premix Ex Taq was purchased from Bao bioengineering (Dalian) Inc.; the RAA kit (fluorescent type) was purchased from Zhejiang Taijing Biotech limited; the primers and probes were synthesized by Biotechnology engineering (Shanghai) Inc.
Genie III isothermal amplification fluorescent detection System, OptiGene, UK; ABI7500 real-time fluorescent PCR instrument, ABI corporation, usa; NanoDrop2000C ultramicro spectrophotometer, Thermo Scientific, USA.
Example 1 detection method for Shigella-establishment of real-time fluorescent RPA method
1. Design and preparation of primer and probe sequence
The research takes Shigella invasive plasmid antigen H gene (ipaH) as a target gene, and designs a specific primer and an exo probe according to a conserved sequence of the target gene, thereby establishing a real-time RPA method for rapidly detecting Shigella in food.
The inventor analyzes the sequence of the shigella ipaH gene (accession number: AE005674) in GeneBank, selects a conserved region, designs a real-time RPA primer and an exo probe, and the size of a target fragment is 247 bp.
The present invention designs and synthesizes a pair of primers and a probe, as shown in Table 1.
TABLE 1 Shigella real-time RPA primers and probes designed by the present invention
2. Shigella strain and extraction of bacterial genome DNA
Inoculating pure culture strain of Shigella (CICC21679) into 10mL of nutrient broth, and culturing at 36 deg.C for 18 h; adding 1mL of bacterial liquid into a 1.5mL pipette, centrifuging at 10000rpm for 1min, and removing supernatant; extracting bacterial DNA from the thallus precipitate according to the method of the bacterial genome DNA extraction kit, immediately using or storing at-20 ℃ for later use, and simultaneously measuring the concentration of the extracted nucleic acid of the Shigella sonnei by using a NanoDrop2000C ultramicro spectrophotometer.
3. Preparation of Shigella detection kit
A single reaction system was prepared using the RAA kit (fluorescent type) as follows: mu.L of 10. mu.M forward primer (final concentration of 0.4. mu.M), 2. mu.L of 10. mu.M reverse primer (final concentration of 0.4. mu.M), 0.6. mu.L of 10. mu.M probe (final concentration of 0.12. mu.M), 12.5. mu.L of 20% by volume polyethylene glycol, 1. mu.L of viral DNA template, 29.4. mu.L of ddH2And O. And uniformly mixing 47.5 mu L of the system, adding the mixed system into a reaction tube filled with the freeze-dried enzyme preparation, blowing and beating the mixed system up and down by using a pipette until the mixed system is completely dissolved, adding 2.5 mu L of 280mM magnesium acetate into the reaction tube, performing instantaneous centrifugation and vortex, and putting the mixture into an isothermal amplification fluorescence detector Genie III, wherein the temperature is set to be 39 ℃, and the reaction time is 20 min.
The freeze-dried enzyme preparation comprises 1mM of deoxyribonucleoside triphosphate, 90 ng/. mu.L of single-chain binding protein, 120 ng/. mu.L of recA recombinase, 30 ng/. mu.L of Bsu DNA polymerase, 30 ng/. mu.L of Exo exonuclease, 100mmol/L of trihydroxymethyl glycine, polyethylene glycol with the volume concentration of 20%, 5mM of dithiothreitol and 100 ng/. mu.L of creatine kinase.
4. Establishment of real-time RPA method as shigella detection method
The establishment of the detection method comprises the following steps:
the amplification reaction is carried out in an isothermal amplification fluorescence detector with the temperature set to 37-39 ℃, and the reaction time is 20-30 min;
and 3, determining whether the shigella exists in the sample to be detected by judging whether the reaction result is positive or not.
In order to better illustrate the technical solution of the present invention, further comparison is made below by means of a comparative example and an example of the present invention.
Comparative example 1 establishment of real-time PCR method for Shigella detection
1. A pair of primers and probes for real-time PCR are shown in Table 2.
TABLE 2 real-time PCR primers and probes of Shigella designed by the present invention
2. Establishment of real-time PCR method
The reaction system is as follows: mu.L of 10. mu.M forward primer (final concentration of 0.8. mu.M), 2. mu.L of 10. mu.M reverse primer (final concentration of 0.8. mu.M), 0.9. mu.L of 5. mu.M probe (final concentration of 0.18. mu.M), 12.5. mu.L of Premix Ex Taq, 1. mu.L of viral DNA template, 6.6. mu.L of ddH2O。
The system is fully and uniformly mixed and then put into an ABI7500 real-time fluorescent PCR instrument, and the reaction program is set as follows: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, extension at 60 ℃ for 35s, 35 cycles, and fluorescence signal collection at 60 ℃.
To better illustrate the application of the real-time fluorescent RPA method for Shigella detection provided in the examples of the present invention, example 1 and comparative example 1 were conducted as specificity and sensitivity tests and tests for detection of artificially contaminated samples, respectively.
Specificity test
The real-time RPA reaction was performed using genomic DNA of the strains shown in Table 3 as a template to determine whether a specific amplification curve was present.
