CN117551799B - Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application - Google Patents

Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application Download PDF

Info

Publication number
CN117551799B
CN117551799B CN202410038146.9A CN202410038146A CN117551799B CN 117551799 B CN117551799 B CN 117551799B CN 202410038146 A CN202410038146 A CN 202410038146A CN 117551799 B CN117551799 B CN 117551799B
Authority
CN
China
Prior art keywords
primer pair
pcr amplification
primer
strains
detected
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410038146.9A
Other languages
Chinese (zh)
Other versions
CN117551799A (en
Inventor
陈宝鑫
夏立群
费晴
温依铭
李娜
张子雯
谢颖欣
高锐祖
董进
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong Ocean University
Original Assignee
Guangdong Ocean University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangdong Ocean University filed Critical Guangdong Ocean University
Priority to CN202410038146.9A priority Critical patent/CN117551799B/en
Publication of CN117551799A publication Critical patent/CN117551799A/en
Application granted granted Critical
Publication of CN117551799B publication Critical patent/CN117551799B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/365—Nocardia
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer combination for nocardia seriolae strain typing, a multiplex PCR identification method and application thereof, and belongs to the field of microorganisms. The invention discloses a primer combination I for amplifying ORF3336, ORF4608 and ORF5389 gene fragments, the sensitivity of which reaches 125 pg/mu L; the primer combination II is used for amplifying ORF3335, ORF4608 and ORF5389 gene fragments, and the sensitivity reaches 500 pg/mu L; the primer combination III is used for amplifying ORF3334, ORF4608 and ORF5389 gene fragments, and the sensitivity reaches 500 pg/mu L. The invention also discloses a multiple PCR identification method for the nocardia seriolae strain typing, which provides a new method for the rapid typing of nocardia seriolae isolated strains in aquatic product cases and helps to control and prevent nocardia seriolae diseases in fish.

Description

Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application
Technical Field
The invention relates to the field of microorganisms, in particular to a primer combination for nocardia seriolae strain typing, a multiplex PCR identification method and application.
Background
Nocardia of Sinorhizoma et ZuccNocardia seriolae) Is the main pathogen of fish nocardia, which is aerobe, gram positive Bacteria, most of which have no aerial silk, part of which has aerial mycelium, and the basal silk branches, and the diaphragm breaks into rod-shaped body and spheroid, and belongs to the bacterial domain (Bacteria), the phylum of the taxonomy (Firmicutes), the actinomycetes (actinomycetes), the order of the actinomycetes (actinobacilles), the Nocardiaceae (Nocardiaceae), and the genus nocardiaNocardia). The major pathological changes of fish nocardia are yellow or white nodules (granulomas) with a diameter of 1-5 mm formed by internal organs, and the inner edge of the gill cap or the gill wires of some diseased fish have nodules, fibroids in the abdominal cavity and skin ulcers. There is no obvious disease symptoms in the early stage of nocardia infection of fish, and white nodules are formed by the spleen, liver and kidney of the diseased fish in the middle and late stages of infection. According to statistical analysis, the death rate of fish after infection can reach 90%, the disease precursor of fish is not found in time, effective measures are taken, and the economic loss caused by fish death is difficult to control.
Nocardia of Sinorhizoma et al in 1968 were first prepared from Kariya et al in Seriola quinquefoliaSeriola quinqueradiata) Herba Seriolae with brown and purpleS. purpurascens) Separated from the fish body, the nocardia disease of the fish in the cultivation process is more and more serious along with the improvement of the intensive degree of the aquaculture industry, and the fish species with the disease include snakehead fish according to incomplete statisticsChanna argus) Scutellarin (Lateolabrax japonicus)Micropterus salmoides) Garrupa (garrupa)Epinephelusspp. and large yellow croaker @Larimichthys crocea) The eel is a kind of Chinese characterAnguilla japonica) Trachinotus ovatus(Trachinotus ovatus) About 42 kinds of fresh water and sea fish.
In recent years, nocardia in fish has been attracting more and more attention from scholars, and no effective method has been established for the genotyping of nocardia in quince. Common methods of strain typing include biochemical typing, serological typing, pulsed Field Gel Electrophoresis (PFGE), and the like. Xu et al state that biochemical typing is an effective bacterial typing reference tool and that rapid typing of bacterial strains cannot be achieved due to the considerable time and labor costs involved in this method. Serotyping has been considered as the "gold standard" for identifying pathogens and for epidemic monitoring and tracking in environmental and clinical samples, and plays a great role in bacterial genotyping, which, although widely and chronically used, has a number of drawbacks, including mainly: the steps for preparing antisera are complex, the detection process is long, cross reaction is easy to occur, and the like. PFGE is a bacterial typing technique developed for the first time in the 80 s of the 20 th century for separating macromolecular DNA or chromosomes, and has been regarded as a "gold standard" for clinically important bacterial molecular typing, however, PFGE requires expensive instruments and has relatively complex operation steps, does not have sufficient resolution to distinguish bands of almost the same size, and is greatly affected by human factors and is liable to generate a certain subjectivity. While multiplex PCR detection techniques are able to identify and differentiate the same species of different strains at the subspecies level, a minimum of one PCR tube per sample can be used. Therefore, the use of multiplex PCR for typing nocardia seriolae is particularly urgent in the context of the increasing need for rapid and accurate identification of nocardia seriolae.
Disclosure of Invention
The invention aims to provide a primer combination for nocardia seriolae strain typing, a multiplex PCR identification method and application thereof, so as to solve the problems in the prior art, and the multiplex PCR typing identification method determined by the screened primer combination provides a novel method for rapid typing of nocardia seriolae isolated strains in aquatic cases, is beneficial to preparing vaccines for preventing and controlling nocardia seriolae diseases by selecting the nocardia seriolae strains of the same type, and is helpful for preventing and controlling nocardia seriolae diseases in fish.
In order to achieve the above object, the present invention provides the following solutions:
the invention provides a primer combination for the typing identification of Nocardia seriolae strains, which comprises any one of a primer combination I, a primer combination II and a primer combination III;
the primer combination I is as follows: SEQ ID NO:11-12, primer pair I, SEQ ID NO:15-16 and SEQ ID NO:19-20, the specific sequence of which is shown as follows:
3336-F: CTGATCGAAACCCAAGACC；
3336-R: CTGTCGAAGGAATCGGTAAG；
4608-F: GAGGGCTCGGACTGGAT；
4608-R: GGAAGTGGTCGGGATGG；
5389-F: TGCTGGTGGAATGCGTGTC；
5389-R: CTTCGAGAATGGCGATGGA；
the primer combination II is as follows: SEQ ID NO:9-10, primer pair IV, SEQ ID NO:15-16 and SEQ ID NO:19-20, the specific sequence of which is shown as follows:
3335-F: ATATCGTGCTGGAAGGGACG；
3335-R: GGGTTGGTGAAGTTCTTGCG；
4608-F: GAGGGCTCGGACTGGAT；
4608-R: GGAAGTGGTCGGGATGG；
5389-F: TGCTGGTGGAATGCGTGTC；
5389-R: CTTCGAGAATGGCGATGGA；
the primer combination III is as follows: SEQ ID NO:7-8, primer pair V, SEQ ID NO:15-16 and SEQ ID NO:19-20, the specific sequence of which is shown as follows:
3334-F: CTCCTATGCTCATCTGGCCG；
3334-R: GGGTTGATCTCCACACTCGG；
4608-F: GAGGGCTCGGACTGGAT；
4608-R: GGAAGTGGTCGGGATGG；
5389-F: TGCTGGTGGAATGCGTGTC；
5389-R: CTTCGAGAATGGCGATGGA。
the invention also provides a kit for the typing identification of nocardia seriolae strains, which comprises the primer combination.
The invention also provides a multiplex PCR identification method for nocardia seriolae strain typing, which comprises the following steps:
and (3) taking DNA of Nocardia seriolae to be detected as a template, performing multiplex PCR amplification reaction by using the primer combination, and detecting the type of the PCR amplification product combination strip according to the amplification condition of the PCR products corresponding to each primer pair in the primer combination so as to identify the strain type of the Nocardia seriolae to be detected.
Preferably, when the primer combination is the primer combination I, the mass concentration ratio of the primer pair I to the primer pair II to the primer pair III is 2:1:2;
when the primer combination is the primer combination II, the mass concentration ratio of the primer pair IV to the primer pair II to the primer pair III is 1:1:1;
when the primer combination is the primer combination III, the mass concentration ratio of the primer pair V to the primer pair II to the primer pair III is 1:2:2.
Preferably, the multiplex PCR amplification reaction is performed by the following reaction procedure: 95 ℃ for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 1min,30 cycles; extending at 72℃for 10min.
Preferably, the reaction system of the multiplex PCR amplification reaction is as follows: 25. Mu.L of premix, 15. Mu.L of primer combination and 5. Mu.L of DNA template, add ddH 2 O was made up to a total volume of 50. Mu.L.
Preferably, the method of identifying comprises:
if the PCR amplification product satisfies the following (1): the primer pair I, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (2): the primer pair I and the primer pair II amplify corresponding PCR amplification products, and the primer pair III does not amplify corresponding PCR amplification products, so that the strains to be detected conforming to the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (3): the primer pair I and the primer pair III amplify corresponding PCR amplification products, and the primer pair II does not amplify corresponding PCR amplification products, so that the strains to be detected conforming to the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (4): the primer pair I does not amplify corresponding PCR amplification products, the primer pair II and the primer pair III amplify corresponding PCR amplification products, and the strain to be detected conforming to the amplification results is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (5): the primer pair I amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (6): the primer pair I and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (7): the primer pair I and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (8): the primer pair I, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, and the strains to be detected which accord with the amplification results are classified as nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (9): the primer pair IV, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (10): the primer pair IV and the primer pair II amplify corresponding PCR amplification products, and the primer pair III does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (11): the primer pair IV and the primer pair III amplify corresponding PCR amplification products, and the primer pair II does not amplify corresponding PCR amplification products, so that the strains to be detected conforming to the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (12): the primer pair IV does not amplify corresponding PCR amplification products, and the primer pair II and the primer pair III amplify corresponding PCR amplification products, so that the strains to be detected which accord with the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (13): the primer pair IV amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (14): the primer pair IV and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (15): the primer pair IV and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (16): the primer pair IV, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, and the strains to be detected which accord with the amplification results are classified as nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (17): the primer pair V, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (18): the primer pair V and the primer pair II amplify corresponding PCR amplified products, and the primer pair III does not amplify corresponding PCR amplified products, so that the strains to be detected conforming to the amplification result are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (19): the primer pair V and the primer pair III amplify corresponding PCR amplified products, and the primer pair II does not amplify corresponding PCR amplified products, so that the strains to be detected conforming to the amplification result are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (20): the primer pair V does not amplify corresponding PCR amplified products, and the primer pair II and the primer pair III amplify corresponding PCR amplified products, so that the strains to be detected which accord with the amplified results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (21): the primer pair V amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (22): the primer pair V and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (23): the primer pair V and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (24): and if the primer pair V, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, classifying the strains to be detected which meet the amplification results into nocardia seriolae of the same type.
The invention also provides the primer combination or the application of any one primer in the primer combination in preparation of products for typing Nocardia seriolae strains.
The invention discloses the following technical effects:
the invention carries out comparative analysis on the published 20 Nocardia seriolae genome data, screens to obtain differential genes in Nocardia seriolae strains, designs corresponding primers, optimizes the reaction conditions of a multiple PCR system, carries out strain typing on 24 Nocardia seriolae, and can be applied to the typing of the Nocardia seriolae isolated strain in aquatic cases. The invention is found through experiments: the selected gene fragments of ORF3334, ORF3335, ORF3336, ORF4608 and ORF5389 have intra-species differences, primer combinations are carried out by using primers designed by the selected gene fragments, and a multiplex PCR typing method of the Nocardia seriolae strain is established. The experimental result shows that the primer combination I (ORF 3336, ORF4608 and ORF 5389) can generate clear amplified bands, the optimal ratio of the primers is 3336-F/R:4608-F/R:5389-F/R=2:1:2, and the sensitivity reaches 125 pg/mu L; the optimal proportion of the primer combination II (ORF 3335, ORF4608 and ORF 5389) is 3335-F/R, 4608-F/R, 5389-F/R=1:1:1, and the sensitivity reaches 500 pg/mu L; the optimal ratio of the primers of the primer combination III (ORF 3334, ORF4608 and ORF 5389) is 3334-F/R:4608-F/R:5389-F/R=1:2:2, and the sensitivity reaches 500 pg/mu L. The multiple PCR typing method of the nocardia seriolae, which is established by the invention, provides a new method for rapid typing of isolated strains of the nocardia seriolae in aquatic cases, is beneficial to research on nocardia seriolae vaccines of fish through typing results, and helps to control and prevent nocardia seriolae.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a multiplex PCR amplification electrophoretogram of primer combination I; m is DL2000DNA molecular standard; n is a negative control; the Nocardia seriolae strains corresponding to 1-24 are HB202008, FS201912, WL-2021-1, N-2, N-1, WL-2020-1, N-4, JZL-2019-1, SZ0214, N-3, N-6, N-5, N-8, N-9, N-12, N-13, N-14, N-15, N-16, N-17, N-18, N-19, N-20 and N-21 respectively;
FIG. 2 is an optimized electrophoresis chart of the concentration ratios of multiplex PCR primers; m is DL2000DNA Marker; n is a negative control; 1 is nocardia seriolae strain FS201912;2 is Nocardia seriolae strain N-14; a is primer combination I3336-F/R: 4608-F/R: 5389-F/r=1: 1:1, a step of; b is primer combination I3336-F/R: 4608-F/R: 5389-F/r=1: 1:2; c is primer combination I3336-F/R: 4608-F/R: 5389-F/r=1: 2:2; d is primer combination I3336-F/R: 4608-F/R: 5389-F/r=2: 1:2; e is primer combination II 3335-F/R:4608-F/R: 5389-F/r=1: 1:1, a step of; f is primer combination III 3334-F/R:4608-F/R: 5389-F/r=1: 1:1, a step of; g is primer combination III 3334-F/R:4608-F/R: 5389-F/r=1: 2:2;
FIG. 3 is a multiplex PCR sensitivity electrophoretogram; m is DL2000DNA Marker; n is a negative control; a is the result of multiplex PCR typing detection sensitivity of FS201912 strain by using primer combination I; b is the result of multiplex PCR typing detection sensitivity of the N-14 strain by using the primer combination I; c is the result of the sensitivity of the FS201912 strain to the genotyping detection by the multiplex PCR with the primer combination II; d is the result of multiplex PCR typing detection sensitivity of the N-14 strain by using the primer combination II; e is the result of multiplex PCR typing detection sensitivity of FS201912 strain using combination III; f is the result of multiplex PCR typing detection sensitivity of the N-14 strain by using the primer combination III; in the figure, 1-8 are respectively 30 ng/. Mu.L, 6 ng/. Mu.L, 1 ng/. Mu.L, 500 pg/. Mu.L, 250 pg/. Mu.L, 125 pg/. Mu.L, 62.5 pg/. Mu.L and 31.3 pg/. Mu.L of Nocardia Seriolae DNA;
FIG. 4 is a diagram showing the use of multiplex PCR to identify nocardia seriolae strain typing; m is DL2000DNA molecular standard; n is a negative control; 1-29 correspond to Nocardia seriolae strains HB202008, FS201912, WL-2021-1, N-2, N-1, WL-2020-1, N-4, JZL-2019-1, SZ0214, N-3, N-6, N-5, N-8, N-9, N-12, N-13, N-14, N-15, N-16, N-17, N-18, N-19, N-20, N-21, N-11, N-22, N-23, WL-2023-11, ZJ0503, respectively, isolated from diseased fish
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
The study samples and primary reagents referred to in the following examples:
(1) Study sample: 29 strains of nocardia sericata and sources thereof are shown in table 1.
TABLE 1 Nocardia quinqueen strain 29 and sources thereof
(2) Main reagent
DNA extraction kit was purchased from TIANGEN company. Premix TaqTM PCR Premix was purchased from TaKaRa. Primers were synthesized by the division of biological engineering (Shanghai). The PCR instrument was a yena analytical instrument company.
The major gene fragments involved in the following examples: the genes corresponding to ORF3334, ORF3335, ORF3336, ORF4608 and ORF5389 are respectivelyArsC、AraC、ISOPREN、ALAT、IclRThe nucleotide sequences are shown in SEQ ID NO: 23-27.
ArsCGene (SEQ ID NO: 23):
GTGATCGTGGACCAGTCGAGTCTGGATGCCGCCGCCGCGCGGCTGGGGCAGGAGTTCGCCGGGATTCTGGATGGCGCGATGGTCGGGTCGATTCTCGACAGCTCCTATGCTCATCTGGCCGCGATCTCGATCCCGGACCGGCTG CCCGATCATGCCGAGCGGTATGCGCGGGAACGGTTGGTGGCCTTGGCCAGAGCCGAGGGACGGGCGGTGCGGAGCG GGCCGGCGGTGTTGTTCGTGTGCACGCACAATGCGGGGCGCTCGCAGATGGCGCTGGGGTTCTTCACGCGGCTGGC CGGGGGACGGGCGTCGGCGTGGTCGTGCGGATCGAAACCGAGTGTGGAGATCAACCCGGTGGTGGCCTCGGCCATGGCGGAGGTGGGAGTCGATATCTCCGAGGAGTTTCCGAAGCCGTGGAGCGATGAGCTCATGCGGGCGGCCGACGTGATCATCGATATGGGGTGCGGGGATACCGATCCGATCATCGCGGGGCATCGGTTCGAGCAGTGGCCGCTGCCCGACCCGGCCGAAGAGGACATCGAGGAGATCCGGGCCATTCGCGACCAGATCGAGGTGCGGGTGCGACGCCTGGTCGCCAATCTCGGGTTGGCGGGTTAG.
AraCgene (SEQ ID NO: 24):
ATGGTGGCGCAGTCCGCCGGTGAGTTCCTGCTGGTGAATATCGTGCTGGAAGGGACGAATTGGACCGA GCAGGCCGGCAGGGTGGCCGAATGCAAGCCCGGTTCCATCTCCTTCTTCGACAGCGGTGTGCCGCTGGAGAGCCGG ACCACCGACAATTGTCTGTCGACGCTGGTCCGCGCCCCGCTGCAACTGGTGCTCGAGCATTCCGGCCTGACCCGTG AGCAACTGCCCACCGCCAGCGCGGTCCCCGCGACCGGCGCACTGGGCGTGGTCACCAACTTCTTCCGCGGCCTGGC CGAACTCGCGCCCGACGACATCACCCAGGCGGTCACCGTCTTCGGCACCGATGCCGCGGGCATGATGGCCTCGGCC CTGCTGCTGGCCAATGGCGAAACCTCACCGGCGCCCTCCGATTCGCTCTACACCCGCCAGCAGGTGCTGGCCTACA TCCGCAAGAACTTCACCAACCCCGACCTCACCGTCGACGAGATCGCCCACGCCTGCCTGATCTCCCGCCGCACCCTCTACCGCGTCTGCGAGGGCTTCGGCGAGCCCGGCGCGATCGTGCGCCGCACCCGAATCGCCCACGCCCGCCGCCTGATCCGCGCCGACCCCGCCCGCTCCCTGGCCGCCGTCGCAGCCGCCGCCGGTTTCTCCACCGACCGCCACTTCTACCGCGCCTTCCGCGAGGAAACCGGCCTCACCCCCGGCCAATTCCGCGACCAGGTCGGCCCGCGCGGGCGGACGCAGTAA.
ISOPRENgene (SEQ ID NO: 25):
GTGAACGAGAAATCCGTCGGCACGGTTCGCAGGCGCGCCCTGATGTCGTTGTGGCAGTTGATCAGGCTGGTCGACGAGGATGCCGACGGCATGATCACCGGGTCGCCGTATGCCACCGCGGGGGTGGTCGCGCGACTCTGGCAAACACCCCGGCTACTGCCCGTTTCGCTGGCGCGGCTGGGCCTGAACGCGTTGGCGCGCAGTCGGAACGGCGACGGCAGCTGGGGCAGCCCGCACGCGCCGCGGCCCTATCGGGTGGTGCCGACGCTGGCGGTGGTGTGCGCCCTGGCGGGCCTGCCCGCCGACGCGCCGATCGAACGGGAGTGGGTGCGCGGCGCGGCGCGGCGGGGGAGCGGGTTCCTGTTCGAGGATCCGGAAGTCTTTGTGCCGGACCGACTGCCCAGTCTGGAGGCGGTCGATCGGACCGTGCCCGTGCTGCTGGAACAGCTCGCGCAGTCCCCGGAGTTCGACGCCGAGCAATACGGTCCGGCACTGCTGCGGGCCCGAATGGCGCAGCGGGCCAACGCCGACCGTTGCGCACGGCTGCGGGCCCGTGCCGCGGCCGGTGATCGTGCGGCGTGGCGGGCTTTTCCGCTGGAGCTGCTGGCCACCGCGCCCGGGGGCTGGCGATCCGAGACGGCCGTGCGCGGGGGCGCGGTGGCCTGCTCGCCGGTGTTGACCGCGGCCGCGGTCCGCTGGCACGGCGCCGAATTGGCCGGGATCGAGCGCTATCTGCGCCGCGAGGGCGTGCGCAGGCAGGGCCTGTGGCCACCCCTCGCTCCGGCCGTGAACCACGAAAGGGCCATGGCCGCGGCGCTTTTCGTCCGCCTGGGGTTCCCGCTGCCGCCGGGATTCACGGCATCGCTGAGCGCGTCGCTGCGCTCGGCGCTGGGCGCGGACGGCATGTCGTTCGCCCCCGGACTGCCACCCGACGCGGAGCACACCGCGCTGGCGATCTTCGTGCTGAACTCGTGGGACGACGCCGTGGATTCCCGCTGTCTGCTGGACTTTCCCGCACCGGCCACGCCCTTGGCGACCGCCCACGTGCTCGAGGCCTGGACCACCGTCGCGGCGATGGCCGGGACCGGTGCGGTGCGCGATCGGGCGACCGCGGCGGTGCGCGCACTGATCG AAACCCAAGACCCGGACGGTCATTGGGACGATCGCACGGTCGCCTCGGCGTGCCTGCCGACCGCCGTCGCGGCCAT GGCGCGCGTCATGGAATCGGAGTTCTCCGCCGACGCCCTGCTCGCGGTCTCGCGGGCGATCGGGTGGCTGCTGGCC AACCAGCGGTCCGACGGTTCCTGGGGTGTCTGGCACCCGGGTACGGAGGAGACCGCGTACGCGGTGCACGCGCTGG GCATTTGCGCGAGTCCGGCGGTAGAGCGGTTGGTGGCCGCCGCGCTGCGGCGGGCCCACATATTTCTTACCGATTC CTTCGACAGCGCGATGACGGATTCGGTGCGAACACCATTGTGGCACTACAAAGATCTCGCTGCACCGCTGCGAATCGAGCGTCTCTACACATTGACGGCGCTGCTGATGAGCGGTTCGCCCGTTCCGTGA.
ALATgene (SEQ ID NO: 26):
GTGTGCGGCAACCACACCGAGAAGGGGTCGTTCATGCAGGTGAAGCAGTCGAGCAAGCTGGCGGGCGTGTCCTATGAGATCCGCGGGCCGGTCGCCGAGCACGCCGCCCGGCTGGAGGTGGAGGGGCATCACATCGTGAAGCTCAACACCGGCAACCCGCTCACCTTCGGCTTCGAAGCGCCCCCCGAGCTGCTCCAGGACATGGTCCGCAACCTGCCGCAGTCCAGCGGCTACTCCTCCTCCAAGGGCCTGCTCTCGGCGCGGCGCGCGGTGGTGCAGTACTACGAGACCCTCGGCCTCGCCGAACTCGATGTCGAACAGGTCTTCCTGGGCAACGGCGTCTCCGAGCTCATCATGATGGCCATGACCGCGCTGCTGGAGAACGGCGACGAAGTCCTGGTCCCCGCACCGGATTTCCCGCTCTGGACCGCCGCCACCGCGCTCAACGGCGGCCGCCCGGTGCACTACATCTGCGACGAGGGCTCGGACTGGATGCCGGACCTGGCCGATATCGAGTCCAAGAT CACCGACCGCACCCGCGCGCTGGTCATCATCAACCCGAACAACCCGACCGGCGCGGTGTATTCGCCCGAGGTGGTG CGCCAGATGCTCGAGCTGGCCCGCCGCCACAACCTGGTGGTGTTCTCCGACGAGATCTACGACAAGATCCTCTACG ACGGCCTGACCCACACCGCCACCGCGTCGCTGGCCCCGGATCTGTTGTGCCTCACCTTCTCCGGCCTGTCCAAGTC CTACCGCGCCGCCGGCTTCCGCGGCGGCTGGCTGGTGGTCTCCGGCCCCGTCGAGCACGCCGAGAACTACCTCGAG GGCCTGACCATGCTGGCCGGGCTGCGCCTGTGCGCGAATGTCCCCGCGCAGCAGGCGATTCAAGCCGCCCTCGGCG GCCACCAGAGCATCTACGACCTGACCCTGCCCGGCGGCCGCCTGCGCGAGCAGCGTGACCGGGCGTTCGAAGCGCT CAACGCCGTCCCGGGCATCTCGTGTGTGAAGCCCAAGGGCGCGCTGTACGCCTTCCCTCGCATCGACCTCGGCATG TACAAGATCCACAGTGACGAGCAGTTCGTCCTGGATCTGCTGCTGCGCGAGAAGATCCACATCGTCCAGGGCACCG GCTTCAACTGGCCCCATCCCGACCACTTCCGCATCGTGACGCTGCCGCACGCCGATGAGCTCGAGGCCATCATCGAACGCATCGGCCGGTTCCTGGCGACCTACAAGCAGGAGGTCCTCAGACCGGACGGCCCGCCGTCATGCCCCCGTCGACCACGAATTCCGCGCCATTGCAGTAGCTGGATTCGTGGCTGGCGAGGAACACGACCAGCGCCGTCACCTCCTCGGGCCCGCCGAGCCTGGCGAGGGTGTTCGCTTCGCGATTCGCGGTCGAACCCTCGGGCACGCCGATCATGGGCGTCAGAATCCCGCCCGGGTGAACGGAATTCACGCGCACCCCGTGCGGGGCGAGCTCGAGCGCGGCGGACTTGGTGA.
IclRgene (SEQ ID NO: 27):
GTGGCCGAACGGCCGCCCCTGCGCGGATTGACCCGGCGCGAACTGCCTTTCGTGCCGGTGTTCGCACAGTCGGTCGCGGCCATCGCGCCCTCGGGGACGGCGGTGGTCACCCCGGCCTTCGTGATCGGCGCGGCCGGGGGCGGGGCGAGTGTGGCCGCGTTCCTGGCGGCGGCGCTGCTGGCCTGGGCGGTGGCCCTGGTGATCCGGCCCATGGCGCAGCGGCTGGCGGTGACCGGCGGGCTGTACACATACGTGGCGAAGGGGCTCGGTCCGTTCGTCGCAGTACCGACCGGGTGGTCGGCGATTGTGGGGTACGCGAGCGTCAGTGTGGCGGGGCTGCTCGCGGTCGGCACCTATCTGGATCAGCTCGCGGTCACGGCCGGGCTGGCCGGTTTCGGTGGGACCGCAACGATTGTCGGCCTGCTGCTGGTCGCGGCGGTGGTGGAGGCGGTGCTCATGGTGCGCGGCATCCGGCTGTCGGCGTCGGCGACGCTGCTGGTGGAATGCGTGTCCGTGGTGACGGT GCTCGCGCTCATGGGCTACCTGCTGACCCGCGACGCGCACGCTCCGCGTCCGGCCCCGGTCTTCGAATGGCACGGC GGCACCGGCACTCTCGCCATGAGCGCGGTGGTGGCGGTCAGCGCCTTCGTCGGATTCGAGAGTGCGACCACCCTGT CCGCCGAGGCCTACCGGCCGTTCCGTTCGGTGCCGCGGACCTTGGTCTGGACACCGCTGGCCGCCGCCGTCATCTA CCTGATCGCGGTGACCGCGCAGGCCGTGGCCCTGGCCGCCGCGCCCCCGGGCACCGCCTCGAGCTCGACACCGGTC ACCGATCTGCTCATGCGGGGCGATTCCGGATTCCTCGGCGCGGTCCTGGATCTCGGGGTCGCGGCATCGTTCTTCG CCTGCACCGTCGCCTCGATCAACGCGCTGGTGCGGGTGCTGTTCACCATGGGCCGCGAGCGCATCGCCCCGGCGGC GGCCGGGCGCGCGCACTCCCGTTTCCACACCCCGGCCCCCGCCATTGTCGCGGCGGTGGGCGCGGTGACCGCCTGC GCGCTGTGGTACCTGCTCTCCGGAGCCGAACCCCAGGACGGCATCCGCAGCTTCCTGACCCTGAGCGCGCTCGGAT ACCTCGGCTCGTACCTGCCCGCCTGTCTGGCCACCCCGGCGCTGCTGCGCCGCATCGGCGAACCCAGCCGCGCCAT CGCGATCCTCGGCTCGGTGACCGCGCTGCTGCTCGGCGTGCTCATGGTCGGCGCGGCGGTCTCGGCCCGCAATGAC AATGTCACCGTGGTGATCGCCTACGCCGCGATCCTGGCGGCGGCCGTGGCATTCACCGTCGGCCTGCGCGTGCTCG CGCCGGATCGGTTGCGCGGCATCGGCATCTACGACGAGCCGCGCCGCGAAGACCTGCTGCCCGTCGTGACCTTCCG GGAGCCGCCATGCAGGATTCCCGCCGCACCAATACGGTCTCGAACTCCATCGCCATTCTCGAAGCGGTCGCCGACTGCGGGGTGGGCGTCACCGCCAAGGAGATCGCGCAGCGTCTGGGCATCGCGCCCGCCACCACCTACCGGCTGCTGA.
the underlined bases in the above sequences are gene fragments corresponding to the amplification of the genes in the examples described below.
Example 1 selection of intraspecific differential genomic DNA fragments and design of PCR primers
1. Design of PCR primers
Sequence alignment analysis was performed on the whole genome data of the published 20 strains of Nocardia seriolae using the BLAST program of NCBI (http:// www.ncbi.nlm.nih.gov), and 10 gene fragments (ORF 362, ORF 2083, ORF3334, ORF3335, ORF3336, ORF 3691, ORF4608, ORF 4884, ORF5389, ORF 7220) having intra-species differences in the above 20 strains of Nocardia seriolae were selected as target fragments to be examined, i.e., gene fragments present in part of the Nocardia seriolae strain but not in all of the Nocardia seriolae strains, and specific PCR primers were designed for each target fragment (see Table 3). In addition, literature reports on intra-species differences among different strains of nocardia seriolaedopVirulence genes and their PCR primers (see Table 3) were synthesized by the company Shanghai, inc. of biological engineering.
TABLE 2 NCBI published genome data of 20 Nocardia seriolae strains
TABLE 3 11 candidate primer pair information
The "Rogowski et al" in the above Table is "Rogowski et al, deng Yuting, zhao Fei, et al, 9 strains of North Amarum Seriolae biological characteristics and pathogenicity comparison [ J ]. Biol.Ind., 2021,48 (8): 2733-2749 ]"
2. Primer screening and multiplex PCR primer combination screening
11 pairs of primers can be determined by single PCRWhether the amplified bands have singleness or not, and whether the amplified bands can reflect the differences of different sources or not. The PCR reaction condition is denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, extension at 72℃for 1min,30 cycles, extension at 72℃for 10min. Set 20 μl PCR reaction system: premix Taq TM 10. Mu.L of PCR premix and 1. Mu.L of each 1. Mu. L, DNA template with ddH for the primer pair (concentration 100 ng/. Mu.L) in Table 2 2 O was made up to 20. Mu.L. After the completion of the PCR reaction, agarose gel electrophoresis was performed.
After screening out PCR primer pairs capable of amplifying single intra-species difference, setting 50 mu L of PCR reaction system Premix Taq TM 25. Mu.L of PCR premix, 1. Mu.L of total primer (multiple pairs of candidate primers added in equal proportions), 5. Mu.L of DNA template, and ddH 2 O was made up to 50. Mu.L. The PCR reaction procedure is denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,30 cycles; extending at 72℃for 10min. The primers with the difference of the amplified fragment lengths are combined, and screening is carried out according to the amplification effect, so that the difference of nocardia seriolae strains of different sources can be reflected, and unreasonable amplified strip deletion cannot occur.
3. Multiple PCR reaction condition parameter optimization
According to the experimental result of the screening, selecting a multiplex PCR candidate primer pair combination with good amplification effect, and setting a 50 mu L PCR reaction system: premix Taq TM 25. Mu.L of PCR premix, 15. Mu.L of total primer (primer pair 1: primer pair 2: primer pair 3=1:1:1, ratio of mass concentration ratio), 5. Mu.L of DNA template, and ddH were used 2 O makes up 50. Mu.L. The PCR reaction procedure is denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,30 cycles; and (3) extending at 72 ℃ for 10min, and detecting the amplification effect when the mass concentration ratio of the primer pair 1 to the primer pair 2 to the primer pair 3 is 1:1:1. And (3) according to the amplification effect of the equal proportion primer proportion, properly increasing the proportion of the primer proportion of the weak band, and then amplifying again. The target fragment can be amplified to form a single clear band, and a nonspecific band is not generated as an index for optimizing the ratio of the primers.
4. Sensitive detection of multiplex PCR typing
With ddH 2 Nocardia of Seriola quinquefoilDNA was prepared in a concentration gradient of 8 North Amiola, namely, north Amiola DNA concentrations of 30 ng/. Mu.L, 6 ng/. Mu.L, 1 ng/. Mu.L, 500 pg/. Mu.L, 250 pg/. Mu.L, 125 pg/. Mu.L, 62.5 pg/. Mu.L, 31.3 pg/. Mu.L, respectively. According to the optimized primer proportion, using Nocardia seriolae DNA templates with different concentrations and ddH 2 O is a blank control, and the sensitivity of multiplex PCR is detected.
5. Application detection for multiplex PCR typing identification
And (3) taking the nocardia seriolae strain separated from the nocardia seriolae fish sample of infected fish, extracting genome DNA, and carrying out typing identification on the case strain by using an established multiple PCR nocardia seriolae strain typing method according to the optimized multiple PCR reaction condition parameters.
6. Results and analysis
6.1 Primers for screening multiplex PCR
Single PCR amplification was performed using primers dop-F/R, 362-F/R, 2083-F/R, 3334-F/R, 3335-F/R, 3336-F/R, 3691-F/R, 4608-F/R, 4884-F/R, 5389-F/R and 7220-F/R, respectively, using the DNA of the 24 Nocardia sericata strains stored in the laboratory as a template, and the results showed that the 24 strains all carried ORF 362, 2083, 3691, 4884, 7220,dopThe gene fragments, whereas the ORF3334, ORF3335 and ORF3336 gene fragments were detected in only three strains HB202008, FS201912 and N-14, ORF4608 was detected in only 18 strains and ORF5389 was detected in only 17 strains (see Table 4).
TABLE 4 Single PCR amplification results of 24 strains
Note that: +: detecting positive target genes; -: negative detection of target gene
6.2 Primer combination screening of multiplex PCR systems
According to the single PCR experimental results, the ORF3334, ORF3335, ORF3336, ORF4608 and ORF5389 gene fragments have the intra-species difference of Nocardia seriiolae. According to the amplification conditions of the primer amplified fragments in each strain and the length difference of the amplified fragments, the primer ORF 3336-F/R, the primer ORF 4608-F/R and the primer ORF 5389-F/R are used as a primer combination I established by a multiplex PCR typing method. The DNA of 24 Nocardia seriolae strains stored in the laboratory is used as a template for multiplex PCR amplification, the detection result is shown in figure 1, each strain can amplify reasonable bands, namely, gene fragments which are detected to be positive in a single PCR system can amplify corresponding bands in the multiplex PCR system, and gene fragments which are detected to be negative in the target gene in the single PCR system do not amplify the bands in the multiplex PCR system. The strain types corresponding to the strains are shown in Table 5, and the corresponding gene fragments of FS201912 and N-14 in the tables can be amplified to form strips after being amplified by the primer group I, and the two strains are expressed to judge that the same type of Nocardia seriolae. Since the PCR amplifications of ORF3334, ORF3335 and ORF3336 exhibited the same strain distribution, the multiplex PCR amplification results of primer combination II (ORF 3335, ORF4608, ORF 5389) and primer combination III (ORF 3334, ORF4608, ORF 5389) were the same as those of primer combination I. The 3 primer combinations designed are all used for establishing a multiplex PCR identification method for the nocardia seriolae strain typing.
TABLE 5 typing of strains corresponding to 24 Nocardia Seriola strains
Note that: the column "Strain typing" represents in order from left to rightORF 333、ORF 460、ORF 5389In the case of gene fragment amplification, "+" indicates amplified fragments and "-" indicates no amplification.
6.3 Optimized results for multiplex PCR reaction condition parameters
6.3.1 optimization results of multiplex PCR primer ratios
According to the above-mentioned multiplex PCR experiment results, using the primer combination I (ORF 3336, ORF4608, ORF 5389), the primer combination II (ORF 3335, ORF4608, ORF 5389) and the primer combination III (ORF 3334, ORF4608, ORF 5389), both of the two Nocardia seriolae FS201912 and N-14 were amplified into 3-item gene fragments, and thus the above-mentioned two strains were selected as strains for optimizing the primer ratios of the multiplex PCR system. The multiple PCR reaction system and the reaction conditions are shown as ' 3 ', and the parameters of the multiple PCR reaction conditions are optimized '. The results showed that when the total primer concentration ratio of primer combination I (ORF 3336, ORF4608, ORF 5389) was 3336-F/R:4608-F/R: 5389-F/r=1: 1:1, only a very light fluorescent band was detected by the ORF5389 gene fragment (see FIG. 2A). The mixture ratio of the three pairs of primers is adjusted to be 3336-F/R:4608-F/R: 5389-F/r=1: 1:2, none of the three gene fragments of interest of the FS201912 strain detected a band (see FIG. 2B). The mixture ratio of the three pairs of primers is adjusted to be 3336-F/R:4608-F/R: 5389-F/r=1: 2:2, a clearer band appears in all three gene segments of interest (see C in FIG. 2). The primer mixture ratio is adjusted to 3336-F/R:4608-F/R: 5389-F/r=2: 1:2, the three target gene fragments all have clear bands, and the brightness difference of the 3 bands is small (see D in FIG. 2), so the ratio is selected as the optimal primer ratio.
When the total primer concentration ratio of primer combination II (ORF 3335, ORF4608, ORF 5389) is 3335-F/R:4608-F/R: 5389-F/r=1:1:1, the ratio was used directly, since the three gene fragments of interest all appear in clear bands and the difference in brightness between the 3 bands is small (see E in fig. 2).
When the total primer concentration ratio of primer combination III (ORF 3334, ORF4608, ORF 5389) is 3334-F/R:4608-F/R: at 5389-F/r=1:1:1, only a very light fluorescent band was detected for the gene fragments ORF5389, ORF4608 (see F in fig. 2). The ratio of the three pairs of primers is adjusted to be 3334-F/R:4608-F/R: 5389-F/r=1:2:2, the three gene fragments of interest all appear in clear bands (see G in fig. 2), so this ratio was chosen as the optimal primer ratio.
6.3.2 Establishment of multiple PCR reaction condition parameters
Through optimizing the parameters of the multiple PCR reaction conditions, the multiple PCR reaction system (50 mu L) is established as Premix Taq TM 25. Mu.L of PCR premix and 15. Mu.L of total primer (primer ratio 3336-F/R: 5389-F/R=2:1:2 in primer combination I; primer ratio 3335-F/R:4608-F/R: 5389-F/R=1:1:1 in primer combination II; primerPrimer proportion in the composition III is 3334-F/R4608-F/R5389-F/R=1:2:2), DNA template 5 mu L and ddH 2 O makes up 50. Mu.L; the multiplex PCR reaction procedure was 95℃for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 1min,30 cycles; extending at 72℃for 10min.
6.3.3 Sensitivity level detection for multiplex PCR
And (3) carrying out equal-ratio dilution on the extracted FS201912 and N-14 Nocardia seriolae DNA according to the optimized multiple PCR reaction conditions and programs to form 8 concentration gradients, and carrying out sensitivity detection of multiple PCR. Primer combination I: multiplex PCR sensitivity detection was performed with 3336-F/R (320 bp), 4608-F/R (685 bp), 5389-F/R (1007 bp): the results are shown in fig. 3 a and B, which show that: when the DNA template amount of Nocardia fish is 125 pg/mu L, reasonable target bands can be amplified at the same time, and the sizes of the band fragments are consistent with the expectations. The negative blank control had no amplified bands. The sensitivity of the multiple PCR of nocardia seriolae established by the primer combination I can reach 125 pg/mu L.
Primer combination II: multiplex PCR sensitivity tests were performed for 3335-F/R (433 bp), 4608-F/R (685 bp), 5389-F/R (1007 bp), and the results are shown in FIGS. 3C and D, which show that: when the DNA template amount of Nocardia fish is 500 pg/mu L, reasonable target bands can be amplified at the same time, and the sizes of the band fragments are consistent with expectations. The negative blank control had no amplified bands. The sensitivity of the multiple PCR of nocardia seriolae established by the primer combination II can reach 500 pg/mu L.
Primer combination III: multiplex PCR sensitivity assays were performed for 3334-F/R (252 bp), 4608-F/R (685 bp), 5389-F/R (1007 bp), and the results are shown in FIGS. 3E and F, which show that: when the DNA template amount of Nocardia fish is 500 pg/mu L, reasonable target bands can be amplified at the same time, and the sizes of the band fragments are consistent with expectations. The negative blank control had no amplified bands. The sensitivity of the multiple PCR of Nocardia quinquevalis established by the primer combination III can reach 500 pg/mu L.
6.4 Application detection of multiple PCR identification method for typing Nocardia seriolae strain
The optimized multiplex PCR parameters were used, and the primer combinations I (3336-F/R, 4608-F/R, 5389-F/R) were used to perform multiplex PCR typing identification on 29 Nocardia seriolae strains isolated from the body of the infected fish Nocardia seriolae, and the results are shown in FIG. 4, and the strains corresponding to the 29 Nocardia seriolae strains are shown in Table 6.
TABLE 6 typing of 29 Nocardia Seriola strains isolated from fish
Note that: the column "Strain typing" represents in order from left to rightORF3336、ORF4608、ORF5389In the case of gene fragment amplification, "+" indicates amplified fragments and "-" indicates no amplification.
From the results of the above examples, it can be seen that the multiplex PCR identification method established by the invention has good effect on the typing of nocardia seriolae strains, has higher sensitivity, and can still detect mixed samples with primer combination I (3336-F/R, 4608-F/R, 5389-F/R) as low as 125 pg/. Mu.L; primer combination II (3335-F/R, 4608-F/R, 5389-F/R) was as low as 500 pg/. Mu.L of the mixed sample still detected; primer set III (3334-F/R, 4608-F/R, 5389-F/R) was as low as 500 pg/. Mu.L of the mixed sample still detected; therefore, the method for typing and identifying the nocardia seriolae strain by utilizing the multiplex PCR technology has application value in preventing and controlling the diseases of the nocardia seriolae.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (6)

1. A primer combination for the typing identification of nocardia seriolae strains, which is characterized in that the primer combination comprises any one of a primer combination I, a primer combination II and a primer combination III;
the primer combination I consists of a primer sequence shown as SEQ ID NO:11-12, a primer pair I as set forth in SEQ ID NO:15-16 and a primer set as set forth in SEQ ID NO:19-20, wherein the mass concentration ratio of the primer pair I to the primer pair II to the primer pair III is 2:1:2;
the primer combination II consists of a primer sequence shown as SEQ ID NO:9-10, a primer pair IV as set forth in SEQ ID NO:15-16 and a primer set as set forth in SEQ ID NO:19-20, wherein the mass concentration ratio of the primer pair IV to the primer pair II to the primer pair III is 1:1:1;
the primer combination III consists of a primer sequence shown as SEQ ID NO:7-8, a primer pair V as set forth in SEQ ID NO:15-16 and a primer set as set forth in SEQ ID NO:19-20, wherein the mass concentration ratio of the primer pair V to the primer pair II to the primer pair III is 1:2:2.
2. Kit for the genotyping identification of nocardia seriolae strains, characterized in that it comprises a primer combination according to claim 1.
3. A multiplex PCR identification method for nocardia seriolae strain typing for the purpose of non-disease diagnosis, comprising the steps of:
taking DNA of Nocardia seriolae to be detected as a template, performing multiplex PCR amplification reaction by using the primer combination according to the claim 1, and detecting the type of the PCR product combination strip according to the amplification condition of the PCR product corresponding to the primer combination I, the primer combination II or the primer combination III so as to identify the strain type of the Nocardia seriolae to be detected;
the identification method comprises the following steps:
if the PCR amplification product satisfies the following (1): the primer pair I, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (2): the primer pair I and the primer pair II amplify corresponding PCR amplification products, and the primer pair III does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (3): the primer pair I and the primer pair III amplify corresponding PCR amplification products, and the primer pair II does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (4): the primer pair I does not amplify corresponding PCR amplification products, and the primer pair II and the primer pair III amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (5): the primer pair I amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (6): the primer pair I and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (7): the primer pair I and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (8): the primer pair I, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, and the strains to be detected which accord with the amplification results are classified as nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (9): the primer pair IV, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (10): the primer pair IV and the primer pair II amplify corresponding PCR amplification products, and the primer pair III does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (11): the primer pair IV and the primer pair III amplify corresponding PCR amplification products, and the primer pair II does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (12): the primer pair IV does not amplify corresponding PCR amplification products, and the primer pair II and the primer pair III amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (13): the primer pair IV amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (14): the primer pair IV and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (15): the primer pair IV and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (16): the primer pair IV, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, and the strains to be detected which accord with the amplification results are classified as nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (17): the primer pair V, the primer pair II and the primer pair III amplify corresponding PCR amplified products, and the strains to be detected which accord with the amplified products are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (18): the primer pair V and the primer pair II amplify corresponding PCR amplification products, and the primer pair III does not amplify corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (19): the primer pair V and the primer pair III amplify corresponding PCR amplification products, and the primer pair II does not amplify corresponding PCR amplification products, so that the strains to be detected conforming to the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (20): the primer pair V does not amplify corresponding PCR amplification products, and the primer pair II and the primer pair III amplify corresponding PCR amplification products, so that the strains to be detected which accord with the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (21): the primer pair V amplifies a corresponding PCR amplification product, and the primer pair II and the primer pair III do not amplify the corresponding PCR amplification product, so that the strain to be detected conforming to the amplification result is classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (22): the primer pair V and the primer pair III do not amplify corresponding PCR amplification products, and the primer pair II amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (23): the primer pair V and the primer pair II do not amplify corresponding PCR amplification products, and the primer pair III amplifies the corresponding PCR amplification products, so that the strains to be detected which meet the amplification results are classified as Nocardia seriolae of the same type;
if the PCR amplification product satisfies the following (24): and if the primer pair V, the primer pair II and the primer pair III do not amplify corresponding PCR amplification products, classifying the strains to be detected which meet the amplification results into nocardia seriolae of the same type.
4. The multiplex PCR identification method as claimed in claim 3, wherein the multiplex PCR amplification reaction is performed by the reaction procedure of: 95 ℃ for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 1min,30 cycles; extending at 72℃for 10min.
5. The multiplex PCR identification method as claimed in claim 3, wherein the reaction system of the multiplex PCR amplification reaction is: 25. Mu.L of premix, 15. Mu.L of primer combination and 5. Mu.L of DNA template, add ddH 2 O was made up to a total volume of 50. Mu.L.
6. Use of the primer combination according to claim 1 for the preparation of a product for typing nocardia seriolae strains.
CN202410038146.9A 2024-01-11 2024-01-11 Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application Active CN117551799B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410038146.9A CN117551799B (en) 2024-01-11 2024-01-11 Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410038146.9A CN117551799B (en) 2024-01-11 2024-01-11 Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application

Publications (2)

Publication Number Publication Date
CN117551799A CN117551799A (en) 2024-02-13
CN117551799B true CN117551799B (en) 2024-03-19

Family

ID=89821877

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410038146.9A Active CN117551799B (en) 2024-01-11 2024-01-11 Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application

Country Status (1)

Country Link
CN (1) CN117551799B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101671640A (en) * 2001-01-30 2010-03-17 雀巢制品公司 The genome of a bifidobacterium
KR20110007345A (en) * 2009-07-16 2011-01-24 연세대학교 산학협력단 Rpob gene fragments and method for the diagnosis and identification of nocardia genus
CN101962678A (en) * 2010-09-26 2011-02-02 宁波大学 Nocardia seriolae fluorescence quantitative PCR detection kit and detection method
CN102906272A (en) * 2010-10-20 2013-01-30 Cj第一制糖株式会社 Microorganism producing o-phosphoserine and method of producing l-cysteine or derivatives thereof from o-phosphoserine using the same
CN104263844A (en) * 2014-10-21 2015-01-07 中国疾病预防控制中心传染病预防控制所 Nucleotide sequence for detecting Nocardia calcarea and application thereof
CN110878365A (en) * 2019-11-22 2020-03-13 广东海洋大学深圳研究院 Method for detecting pathogenic bacteria of fish sarcoidosis by multiple PCR
CN113005069A (en) * 2021-01-28 2021-06-22 广东海洋大学 Nocardia seriolae attenuated as well as preparation method and application thereof
CN113186319A (en) * 2021-06-22 2021-07-30 广东海洋大学 Primer, kit and method for detecting Nocardia seriolae
CN116179725A (en) * 2022-12-29 2023-05-30 广东海洋大学 Primer pair combination for multiple PCR detection of Nocardia seriolae and detection method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130338018A1 (en) * 2010-01-25 2013-12-19 University Of Florida Research Foundation Inc. Primers, sequences and recombinant probes for identification of mycobacterium species

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101671640A (en) * 2001-01-30 2010-03-17 雀巢制品公司 The genome of a bifidobacterium
KR20110007345A (en) * 2009-07-16 2011-01-24 연세대학교 산학협력단 Rpob gene fragments and method for the diagnosis and identification of nocardia genus
CN101962678A (en) * 2010-09-26 2011-02-02 宁波大学 Nocardia seriolae fluorescence quantitative PCR detection kit and detection method
CN102906272A (en) * 2010-10-20 2013-01-30 Cj第一制糖株式会社 Microorganism producing o-phosphoserine and method of producing l-cysteine or derivatives thereof from o-phosphoserine using the same
CN104263844A (en) * 2014-10-21 2015-01-07 中国疾病预防控制中心传染病预防控制所 Nucleotide sequence for detecting Nocardia calcarea and application thereof
CN110878365A (en) * 2019-11-22 2020-03-13 广东海洋大学深圳研究院 Method for detecting pathogenic bacteria of fish sarcoidosis by multiple PCR
CN113005069A (en) * 2021-01-28 2021-06-22 广东海洋大学 Nocardia seriolae attenuated as well as preparation method and application thereof
CN113186319A (en) * 2021-06-22 2021-07-30 广东海洋大学 Primer, kit and method for detecting Nocardia seriolae
CN116179725A (en) * 2022-12-29 2023-05-30 广东海洋大学 Primer pair combination for multiple PCR detection of Nocardia seriolae and detection method

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Development of TaqMan quantitative PCR assay for detection of Nocardia seriolae in fish and the environment;Yanxin Sun;J Microbiol Methods .;20221205;第205卷;1-6 *
诺卡菌特异性PCR快速检测方法的建立;蒋依依等;南方水产科学;20111205;第7卷(第6期);47-51 *
鰤鱼诺卡氏菌特异性PCR检测方法的建立;陈国权等;基因组学与应用生物学;20200925;第40卷(第Z2期);2656-2665 *

Also Published As

Publication number Publication date
CN117551799A (en) 2024-02-13

Similar Documents

Publication Publication Date Title
CN111187856A (en) Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof
CN112322764B (en) Detection kit and detection method for brucella
CN113249499B (en) Salmonella typhi detection kit, and preparation method and application thereof
CN113151522A (en) LFD-RPA technology-based rice bacterial leaf streak germ detection kit, primer probe composition and application thereof
CN112359125A (en) Method for rapidly detecting cryptococcus gatherensis
Cornejo et al. A multiplexed genotyping assay to determine vegetative incompatibility and mating type in Cryphonectria parasitica
CN117551799B (en) Primer combination for nocardia seriolae strain typing, multiplex PCR identification method and application
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
CN109486960B (en) Method for detecting Meloidogyne incognita by applying RPA technology, RPA primer and kit
CN116622909A (en) Isothermal amplification detection reagent and detection method for feline herpesvirus I type
CN110804677A (en) Nested duplex PCR (polymerase chain reaction) detection primer and kit for distinguishing African swine fever virus wild strain and gene deletion strain
CN109897912A (en) A kind of LAMP primer and the method for detecting Plasmopara viticola
CN106521038B (en) A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit
CN112501321B (en) Method for molecular typing of mycobacterium tuberculosis
CN116377092A (en) Single-tube nested qPCR reagent for detecting Brucella
CN114032336A (en) Method and kit for detecting cucumber mosaic virus
CN114540525A (en) Primer composition for detecting or assisting in detecting chlamydia psittaci and application thereof
Li Molecular differentiation of the four most commonly occurring Trichogramma (Hymenoptera: Trichogrammatidae) species in China.
CN110863067A (en) Primer pair and kit for detecting eel herpes virus
CN114107539B (en) LAMP primer composition for detecting pythium delicicola and application thereof
CN113862381B (en) Loop-mediated isothermal amplification primer, kit and method for detecting aedes albopictus
CN113981110B (en) Loop-mediated isothermal amplification primer, kit and method for detecting culex spinosa
CN110894551A (en) RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I)
CN116426668B (en) Primer group for detecting mucor based on nucleic acid mass spectrometry technology and application thereof
CN110358851B (en) Nucleic acid sequence, primer, method and kit for detecting bacillus cereus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant