CN111187856A

CN111187856A - Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof

Info

Publication number: CN111187856A
Application number: CN202010091557.6A
Authority: CN
Inventors: 王鑫杰; 张玉; 黄行许
Original assignee: ShanghaiTech University
Current assignee: ShanghaiTech University
Priority date: 2020-02-13
Filing date: 2020-02-13
Publication date: 2020-05-22
Anticipated expiration: 2040-02-13
Also published as: CN111187856B

Abstract

The invention discloses a Cpf1 fluorescent kit for rapidly detecting new coronavirus SARS-CoV-2 nucleic acid, which comprises a Cpf1 detection system and a fluorescent reporter system suitable for rapidly detecting SARS-CoV-2. In the invention, a series of specific crRNAs are designed aiming at 4 genes of orf1a, orf1b, N and E of SARS-CoV-2 virus, and SARS-CoV-2 virus nucleic acid can be sensitively and specifically detected. The invention adopts Cpf1 to detect the new coronavirus SARS-CoV-2 for the first time, and has the advantages of high sensitivity, strong specificity, short time consumption, high flux, direct interpretation by naked eyes, no dependence on large-scale experimental equipment and the like. These advantages make the Cpf1 fluorescence method developed by the invention convenient for clinical one-line rapid detection and identification diagnosis of the SARS-CoV-2 nucleic acid of the new coronavirus.

Description

Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof

Technical Field

The invention relates to a rapid detection method and a kit for a new coronavirus nucleic acid, in particular to a rapid diagnosis method and a kit for a new coronavirus SARS-CoV-2 virus nucleic acid based on Cpf1 fluorescence detection, belonging to the field of biotechnology.

Background

The international committee for viral classification (ICTV) formally classified the new coronavirus (2019-nCoV) as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The World Health Organization (WHO) announces that the disease caused by this virus is under the positive name COVID-19.

At present, the diagnosis of the new coronary pneumonia mainly comprises two types of virus nucleic acid molecule detection and chest imaging detection. The chest imaging detection mainly depends on the CT imaging result of the chest and lung part for judgment: the early stage shows multiple small spot shadows and interstitial changes, and the lung-external zone is obvious, so that the two lungs develop multiple wear glass shadows and infiltrative shadows. In severe cases, lung consolidation changes, even 'white lung' and pleural effusion are rare. However, the chest-lung CT examination is required to be specialized. In the approach of molecular biology, there are two approaches commonly used at present: gene sequencing and nucleic acid detection of the virus. The second generation sequencing can detect trace substances, but most hospitals do not have the assistance of sequencing equipment and a biological information team, and the detection period is high in cost and long, so that the second generation sequencing is not suitable for screening.

Current diagnostic methods rely on viral nucleic acid detection: identified by real-time reverse transcription polymerase chain reaction (rRT-PCR). Samples of the upper and lower respiratory tract, such as bronchial or alveolar lavage fluid and profuse sputum, were collected for each case, along with serum collected at the beginning of onset and 14 days after onset. At present, on the basis of meeting the standard of suspected cases, rRT-PCR detection is carried out on samples such as sputum, throat swabs, lower respiratory tract secretion and the like, and SARS-CoV-2 nucleic acid is positive, so that SARS-CoV-2 infection can be diagnosed. The detection of viral nucleic acids by rRT-PCR is mainly subject to: the quality of the kit and the number of P3 laboratories capable of undertaking clinical tests, the accuracy and stability of the P3 laboratory equipment, the number of workers capable of skilled stable operation, the need for expensive laboratory equipment, and the long test time.

At present, no effective treatment means or vaccine aiming at SARS-CoV-2 infection exists, and disease control mainly depends on strict physical isolation to cut off the transmission path, thereby directly causing serious economic loss. In view of the broad and rapid transmission pathway of SARS-CoV-2, rapid diagnosis of the virus is urgently required, which is very important for prevention and diagnosis of the disease. The SARS-CoV-2 is detected accurately and quickly, so that the quarantine decision can be taken immediately and immediately, and the purpose of blocking the diffusion risk is achieved.

CRISPR-Cas (Clustered differentiated short palindromic repeats, CRISPRs) is an adaptive immune system in bacteria, and Cas proteins degrade foreign nucleic acids through RNA-guided nuclease targeting [1,2 ]. Among them, CRISPR-Cas12a (Cpf1) belongs to Cas enzyme second family, and is used to guide RNA to guide double-stranded DNA cleavage of single RuvC catalytic domain. The Cpf1 enzymes recognize a Thymine (Thymine, T) nucleotide rich spacer adjacent motif (PAM) 3, catalyze their own guided CRISPR RNA (crRNA) maturation 4, and specifically recognize and cleave complementary paired double-stranded dna (dsdna) 3. Strong non-specific single-stranded DNA (ssdna) trans-cleavage activity can be induced when the CRISPR/Cpf1 protein recognizes cleavage of the target double-stranded DNA in a sequence-specific manner [5 ]. Based on the above properties of Cpf1, we developed a rapid and accurate assay for detecting SARS-CoV-2 viral nucleic acid in clinical specimens. Firstly, the clinical sample is processed by virus inactivation treatment to release SARS-CoV-2 nucleic acid in the sample to be detected. Viral RNA is Reverse Transcribed (RT) to obtain DNA and Recombinase Polymerase Amplification (RPA) is performed [6 ]. The Cpf1-crRNA complex binds to and cleaves the target dsDNA, which activates the trans-cleavage of ssDNA. Fluorescent reporter molecules coupled to ssDNA generate a fluorescent signal upon cleavage. The novel method called DNA endonuclease targeting CRISPR trans-reporter gene provides a powerful platform for rapidly and accurately detecting the novel coronavirus.

Reference to the literature

1.R,B.,et al.,CRISPR provides acquired resistance against viruses inprokaryotes. Science(New York,N.Y.),2007.315(5819):p.1709-12.

2.LA,M.and S.EJ,CRISPR interference limits horizontal gene transferin staphylococci by targeting DNA.Science(New York,N.Y.),2008.322(5909):p.1843-5.

3.B,Z.,et al.,Cpf1 is a single RNA-guided endonuclease of a class2CRISPR-Cas system.Cell,2015.163(3):p.759-71.

4.I,F.,et al.,The CRISPR-associated DNA-cleaving enzyme Cpf1 alsoprocesses precursor CRISPR RNA.Nature,2016.532(7600):p.517-21.

5.JS,C.,et al.,CRISPR-Cas12a target binding unleashes indiscriminatesingle-stranded DNase activity.Science(New York,N.Y.),2018.360(6387):p. 436-439.

6.O,P.,et al.,DNA detection using recombination proteins.PLoSbiology,2006. 4(7):p.e204.

Disclosure of Invention

The invention aims to solve the problem of rapid detection of the clinical new coronavirus SARS-CoV-2, and provides a rapid visualized Cpf1 kit for rapid detection of the new coronavirus SARS-CoV-2 nucleic acid with high sensitivity and strong specificity and a detection method thereof.

In order to achieve the above object, the present invention provides a Cpf1 kit for rapid nucleic acid detection of novel coronavirus SARS-CoV-2, comprising a fluorescent detection system of Cpf1 suitable for rapid nucleic acid detection of novel coronavirus SARS-CoV-2; the Cpf1 fluorescence detection system comprises: a specific crRNA, Cpf1 protein and single stranded DNA (ssDNA) reporter system for the detection segments of the novel coronavirus SARS-CoV-2 genes orf1a, orf1b, N and E;

the specific crRNA is: any one or more of orf1a-crRNA1 to orf1a-crRNA2 for orf1a gene, orf1b-crRNA1 to orf1b-crRNA3 for orf1b gene, N-crRNA1 to N-crRNA2 for N gene and E-crRNA1 to E-crRNA2 for E gene, the sequences of which are SEQ No.1 to SEQ No. 9; the single-stranded DNA (ssDNA) report system comprises ssDNA FQreporters used for fluorescence detection of a microplate reader or direct visual interpretation under a fluorescent lamp; the ssDNA FQ reporter is ssDNA labeled by 6-carboxyfluorescein (6-FAM) and a fluorescence quencher (BHQ1), and the labeling products are as follows: the gene is/56 FAM/TTTATTT/3BHQ1/, named ssDNA FQ reporter/56 FAM/TTTATTT/3BHQ 1/.

Preferably, the specific crRNA is: orf1a-crRNA1 and orf1a-crRNA2 mixed in equal proportion are named orf1 a-crRNAmix; or orf1b-crRNA1, orf1b-crRNA2 and orf1b-crRNA3 which are mixed in equal proportion and are named orf1 b-crRNAmix; or N-crRNA1 and N-crRNA2 which are mixed in equal proportion and are named as N-crRNAmix; or E-crRNA1 and E-crRNA2 which are mixed in equal proportion and are named as E-crRNAmix.

The invention also provides a preparation method of the Cpf1 reagent kit for rapidly detecting the SARS-CoV-2 nucleic acid of the novel coronavirus, which is characterized in that the preparation method of the specific crRNA comprises the following steps: aiming at SARS-CoV-2 virus nucleic acid orf1a, orf1b, N and E genes with the sequences from SEQ NO.10 to SEQ NO.13, searching a targeting sequence containing cpf1 recognition sequence (PAM) TTTN, and designing crRNA with the length of 23 bp; after the design is finished, preparing crRNA;

the preparation method of the Cpf1 protein comprises the following steps: optimizing prokaryotic codon aiming at cpf1 protein nucleic acid sequence to obtain sequence SEQ NO.14, constructing pET28a expression vector, performing low-temperature induced soluble protein expression, and obtaining target protein through affinity purification and molecular sieve purification;

the preparation method of the Cpf1 protein comprises the following steps: prokaryotic codon optimization is carried out on cpf1 protein nucleic acid sequence to obtain sequence SEQ NO.14, pET28a expression vector is constructed, low-temperature induction soluble protein expression is carried out, and target protein is obtained through affinity purification and molecular sieve purification.

Preferably, the preparation of the crRNA comprises constructing a vector pUC57-T7-crRNA, and obtaining the crRNA of interest by in vitro transcription; or directly synthesizing RNA corresponding to the crRNA sequence.

The Cpf1 kit for rapidly detecting the nucleic acid of the novel coronavirus SARS-CoV-2 can be used for fluorescence detection by a microplate reader and can also be used for fluorescence macroscopic detection. In the invention, when the fluorescence detection of a microplate reader is used, the detection exciting light is set to be 485-520 nm; when the direct detection is carried out by naked eyes, a light emitter capable of generating a 485nm wavelength light source is selected for detection.

When fluorescence detection is used, SARS-CoV-2 viral nucleic acid is present in the Cpf1 detection system and specifically activates the endonuclease activity of Cpf1 protein under the mediation of SARS-CoV-2 specific crRNA. After activation, the Cpf1 protein cleaves ssDNA FQ reporter labeled with a fluorescent group and a quenching group, so that the activated fluorescent group is released, and a fluorescence reading or a green reaction visible to the naked eye can be detected by using a microplate reader. Correspondingly, when SARS-CoV-2 virus nucleic acid does not exist in the sample to be detected, no fluorescence reading or no visible green reaction can be obtained.

The invention also provides a method for quickly detecting the nucleic acid of the novel coronavirus SARS-CoV-2, which is characterized by adopting the Cpf1 kit for quickly detecting the nucleic acid of the novel coronavirus SARS-CoV-2.

Preferably, the method for rapidly detecting the nucleic acid of the novel coronavirus SARS-CoV-2 comprises the following steps:

step a: inactivating viruses of the sample by utilizing a nucleic acid quick release reagent and releasing nucleic acid in the sample to be detected;

step b: amplifying nucleic acid in a sample to be detected by using an isothermal amplification primer: b, adding the products obtained in the step a into an RT-RPA isothermal amplification system by using specific primers SEQ NO.15 to SEQ NO.22 of SARS-CoV-2 virus nucleic acid orf1a, orf1b, N and E gene fragments, and reacting for 25min at 37 ℃ to obtain specific products;

step c: when the Cpf1 detection system is used for identifying and cutting SARS-CoV-2 virus nucleic acid orf1a, orf1b, N and E gene fragments: adding the product obtained in the step b into a Cpf1 detection system, and reacting for 25min at 37 ℃;

step d: directly detecting and interpreting whether SARS-CoV-2 virus nucleic acid exists in the sample to be detected by utilizing a fluorescent microplate reader or a fluorescent lamp.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention realizes the high sensitivity, high specificity and rapid visual detection of SARS-CoV-2 nucleic acid by using Cpf1 specific recognition nucleic acid fluorescence detection technology. Genetic bioinformatics analysis, SARS-CoV-2 virus sequence and SARS and bat-related SARS virus sequence in NCBI database are designed to aim at orf1a, orf1b, N and E gene fragment differential crRNA. In order to ensure the detection specificity, the designed crRNA sequence is searched for genes comprising human, animal, plant and microorganism in the NCBI nucleic acid database, and the high homology matching is not determined. Based on the recognition of specific PAM sequence characteristics by Cpf1, 9 specific crRNAs were designed on orf1a, orf1b, N and E gene target sequences. Through detection, 9 crRNAs can specifically recognize 4 genes of SARS-CoV-2 virus orf1a, orf1b, N and E respectively. And aiming at the same sample to be detected, the method can simultaneously detect SARS-CoV-2 virus 4 genes orf1a, orf1b, N and E, and can effectively improve the detection accuracy and credibility.

(2) The invention relates to a Cpf1 new coronavirus SARS-CoV-2-based rapid species detection tool, which comprises a fluorescent lamp-based direct visual detection by naked eyes and can realize convenient and rapid result interpretation. The invention provides an accurate, rapid and simple detection method for the first line of basic level experiments and clinics.

(3) The invention discloses a series of Cpf1 reaction systems and crRNA combinations for detecting new coronavirus SARS-CoV-2 nucleic acid, and the sequences are shown in SEQ ID NO.1 to NO.9 in sequence. The invention adopts the Cpf1 fluorescence method to detect the new coronavirus SARS-CoV-2 for the first time, and has the advantages of high sensitivity, strong specificity, short time consumption, high flux, no dependence on large-scale experimental equipment and the like. These advantages make the Cpf1 fluorescence-based detection method developed by the invention conveniently used for the primary experiment and clinical one-line primary rapid detection and identification diagnosis of new coronary pneumonia.

Drawings

FIG. 1 is a schematic diagram of a method for rapid detection of the novel coronavirus SARS-CoV-2 nucleic acid based on Cpf 1;

FIG. 2 shows the fluorescence detection effect of different genes of new coronavirus detected by different crRNAs;

FIG. 3 shows the direct visual interpretation of different genes of different crRNAs of the new coronavirus;

FIG. 4 Cpf1 sensitivity for fluorescence detection of New coronavirus SARS-CoV-2;

FIG. 5 naked eye detection sensitivity of Cpf1 for detecting New coronavirus SARS-CoV-2;

FIG. 6 fluorescent detection of Cpf1 for rapid detection of the SARS-CoV-2 and SARS specificity of the novel coronavirus;

FIG. 7 direct visual inspection of Cpf1 to rapidly detect the specificity of the novel coronavirus SARS-CoV-2;

FIG. 8 simulation detection of clinical SARS-CoV-2 nucleic acid sample fluorescence detection results;

FIG. 9 simulation detection of clinical SARS-CoV-2 nucleic acid sample direct visual detection results;

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, it should be understood that various changes and modifications can be made by those skilled in the art after reading the teachings of the present invention, and such equivalents also fall within the scope of the appended claims.

In the invention: RPA amplification kit

Basic kit was purchased from twist amp, inc; the crRNA in vitro Transcription cassette MEGAshortscript T7 Transcription Kit and the purification cassette MEGAclear Kit were purchased from Ambion; conventional reagents such as Tris-Base, NaCl, Tris-HCl, MgCl2, BSA and glycerol are available from ThermoFisher; the nucleic acid fragment for detection, the ssDNA probe and the RNA synthesis were completed by Nanjing Kinsley; the present invention uses a rapid nucleic acid release agent from nuozoken to obtain pre-treated nucleic acids.

The general technical schematic diagram of the invention is shown in the attached figure 1, and comprises the following 3 parts: preparation of nucleic acid samples to be detected, design and preparation of Cpf1 detection components, system construction and fluorescence detection.

Example 1: rapid and sensitive detection of SARS-CoV-2 gene fragment of new coronavirus

1.1 nucleic acid preparation

In this case, orf1a, orf1b, N and E gene fragments of the novel coronavirus SARS-CoV-2 are designed by referring to the sequence of NCBIWuhan-Hu-1 strain, synthesized by Nanjing Kingsler company and named pc-orf1a, pc-orf1b, pc-N and pc-E, and the corresponding sequences are SEQ NO.10 to SEQ NO.13, respectively.

RNA nucleic acid samples corresponding to orf1a, orf1b, N and E genes of the novel coronavirus SARS-CoV-2 were prepared by in vitro transcription. The specific operation is as follows: using MEGAShortscript T7 transcription kit (Thermo Fisher scientific), corresponding gene RNA samples, pcRNA-orf1a, pcRNA-orf1b, pcRNA-N and pcRNA-E, were transcribed using pc-orf1a, pc-orf1b, pc-N and pc-E as templates, respectively. The transcribed RNA was purified using MEGAclear kit (ThermoFisher Scientific) and recovered by ethanol precipitation; post-transcriptional RNA quality and concentration were determined and stored at-80 ℃ until use.

1.2 preparation of a CrRNA specific for SARS-CoV-2

Preparation of crRNA specific for SARS-CoV-2 the protocol was followed to search for a targeting sequence comprising the cpf1 recognition sequence (PAM) TTTN against orf1a, orf1b, N and E genes of SARS-CoV-2 and design a crRNA of 23bp length. Are designated orf1a-crRNA1 to orf1a-crRNA2 for orf1a gene, orf1b-crRNA1 to orf1b-crRNA3 for orf1b gene, N-crRNA1 to N-crRNA2 for N gene and E-crRNA1 to E-crRNA2 for E gene, respectively. After the design is complete, crRNA is prepared. The preparation of the crRNA can be carried out by synthesizing oligo by Nanjing Kinshire company, constructing vector pUC57-T7-crRNA, and obtaining the target crRNA through in vitro transcription, or can be carried out by directly synthesizing RNA corresponding to the crRNA sequence by Nanjing Kinshire company.

The crRNA of orf1a, orf1b, N and E genes of SARS-CoV-2 provided by the invention comprises SEQ NO.1 to SEQ NO.9, and the specific information is shown in Table 1:

TABLE 1 CrRNA specific for the nucleic acid of the novel coronavirus SARS-CoV-2

1.3 reverse transcription isothermal amplification reaction

In the present invention, reverse transcription isothermal amplification (RT-RPA) is used to pre-amplify single-stranded RNA (ssRNA) viral nucleic acids for the cpf1 detection reaction. RT-RPA amplification primers RT-RPA-F (forward primer) and RT-RPA-R (reverse primer) were designed and synthesized according to isothermal amplification reaction requirements, corresponding to SEQ No.15 to SEQ No.22 (Table 2). And (3) obtaining a sample to be detected by amplification by referring to the RT-RPA isothermal amplification operation step. The specific operation is as follows: isothermal amplification was performed in a 50. mu.L reaction system. mu.L of RNA sample, (18.5-x) mu.L of ddH₂O, 2. mu.L of RT-RPA-F, 2. mu.L of RT-RPA-R and 25. mu.L of reaction buffer solution are mixed evenly, added into a reaction tube and dissolved evenly. Finally, 2.5. mu.L of ethyl acetate was addedMagnesium, mixed and incubated at 39 ℃ for 25 minutes. And (4) carrying out next detection on the RT-RPA product.

TABLE 2 nucleic acid specific RT-RPA primer sequences for novel coronavirus nCoV

1.4 in this case, the 20 μ L system is used for the detection of the new coronavirus cpf1 as shown in table 3, but the method is not limited to the following steps:

TABLE 3 detection System for New coronavirus cpf1

1.5 full-wavelength ELIASA fluorescence detection

In the fluorescence detection of the microplate reader, 2 mu L of Buffer, 1 mu L of RnaseInhibitors, 1 mu L of Cpf1, 1 mu L of ssDNA FQ reporter, 5 mu L of RPA sample, 1 mu L of crRNA and 9 mu L H2O are sequentially added into the Cpf1 to the target gene detection system. The components are mixed evenly and then react for 25min at 37 ℃. Wherein, the concentration of RNase Inhibitors in the reaction system is 40U/. mu.L, the concentration of Cpf1 is 200 ng/. mu.L, the concentration of ssDNA FQ reporter is 25 pM/. mu.L, and the concentration of crRNA is 1 nM/. mu.L.

First, the detection efficiency of crRNA against SARS-CoV-2 virus nucleic acid was sequentially examined. And (3) adding 1 mu L of crRNA into a Cpf1 detection system respectively, keeping other components consistent, mixing uniformly, reacting at 37 ℃ for 25min, and carrying out subsequent result detection and judgment on the reaction products.

The Cpf1 detection system was assessed for activity using fluorescence detection. And (3) measuring the fluorescence of the detection reaction by using a full-wavelength microplate reader, wherein the excitation wavelength is 485nm, the emission wavelength is 520nm, and the fluorescence value of 25min of reading and detection is taken as the reaction value. The results of the reaction detection for the new coronavirus SARS-CoV-2 are shown in FIG. 2. The result shows that in the detection system, crRNA aiming at different gene segments can efficiently and specifically detect corresponding orf1a, orf1b, N and E gene segments.

1.5 direct interpretation by naked eye with fluorescent display

Meanwhile, products obtained after the cpf1 detection reaction is carried out for 25min are placed under a 485nm laser lamp, and the results can be directly interpreted by naked eyes. When the crRNA specifically recognizes the target nucleic acid fragment, the color of the reaction product changes from colorless to fluorescent green; correspondingly, if no corresponding target nucleic acid is to be detected, the color of the reaction product remains uncolored. After 25min of reaction detection at cpf1, visual interpretation was performed under fluorescent light and recorded by photography. As shown in FIG. 3, crRNAs aiming at different gene segments can efficiently and specifically detect corresponding orf1a, orf1b, N and E gene segments.

In view of the consistent detection effect of the crRNA for orf1a, orf1b, N and E genes in the present embodiment, orf1a-crRNA1 to orf1a-crRNA2 for orf1a gene were mixed in equal proportion to obtain orf1 a-crRNAmix; mixing orf1b-crRNA1 to orf1b-crRNA3 aiming at orf1b gene in equal proportion to obtain orf1 b-crRNAmix; mixing N-crRNA1 to N-crRNA2 in equal proportion aiming at the N gene to obtain N-crRNAmix; E-crRNA1 to E-crRNA2 aiming at the E gene are mixed in equal proportion to obtain E-crRNAmix. In the subsequent detection, orf1a-crRNAmix detects orf1a gene, orf1b-crRNAmix detects orf1b gene, N-crRNAmix detects N gene and E-crRNAmix detects E gene.

Example 2: high-sensitivity SARS-CoV-2 nucleic acid detection based on cpf1 fluorescence method

In this case, the following detection was performed to determine the sensitivity of cpf1 fluorescence method for SARS-CoV-2 detection.

First, the molecular weight of the test fragment was calculated from RNA samples pcRNA-orf1a, pcRNA-orf1b, pcRNA-N and pcRNA-E corresponding to orf1a, orf1b, N and E gene fragments of SARS-CoV-2, and subjected to 10-fold gradient dilution to obtain test samples containing 2 × E7, 2 × E6, 2 × E5, 2 × E4, 2 × E3, 2 × E2, 2 × E1 and 2 × E0 copies (copy/μl) per microliter.

The cpf 1-specific reaction was carried out on the diluted sample by the fluorescence method, and detection and interpretation of the fluorescence result were carried out in accordance with the detection procedure in example 1. The operation is briefly described as follows: the sample is diluted in 2. mu.L gradient and added into a 50. mu.L RT-RPA isothermal amplification reaction system for amplification. And (3) adding 10 mu L of isothermal amplification product into a 20 mu L cpf1 fluorescent nucleic acid detection system, uniformly mixing, and reacting at 37 ℃ for 25min to judge the fluorescence result.

In this case, cpf1 fluorescence method is used to detect the new coronavirus SARS-CoV-2, and enzyme-labeling instrument is used to detect (FIG. 4), so that high sensitivity detection of 4e0 copy virus can be realized; high sensitivity detection of 4e1 copies of virus was achieved using fluorescent visual detection (FIG. 5).

Example 3: high specificity detection of SARS-CoV-2 nucleic acid based on cpf1 fluorescence method

In this example, the following tests were carried out to determine whether the fluorescence method cpf1 could perform a highly specific reaction on SARS-CoV-2 and could effectively distinguish SARS virus from SARS-CoV-2 virus.

First, according to the present invention, for SARS-CoV-2 virus nucleic acid detection segments pcRNA-orf1a, pcRNA-orf1b, pcRNA-N and pcRNA-E, RNA samples of SARS virus-corresponding gene sequences were prepared as described in example 1: ncRNA-orf1a, ncRNA-orf1b, ncRNA-N and ncRNA-E.

Next, referring to example 1, SARS-CoV-2 and SARS-detected sample were prepared by RT-RPA reaction and amplified separately.

In the fluorescence detection, 2. mu.L of Buffer, 1. mu.L of LRnase Inhibitors, 1. mu.L of Cpf1, 1. mu.L of ssDNA FQ reporter, 1. mu.L of crRNA and 10. mu.L of detection sample are sequentially added into the Cpf1 detection system. The components are mixed evenly and reacted for 25min at 37 ℃. In the detection system, the concentration of RNase Inhibitors is 40U/. mu.L, the concentration of Cpf1 is 200 ng/. mu.L, the concentration of ssDNADB reporter is 25 pM/. mu.L, and the concentration of crRNA is 1 nM/. mu.L.

In this example, the detection activity of the Cpf1 detection system was determined using fluorescence detection. And (3) measuring the fluorescence of the detection reaction by using a full-wavelength enzyme labeling instrument, wherein the excitation wavelength is 485nm, the emission wavelength is 520nm, and the fluorescence value at the time of detection for 25min is taken as the reaction value. As shown in FIG. 6, the cpf1 fluorescence method of the present invention can detect SARS-CoV-2 virus nucleic acid with high specificity and has no response to SARS virus.

In the embodiment, after the cpf1 detection system reacts for 25min, the fluorescence reaction of the detection product can be interpreted by naked eyes under a 485nm laser lamp. As shown in FIG. 7, the cpf1 fluorescence method of the present invention can detect SARS-CoV-2 virus nucleic acid with high specificity and has no response to SARS virus.

Example 4: rapid detection of clinical SARS-CoV-2 virus nucleic acid by simulating cpf1 fluorescence method

The present embodiment simulates the nucleic acid of clinical tissue sample for fast detection of SARS-CoV-2, and the detection does not involve any clinical new coronavirus sample, and all the operational qualification is performed according to relevant laws and regulations and relevant regulations.

In this case, first, SARS-CoV-2 virus nucleic acid-corresponding RNA samples (pcRNA-orf1a, pcRNA-orf1b and pcRNA-N) and SARS virus nucleic acid-corresponding RNA samples (pcRNA-E ncRNA-orf1a, ncRNA-orf1b, ncRNA-N and ncRNA-E) in example 3 were spotted onto a pharyngeal swab to simulate clinical samples and tested.

First, virus inactivation and viral nucleic acid release are performed. This example uses a rapid nucleic acid release agent from Novomedium to obtain pre-treated nucleic acids. The method comprises the following steps: throat swabs were added to 50 μ L PBS to simulate lysis of virus into the liquid. And adding 20 mul of nucleic acid lysate into 3 mul of sample to be detected, adding an RNase inhibitor, standing for 3 minutes at normal temperature, adding 20 mul of neutralizing solution, and uniformly mixing for next detection. In the Cpf1 assay, 5. mu.L of each sample to be assayed was subjected to RT-RPA pre-amplification in the same manner as in example 1 to obtain a Cpf1 assay sample.

In the Cpf1 detection system, 2. mu.L Buffer, 1. mu.L RNase Inhibitors, 1. mu.L Cpf1, 1. mu.L ssDNA FQ reporter, 10. mu.L RPA sample and 1. mu.L crRNA were sequentially added. The components are mixed evenly and reacted for 25min at 37 ℃.

In this embodiment, the detection result cpf1 can be directly determined by naked eyes under a microplate reader or a fluorescent lamp. As shown in FIG. 8, the cpf1 fluorescence method of the present invention can be effectively used for determining the clinical positive and negative samples by the detection of the microplate reader. Similarly, the simulated clinical positive and negative samples were visually determined efficiently under fluorescent light (FIG. 9).

SEQUENCE LISTING

<110> Shanghai science and technology university

<120> Cpf1 kit for rapid detection of new coronavirus nucleic acid, and preparation method and application thereof

<130>PCN1200195

<160>22

<170>PatentIn version 3.5

<210>1

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1a-crRNA1

<400>1

TTTGGTGGTGCATCGTGTTGTCTGTAC 27

<210>2

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1a-crRNA2

<400>2

TTTGTGACTTAAAAGGTAAGTATGTAC 27

<210>3

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1b-crRNA1

<400>3

TTTCACTCAATACTTGAGCACACTCAT 27

<210>4

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1b-crRNA2

<400>4

TTTTTAACATTTGTCAAGCTGTCA 27

<210>5

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1b-crRNA3

<400>5

TTTTAACATTTGTCAAGCTGTCACGGC 27

<210>6

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>N-crRNA1

<400>

TTTCTTGAACTGTTGCGACTACGTGAT 27

<210>7

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>N-crRNA2

<400>7

TTTGCTGCTGCTTGACAGATTGAACCA 27

<210>8

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>E-crRNA1

<400>8

TTTCTTGCTTTCGTGGTATTCTTGCTA 27

<210>9

<211>27

<212>DNA

<213>Artificial Sequence

<220>

<223>E-crRNA2

<400>9

TTTCGTGGTATTCTTGCTAGTTACACT 27

<210>10

<211>299

<212>DNA

<213>Artificial Sequence

<220>

<223>pc-orf1a

<400>10

actggtactggtcaggcaataacagttacaccggaagccaatatggatcaagaatccttt 60

ggtggtgcatcgtgttgtctgtactgccgttgccacatagatcatccaaatcctaaagga 120

ttttgtgacttaaaaggtaagtatgtacaaatacctacaacttgtgctaatgaccctgtg 180

ggttttacacttaaaaacacagtctgtaccgtctgcggtatgtggaaaggttatggctgt 240

agttgtgatcaactccgcgaacccatgcttcagtcagctgatgcacaatcgtttttaa 299

<210>11

<211>299

<212>DNA

<213>Artificial Sequence

<220>

<223>pc-orf1b

<400>11

cacaccgtttctatagattagctaatgagtgtgctcaagtattgagtgaaatggtcatgt 60

gtggcggttcactatatgttaaaccaggtggaacctcatcaggagatgccacaactgctt 120

atgctaatagtgtttttaacatttgtcaagctgtcacggccaatgttaatgcacttttat 180

ctactgatggtaacaaaattgccgataagtatgtccgcaatttacaacacagactttatg 240

agtgtctctatagaaatagagatgttgacacagactttgtgaatgagttttacgcatat 299

<210>12

<211>228

<212>DNA

<213>Artificial Sequence

<220>

<223>pc-E

<400>12

atgtactcattcgtttcggaagagacaggtacgttaatagttaatagcgtacttcttttt 60

cttgctttcgtggtattcttgctagttacactagccatccttactgcgcttcgattgtgt 120

gcgtactgctgcaatattgttaacgtgagtcttgtaaaaccttctttttacgtttactct 180

cgtgttaaaaatctgaattcttctagagttcctgatcttctggtctaa 228

<210>13

<211>299

<212>DNA

<213>Artificial Sequence

<220>

<223>pc-N

<400>13

gctaacaatgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttc 60

tacgcagaagggagcagaggcggcagtcaagcctcttctcgttcctcatcacgtagtcgc 120

aacagttcaagaaattcaactccaggcagcagtaggggaacttctcctgctagaatggct 180

ggcaatggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttgag 240

agcaaaatgtctggtaaaggccaacaacaacaaggccaaactgtcactaagaaatctgc 299

<210>14

<211>3744

<212>DNA

<213>Artificial Sequence

<220>

<223> cpf1 protein nucleic acid sequence

<400>14

agcaagctgg aaaaatttac caactgctac agcctgagca agaccctgcg tttcaaagcg 60

atcccggttg gcaagaccca ggaaaacatt gacaacaaac gtctgctggt tgaggacgaa 120

aagcgtgcgg aggattataa aggtgtgaag aaactgctgg atcgttacta tctgagcttt 180

atcaacgacg tgctgcacag cattaagctg aaaaacctga acaactacat cagcctgttc 240

cgtaagaaaa cccgtaccga gaaggaaaac aaagagctgg aaaacctgga aatcaacctg 300

cgtaaggaga ttgcgaaggc gttcaagggt aacgagggct acaagagcct gttcaagaaa 360

gatatcatcg aaaccatcct gccggagttc ctggacgata aggacgaaat tgcgctggtt 420

aacagcttca acggttttac caccgcgttc accggcttct ttgataaccg tgagaacatg 480

tttagcgagg aagcgaaaag caccagcatc gcgttccgtt gcattaacga aaacctgacc 540

cgttacatca gcaacatgga cattttcgag aaggttgacg cgatctttga taaacacgag 600

gtgcaggaaa tcaaggagaa aattctgaac agcgactatg atgttgaaga tttctttgag 660

ggtgaattct ttaactttgt tctgacccaa gagggcatcg acgtgtacaa cgcgatcatt 720

ggtggcttcg tgaccgaaag cggcgagaag atcaaaggcc tgaacgagta cattaacctg 780

tataaccaga agaccaaaca aaagctgccg aaatttaagc cgctgtataa gcaggtgctg 840

agcgatcgtg aaagcctgag cttctacggc gagggctata ccagcgacga ggaagttctg 900

gaagtgtttc gtaacaccct gaacaaaaac agcgagatct tcagcagcat taagaaactg 960

gaaaagctgt tcaaaaactt tgacgagtac agcagcgcgg gtatctttgt taagaacggc 1020

ccggcgatca gcaccattag caaagatatc ttcggtgaat ggaacgtgat tcgtgacaag 1080

tggaacgcgg agtatgacga tatccacctg aagaaaaagg cggtggttac cgaaaagtac 1140

gaggacgatc gtcgtaaaag cttcaaaaag attggcagct ttagcctgga acagctgcaa 1200

gagtacgcgg acgcggatct gagcgtggtt gaaaaactga aggagatcat tatccagaag 1260

gttgatgaaa tctacaaagt gtatggtagc agcgagaagc tgttcgacgc ggattttgtt 1320

ctggagaaga gcctgaaaaa gaacgacgcg gtggttgcga tcatgaagga cctgctggat 1380

agcgtgaaaa gcttcgaaaa ctacattaag gcgttctttg gtgaaggcaa agagaccaac 1440

cgtgacgaga gcttctatgg cgattttgtt ctggcgtacg acatcctgct gaaggtggac 1500

cacatctacg atgcgattcg taactatgtt acccaaaaac cgtacagcaa ggataagttc 1560

aagctgtact tccagaaccc gcaattcatg ggtggctggg acaaggataa agagaccgac 1620

tatcgtgcga ccatcctgcg ttacggtagc aagtactatc tggcgattat ggataaaaag 1680

tacgcgaaat gcctgcagaa gatcgacaaa gacgatgtta acggtaacta cgaaaagatc 1740

aactacaagc tgctgccggg cccgaacaag atgctgccga aagtgttctt tagcaaaaag 1800

tggatggcgt actataaccc gagcgaggac atccaaaaga tctacaagaa cggtaccttc 1860

aaaaagggcg atatgtttaa cctgaacgac tgccacaagc tgatcgactt ctttaaagat 1920

agcattagcc gttatccgaa gtggagcaac gcgtacgatt tcaactttag cgagaccgaa 1980

aagtataaag acatcgcggg tttttaccgt gaggttgagg aacagggcta taaagtgagc 2040

ttcgaaagcg cgagcaagaa agaggtggat aaactggtgg aggaaggtaa actgtacatg 2100

ttccaaatct acaacaagga cttcagcgat aagagccacg gcaccccgaa cctgcacacc 2160

atgtacttca agctgctgtt tgacgaaaac aaccatggtc agatccgtct gagcggtggc 2220

gcggagctgt tcatgcgtcg tgcgagcctg aagaaagagg agctggttgt gcacccggcg 2280

aacagcccga ttgcgaacaa aaacccggat aacccgaaaa agaccaccac cctgagctac 2340

gacgtgtata aggataaacg ttttagcgaa gaccaatacg agctgcacat tccgatcgcg 2400

attaacaagt gcccgaaaaa catcttcaag attaacaccg aagttcgtgt gctgctgaaa 2460

cacgacgata acccgtatgt tatcggtatt gaccgtggcg agcgtaacct gctgtacatc 2520

gtggttgtgg acggtaaagg caacattgtg gaacagtata gcctgaacga gattatcaac 2580

aactttaacg gtatccgtat taagaccgat taccacagcc tgctggacaa aaaggagaag 2640

gaacgtttcg aggcgcgtca gaactggacc agcatcgaaa acattaagga gctgaaagcg 2700

ggctatatca gccaagttgt gcacaagatt tgcgaactgg ttgagaaata cgatgcggtg 2760

atcgcgctgg aggacctgaa cagcggtttt aagaacagcc gtgttaaggt ggaaaagcag 2820

gtttaccaaa agttcgagaa gatgctgatc gataagctga actacatggt ggacaaaaag 2880

agcaacccgt gcgcgaccgg tggcgcgctg aaaggttatc agattaccaa caagttcgaa 2940

agctttaaaa gcatgagcac ccaaaacggc ttcatctttt acattccggc gtggctgacc 3000

agcaaaatcg atccgagcac cggttttgtt aacctgctga agaccaaata taccagcatt 3060

gcggatagca aaaagttcat cagcagcttt gaccgtatta tgtacgtgcc ggaggaagac 3120

ctgttcgagt ttgcgctgga ctataagaac ttcagccgta ccgacgcgga ctacatcaaa 3180

aagtggaaac tgtacagcta tggtaaccgt atccgtattt tccgtaaccc gaaaaagaac 3240

aacgtttttg actgggagga agtgtgcctg accagcgcgt ataaggaact gttcaacaaa 3300

tacggtatca actatcagca aggcgatatt cgtgcgctgc tgtgcgagca gagcgacaag 3360

gcgttctaca gcagctttat ggcgctgatg agcctgatgc tgcaaatgcg taacagcatc 3420

accggtcgta ccgatgttga ttttctgatc agcccggtga aaaacagcga cggcattttc 3480

tacgatagcc gtaactatga agcgcaggag aacgcgattc tgccgaagaa cgcggacgcg 3540

aacggtgcgt ataacatcgc gcgtaaagtt ctgtgggcga ttggccagtt caaaaaggcg 3600

gaggacgaaa agctggataa ggtgaaaatc gcgattagca acaaagaatg gctggagtac 3660

gcgcaaacca gcgttaagca cgagaacctg tacttccaat cccaccacca ccaccaccac 3720

caccaccacc accaccacca ctga 3744

<210>15

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>ofr1a-C-RT-RPA-F

<400>15

actggtactggtcaggcaataacagttacaccg 33

<210>16

<211>32

<212>DNA

<213>Artificial Sequence

<220>

<223>ofr1a-C-RT-RPA-R

<400>16

ttgtgcatcagctgactgaagcatgggttcgc 32

<210>17

<211>34

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1b-N-RT-RPA-F

<400>17

cacaccgtttctatagattagctaatgagtgtgc 34

<210>18

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>orf1b-N-RT-RPA-R

<400>18

tgcgtaaaactcattcacaaagtctgtgtcaac 33

<210>19

<211>32

<212>DNA

<213>Artificial Sequence

<220>

<223>E-RT-RPA-F

<400>19

tgtactcattcgtttcggaagagacaggtacg 32

<210>20

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<223>E-RT-RPA-R

<400>20

tagaccagaagatcaggaactctagaagaattcag 35

<210>21

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>N-RT-RPA-F

<400>21

ctaacaatgctgcaatcgtgctacaacttcct 33

<210>22

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>N-RT-RPA-R

<400>22

ttcttagtgacagtttggccttgttgttgttgg 33

Claims

1. A Cpf1 kit for rapidly detecting new coronavirus SARS-CoV-2 nucleic acid is characterized by comprising a Cpf1 fluorescence detection system suitable for rapidly detecting new coronavirus SARS-CoV-2; the Cpf1 fluorescence detection system comprises: specific crRNA, Cpf1 protein and ssDNA reporter system for the detection segments of the orf1a, orf1b, N and E genes of the novel coronavirus SARS-CoV-2;

the specific crRNA is any one or more of orf1a-crRNA1 to orf1a-crRNA2 for orf1a gene, orf1b-crRNA1 to orf1b-crRNA3 for orf1b gene, N-crRNA1 to N-crRNA2 for N gene and E-crRNA1 to E-crRNA2 for E gene, and the sequence of the specific crRNA is SEQ NO.1 to SEQ NO. 9;

the ssDNA report system comprises ssDNA FQreporters used for fluorescence detection of a microplate reader or direct visual interpretation under a fluorescent lamp, the ssDNA FQ reporters are ssDNA labeled by 6-carboxyfluorescein and a fluorescence quencher, and the labeled products are as follows: the gene is/56 FAM/TTTATTT/3BHQ1/, named ssDNA FQ reporter/56 FAM/TTTATTT/3BHQ 1/.

2. The Cpf1 kit for rapid detection of neocoronavirus SARS-CoV-2 nucleic acid of claim 1, wherein the specific crRNA is: orf1a-crRNA1 and orf1a-crRNA2 mixed in equal proportion are named orf1 a-crRNAmix; or orf1b-crRNA1, orf1b-crRNA2 and orf1b-crRNA3 which are mixed in equal proportion and are named orf1 b-crRNAmix; or N-crRNA1 and N-crRNA2 which are mixed in equal proportion and are named as N-crRNAmix; or E-crRNA1 and E-crRNA2 which are mixed in equal proportion and are named as E-crRNAmix.

3. The method for preparing Cpf1 kit for rapid detection of neocoronavirus SARS-CoV-2 nucleic acid according to claim 1 or 2, wherein the method for preparing the specific crRNA comprises: aiming at SARS-CoV-2 virus nucleic acid orf1a, orf1b, N and E genes with the sequences from SEQ NO.10 to SEQ NO.13, searching a targeting sequence containing a cpf1 recognition sequence TTTN, and designing crRNA with the length of 23 bp; after the design is finished, preparing crRNA; the preparation method of the Cpf1 protein comprises the following steps: prokaryotic codon optimization is carried out on cpf1 protein nucleic acid sequence to obtain a sequence SEQ NO.14, a pET28a expression vector is constructed, low-temperature induction soluble protein expression is carried out, and target protein is obtained through affinity purification and molecular sieve purification; the preparation method of the Cpf1 protein comprises the following steps: prokaryotic codon optimization is carried out on cpf1 protein nucleic acid sequence to obtain sequence SEQ NO.14, pET28a expression vector is constructed, low-temperature induction soluble protein expression is carried out, and target protein is obtained through affinity purification and molecular sieve purification.

4. The method for preparing the Cpf1 kit for rapidly detecting the SARS-CoV-2 nucleic acid of the neocoronavirus as claimed in claim 3, wherein the preparation of the crRNA comprises constructing a vector pUC57-T7-crRNA, and obtaining the crRNA of interest by in vitro transcription; or directly synthesizing RNA corresponding to the crRNA sequence.

5. A method for rapidly detecting the nucleic acid of the novel coronavirus SARS-CoV-2, which is characterized in that the Cpf1 kit for rapidly detecting the nucleic acid of the novel coronavirus SARS-CoV-2 according to claim 1 or 2 is adopted.

6. The method for rapidly detecting the nucleic acid of the novel coronavirus SARS-CoV-2 according to claim 5, wherein the method for rapidly detecting the nucleic acid of the novel coronavirus comprises the following steps:

step a: releasing nucleic acid in a sample to be detected by using a nucleic acid quick release reagent;

step b: amplifying nucleic acid in a sample to be detected by using a reverse transcription isothermal amplification primer: b, adding the products obtained in the step a into an RT-RPA isothermal amplification system by using specific primers SEQ NO.15 to SEQ NO.22 of SARS-CoV-2 virus nucleic acid orf1a, orf1b, N and E gene fragments, and reacting for 25min at 37 ℃ to obtain specific products;

step c: detection of SARS-CoV-2 nucleic acid using the Cpf1 detection System: adding the product obtained in the step b into a Cpf1 detection system, and reacting for 25min at 37 ℃;

step d: the result of SARS-CoV-2 virus nucleic acid is read by naked eye under enzyme labeling instrument or fluorescent lamp.