TABLE 3
Note: +, positive result; negative results.
The real-time RPA detection is carried out by taking DNA of shigella and other bacteria as templates, the result is shown in Table 3, only shigella presents a typical amplification curve, and other bacteria do not amplify, which indicates that the method has good specificity.
Sensitivity test
Shigella genomic DNA at a concentration of 35 ng/. mu.L using ddH2O10 times gradient, after 7 gradients are serially diluted, each gradient DNA is respectively subjected to real-time RPA and real-time PCR reaction, the sensitivity of the method is determined, and the detection results are shown in FIG. 1 and FIG. 2.
FIG. 1 shows the real-time RPA detection result, and FIG. 2 shows the real-time PCR detection result. 1: 3.5X 10 in FIGS. 1 and 21ng/μL；2:3.5×100ng/μL；3:3.5×10-1ng/μL；4:3.5×10-2ng/μL；5:3.5×10-3ng/μL；6:3.5×10-4ng/μL；7:3.5×10-5ng/μL。
As can be seen from the results of the tests shown in FIGS. 1 and 2, the detection limit of real-time RPA is 3.5X 10-3ng/uL, which is consistent with the detection limit of the real-time PCR method.
Test for detection of artificially contaminated sample
Performing night pure culture on Shigella sonnei (CICC21679), performing gradient dilution by 10 times with normal saline, and selecting 10-5、10-6、10-7Three dilutions of 200. mu.L of inoculum were spread on XLD agar plates and 3 replicates were used to calculate the initial concentration of pure cultures. Selecting bacteria within the range of 1-10, 10-50 and 50-100CFU, and adding the bacteria into 25g of broccoli and 25g of chicken samples respectively (the samples are detected according to GB4789.5-2012 in advance, and Shigella is not detected); then added into 225mL Shigella enrichment broth and cultured at 36 ℃. After 6h and 8h of enrichment, 1mL of bacterial liquid is respectively taken to extract the bacterial DNA by referring to the extraction method of the bacterial genome DNA provided by the invention, 1 mu L of bacterial liquid is taken as a template to carry out real-time RPA and real-time PCR detection, and the detection results are shown in Table 4.
TABLE 4 test results of the detection of artificially contaminated samples
Note: -, no detection.
As can be seen from Table 4, real-time RPA detection results after enrichment of broccoli and chicken samples artificially contaminated with Shigella indicate that the Shigella in the two samples can be detected when the enrichment time is 8 h; when the sample pollution amount is 46CFU/25g and the bacteria increasing time is 6h, shigella in the chicken sample can be detected, but broccoli sample cannot be detected; when the sample pollution amount is 101CFU/25g and the bacterium increasing time is 6h, the Shigella flexneri in the two samples can be detected. The detection results of the two methods are consistent for all samples, but the real-time RPA only needs 7-12min, while the real-time PCR needs more than 35min (Ct value is between 27 and 34).
Under the condition of the same bacterial pollution amount and the same bacteria enrichment time, the time required for detecting the shigella in the chicken is less than that of a broccoli sample, which is probably caused by different efficiencies of extracting nucleic acid from different substrates or different bacterial reproduction amounts in different media.
The real-time RPA method for Shigella provided by the invention has the advantages of strong specificity, high sensitivity, simple operation and short reaction time, can realize effective detection of Shigella in food samples, can be used for field detection, and provides a new method for detection of Shigella in food and food-borne public health events.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents or improvements made within the spirit and principle of the present invention should be included in the scope of the present invention.
Sequence listing
<110> inspection and quarantine technology center of entry and exit inspection and quarantine bureau of Hebei river
<120> detection kit for Shigella, detection method and application
<130>2017
<160>6
<170>PatentIn version 3.5
<210>1
<211>30
<212>DNA
<213> Artificial sequence
<400>1
ctgcatggct ggaaaaactc agtgcctctg 30
<210>2
<211>30
<212>DNA
<213> Artificial sequence
<400>2
gttctgactt tatcccgggc aatgtcctcc 30
<210>3
<211>46
<212>DNA
<213> Artificial sequence
<400>3
ccatcaggca tctgaaggcc ttttcgaaga taccggcgct ctgctc 46
<210>4
<211>24
<212>DNA
<213> Artificial sequence
<400>4
ttcgtgcatg tcttacctct aagg 24
<210>5
<211>23
<212>DNA
<213> Artificial sequence
<400>5
tgcaagcagg gagtacaggt aac 23
<210>6
<211>22
<212>DNA
<213> Artificial sequence ACCTGCGAGCCTTGGCGCTTTC
<400>6
acctgcgagc cttggcgctt tc 22
Claims (4)
1. A detection kit for Shigella, comprising: the detection kit is used for detecting Shigella by real-time fluorescence RPA, takes the Shigella invasion plasmid antigen H gene as a target gene, is designed with a pair of primers and a probe according to the conserved sequence,
wherein, the sequences of the pair of primers and the probe are as follows:
an upstream primer: 5'-CTGCATGGCTGGAAAAACTCAGTGCCTCTG-3'
A downstream primer: 5'-GTTCTGACTTTATCCCGGGCAATGTCCTCC-3'
And (3) probe: 5'-CCATCAGGCATCTGAAGGCCTTTTCGA-FAM-dT-THF-A-BHQ 1-dT-GATACCGGCGCTCTGCTC-C3-3'.
2. The detection kit for shigella according to claim 1, wherein: the detection kit also comprises a freeze-dried enzyme preparation and a magnesium acetate solution.
3. The detection kit for shigella according to claim 1 or 2, which is characterized in thatCharacterized in that: the reaction system of the detection kit comprises the following components: mu.L of 10. mu.M forward primer, 2. mu.L of 10. mu.M reverse primer, 0.6. mu.L of 10. mu.M probe, 12.5. mu.L of 20% polyethylene glycol, 1. mu.L of viral DNA template, 29.4. mu.L of ddH2O。
4. The detection kit for shigella according to claim 2, wherein: the freeze-dried enzyme preparation comprises 1mM of deoxyribonucleoside triphosphate, 90 ng/. mu.L of single-chain binding protein, 120 ng/. mu.L of recA recombinase, 30 ng/. mu.L of Bsu DNA polymerase, 30 ng/. mu.L of Exo exonuclease, 100mmol/L of trihydroxymethyl glycine, polyethylene glycol with the volume concentration of 20%, 5mM of dithiothreitol and 100 ng/. mu.L of creatine kinase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710552746.7A CN107287315B (en) | 2017-07-07 | 2017-07-07 | Detection kit for Shigella, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710552746.7A CN107287315B (en) | 2017-07-07 | 2017-07-07 | Detection kit for Shigella, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107287315A CN107287315A (en) | 2017-10-24 |
| CN107287315B true CN107287315B (en) | 2020-04-14 |
Family
ID=60100143
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710552746.7A Active CN107287315B (en) | 2017-07-07 | 2017-07-07 | Detection kit for Shigella, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107287315B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114561481B (en) * | 2022-04-20 | 2024-03-26 | 青岛国际旅行卫生保健中心(青岛海关口岸门诊部) | Shigella quick integrated detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421897A (en) * | 2012-08-07 | 2013-12-04 | 上海仁度生物科技有限公司 | RNA isothermal amplification nucleic acid detection kit aiming at Shigella (SH) |
| CN106636459A (en) * | 2016-10-18 | 2017-05-10 | 河北出入境检验检疫局检验检疫技术中心 | Fluorescent RT-RPA specific detection of American porcine reproductive and respiratory syndrome virus |
-
2017
- 2017-07-07 CN CN201710552746.7A patent/CN107287315B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421897A (en) * | 2012-08-07 | 2013-12-04 | 上海仁度生物科技有限公司 | RNA isothermal amplification nucleic acid detection kit aiming at Shigella (SH) |
| CN106636459A (en) * | 2016-10-18 | 2017-05-10 | 河北出入境检验检疫局检验检疫技术中心 | Fluorescent RT-RPA specific detection of American porcine reproductive and respiratory syndrome virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107287315A (en) | 2017-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755424B (en) | Escherichia coli ST131 strain detection primer, kit and detection method based on CRISPR | |
| CN110938677B (en) | Quick constant-temperature detection method for yersinia pseudotuberculosis nucleic acid and application | |
| EP3087202B1 (en) | Nucleic acid detection method and kit | |
| CN105671210A (en) | LAMP technology-based primer, kit and detection method for detecting Plum pox virus | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN107236812B (en) | Detection kit for bacillus cereus, detection method and application | |
| CN102094077A (en) | Kit for detecting genotype of mycobacterium tuberculosis clinical isolation strain quickly | |
| JP2007274934A (en) | Primer set and method for detecting food poisoning bacterium | |
| CN107287315B (en) | Detection kit for Shigella, detection method and application | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella | |
| CN111057775B (en) | Specific novel molecular target for identifying salmonella and rapid detection method thereof | |
| CN112280876A (en) | Primer, probe, kit and application for recombinase-mediated isothermal amplification detection | |
| CN111690759A (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN108315451B (en) | Primer and probe for detecting clostridium perfringens and application thereof | |
| CN113943828B (en) | Primer composition, kit and method for rapidly detecting toxic mushroom, namely, russula japonica based on LAMP | |
| CN109897912A (en) | A kind of LAMP primer and the method for detecting Plasmopara viticola | |
| CN115216552A (en) | Method and kit for rapidly detecting ralstonia solanacearum based on CRISPR/Cas12a-LAMP | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN115725756A (en) | RPA primer group, reagent and kit for detecting treponema pallidum and application of RPA primer group, reagent and kit | |
| CN111621578A (en) | RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method | |
| CN106755317B (en) | Primer, method and application for detecting rice orange leaf disease phytoplasma | |
| CN101824483B (en) | Detection kit for vibrio cholerae O139 group and detection method thereof | |
| CN117551799B (en) | Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application | |
| CN114032316A (en) | Primer group of shigella flexneri specific gene and application thereof | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |