CN114015792B

CN114015792B - Fluorescent kit for detecting Brucella and detection method

Info

Publication number: CN114015792B
Application number: CN202111327518.2A
Authority: CN
Inventors: 王国俊; 李学洋; 李怀珠
Original assignee: Inner Mongolia University
Current assignee: Inner Mongolia University
Priority date: 2021-11-10
Filing date: 2021-11-10
Publication date: 2023-07-07
Anticipated expiration: 2041-11-10
Also published as: CN114015792A

Abstract

The invention relates to a fluorescent kit for detecting Brucella and a detection method. The kit comprises crRNA for detecting Brucella, and the sequence of the crRNA is shown as SEQ ID NO. 1-10; or crDNA for detecting Brucella, the sequence of which is shown as SEQ ID NO. 11-20. The fluorescent kit for Brucella provided by the invention can simultaneously distinguish whether the sample to be detected is the wild strain of Brucella bovis or the A19 vaccine strain of Brucella, and effectively solves the problem of respectively identifying and distinguishing the A19 vaccine strain and the wild strain in the prior art. Compared with the traditional detection method, the detection method provided by the invention has the advantages of strong relative bit variability, low detection limit, high sensitivity, low price, simplicity and rapidness in operation and convenience in carrying equipment and instruments, and the detection sensitivity can reach 18aM.

Description

Fluorescent kit for detecting Brucella and detection method

Technical Field

The invention relates to a fluorescent kit and a detection method for detecting Brucella, belonging to the technical field of biological detection.

Background

Brucellosis (Brucellosis) is a disease caused by Brucella (Brucella) infection, and is a systemic infectious disease of human and livestock, which is called as "Brucellosis" for short, and also called as Zhonghai achalasia heat, malta heat, wave heat and the like. The world animal health Organization (OIE) lists it as a legal animal reporting disease. Brucella can invade the body through skin mucosa, respiratory tract, digestive tract and other ways to cause clinical symptoms such as fever, abortion, infertility, weakness, arthralgia and the like. The brucella hosts are wide, the infectivity is strong, and different brucella species have the capability of cross infection among hosts, and the brucella species form serious threat to animal husbandry and human health. Therefore, the development of simple, rapid and accurate Brucella detection technology under the current severe prevention and control situation is urgent.

Brucella (Brucella) is a gram-negative motionless bacterium, has no capsule (smooth micro capsule), is positive for thixotropic enzymes and oxidase, has absolute aerophilic bacteria, can reduce nitrate, is parasitic in cells, and can survive in a wide variety of livestock bodies. At present, 7 species of brucella are mainly selected from the group consisting of sheep species brucella, cattle species brucella, pig species brucella, canine species brucella, epididymis ovis species brucella, sarin murine species brucella and marine mammal species brucella, and 21 biological species. Brucellosis is widely distributed throughout the world, and there are 170 countries and regions of the world under investigation where brucellosis is reported to occur, the most severe regions being located on coastal aspects of the mediterranean and in the arabian peninsula, which is also common in india, mexico, and in the southern and mid-U.S. regions. Although some countries have effectively controlled brucellosis, the middle subunit region is gradually becoming a new area of human brucellosis. About 50 tens of thousands of human brucellosis occur annually, statistically. Brucellosis also exists widely in China, especially in areas where animal husbandry is the main production. The monitored data of brucellosis in 2009 shows that there are 29 provinces in China and there are livestock brucellosis in the market, and the infection amount of cattle, sheep, pigs and the like is as large as millions, and the disease is found in the pasture areas such as inner Mongolia, northeast, northwest and the like. Human brucellosis also has an upward trend, and human brucellosis epidemic situations show obvious occupational, regional and seasonal properties, and can be related to animals infected by contact. Therefore, brucellosis in animals must be fundamentally prevented and controlled.

At present, the Brucella detection is mainly carried out by using the traditional pathogen separation culture technology, the serological detection technology, the molecular biological detection technology and the like. The traditional detection methods have various limitations, such as complicated conventional biochemical identification process, long period and low efficiency; the immunity detection specificity is not strong, and the omission is easy to cause; RT-PCR requires time consuming, cumbersome, expensive equipment, inconvenient to carry and requires manipulation by a professional. This makes it particularly important to develop a simple, rapid and accurate on-site diagnostic method for brucellosis. Therefore, it is highly desirable to provide a specific fragment and detection method that are simple, rapid, and highly sensitive.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a fluorescent kit for detecting Brucella and a detection method.

The technical scheme of the invention is as follows:

a crRNA for detecting brucella, wherein the crRNA is selected from the group consisting of the sequences set forth in seq id no:

crRNA-WT-1: the sequence is shown as SEQ ID NO. 1;

crRNA-Vac-1: the sequence is shown as SEQ ID NO. 2;

crRNA-WT-2: the sequence is shown as SEQ ID NO. 3;

crRNA-Vac-2: the sequence is shown as SEQ ID NO. 4;

crRNA-WT-3: the sequence is shown as SEQ ID NO. 5;

crRNA-Vac-3: the sequence is shown as SEQ ID NO. 6;

crRNA-WT-4: the sequence is shown as SEQ ID NO. 7;

crRNA-Vac-4: the sequence is shown as SEQ ID NO. 8;

crRNA-WT-5: the sequence is shown as SEQ ID NO. 9;

crRNA-Vac-5: the sequence is shown as SEQ ID NO. 10.

A crDNA for detecting brucella, wherein the crDNA is selected from the group consisting of the sequences set forth in seq id no:

crDNA-WT-1: the sequence is shown as SEQ ID NO. 11;

crDNA-Vac-1: the sequence is shown as SEQ ID NO. 12;

crDNA-WT-2: the sequence is shown as SEQ ID NO. 13;

crDNA-Vac-2: the sequence of the polypeptide is shown as SEQ ID NO. 14;

crDNA-WT-3: the sequence is shown as SEQ ID NO. 15;

crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16;

crDNA-WT-4: the sequence is shown as SEQ ID NO. 17;

crDNA-Vac-4: the sequence of the polypeptide is shown as SEQ ID NO. 18;

crDNA-WT-5: the sequence is shown as SEQ ID NO. 19;

crDNA-Vac-5: the sequence of the polypeptide is shown as SEQ ID NO. 20.

A DNA for detecting brucella, wherein the DNA is selected from the group consisting of:

DNA-WT-1: the sequence is shown as SEQ ID NO. 21;

DNA-Vac-1: the sequence of the polypeptide is shown as SEQ ID NO. 22;

DNA-WT-2: the sequence of the polypeptide is shown as SEQ ID NO. 23;

DNA-Vac-2: the sequence is shown as SEQ ID NO. 24;

DNA-WT-3: the sequence is shown as SEQ ID NO. 25;

DNA-Vac-3: the sequence is shown as SEQ ID NO. 26;

DNA-WT-4: the sequence of the polypeptide is shown as SEQ ID NO. 27;

DNA-Vac-4: the sequence of the polypeptide is shown as SEQ ID NO. 28;

DNA-WT-5: the sequence of the polypeptide is shown as SEQ ID NO. 29;

DNA-Vac-5: the sequence of which is shown as SEQ ID NO. 30.

The crRNA-WT and the crRNA-Vac can be obtained through artificial synthesis or can be obtained through transcription by taking crDNA-WT and crDNA-Vac as templates, wherein the DNA-WT is a targeting sequence of the crRNA-WT, and the DNA-Vac is a targeting sequence of the crRNA-Vac and is used for detecting and distinguishing Brucella bovis wild strains from Brucella melitensis A19 vaccine strains.

A fluorescent kit for detecting brucella, comprising crRNA or crDNA as described above.

Preferably, according to the invention, the kit further comprises a Cas protein and a fluorescent probe;

further preferred, the Cas protein is a CRISPR-Cas13 protein;

according to the invention, preferably, the fluorescent probe sequence is labeled with a fluorescent group at the 5-end and a quenching group at the 3-end.

Further preferably, the fluorophore is FAM or ROX; the quenching group is BHQ1 or BHQ2.

Further preferably, the fluorescent probe ssRNA fluorescent probe has a VAC fluorescent probe sequence of 5 '-FAM-UUUU-3' BHQ1; the WT fluorescent probe sequence is 5'-ROX-UUUUU-3' BHQ2.

A method for detecting Brucella by using the kit comprises the following steps:

(1) Extracting genome of a sample to be detected;

(2) Taking the extracted genome of the sample to be detected as a template, adding the template into a reaction system containing reaction liquid and polymerase, and carrying out RPA amplification;

(3) Taking RPA amplification products, respectively establishing a WT detection system and a VAC detection system, and incubating for 5-30min at 37 ℃;

(4) Respectively placing the WT detection system and the VAC detection system under an LED illumination lamp, and indicating that the sample to be detected is a wild strain when the fluorescent color of the detection liquid is red; when the fluorescent color of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when no fluorescent display is formed, it is indicated that the test sample is free of Brucella infection.

According to the invention, in the step (1), the sample to be tested is whole bovine blood, bovine urine or bovine saliva which is pre-inactivated at 65-80 ℃ for 10 minutes.

According to a preferred embodiment of the present invention, in step (2), the primers for RPA amplification are respectively:

forward primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；

reverse primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GACATATACACGGCATTTGATAGGGGACATA-3'；

forward primers for crRNA-WT-2 and crRNA-Vac-2:

5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；

reverse primers for crRNA-WT-2 and crRNA-Vac-2:

5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3'；

forward primers for crRNA-WT-3 and crRNA-Vac-3:

5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；

reverse primers for crRNA-WT-3 and crRNA-Vac-3:

5'-CAGATAAGCGATCAACACACCATTGACCGCG-3'；

forward primers for crRNA-WT-4 and crRNA-Vac-4:

5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；

reverse primers for crRNA-WT-4 and crRNA-Vac-4:

5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3'；

forward primers for crRNA-WT-5 and crRNA-Vac-5:

5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；

reverse primers for crRNA-WT-5 and crRNA-Vac-5:

5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3'。

according to a preferred embodiment of the present invention, in step (2), the RPA amplification system is: RPA base reaction ball one tube, rehydration buffer 29.5. Mu.L, magnesium acetate buffer 2.5. Mu.L, forward primer 2.5. Mu.L, reverse primer 2.5. Mu.L, the remainder was made up with 8. Mu.L of enzyme free water, and then 5 aliquots were made, one portion per 9. Mu.L, 1. Mu.L of sample to be tested was added per portion, and the total volume was 10. Mu.L.

The amplification conditions were: the reaction temperature is 39-42 ℃ and the incubation time is 5-20 min.

Wherein the RPA base reaction sphere, the rehydration buffer and the magnesium acetate buffer are all derived from TwitAmp ^R Basic kit, RPA Basic reaction ball is spherical solid, contains components such as recombinase, polymerase, etc.

Preferably, in step (3), the WT detection system and the VAC detection system are the same, specifically: tris-HCl (400 mM), mgCl ₂ (120 mM), ssRNA fluorescent probe (5. Mu.M), crRNA 1. Mu.L, RNase Inhibitor 1. Mu. L, cas13a protein 2. Mu. L, T7 Polymerase 0.5. Mu. L, rNTP 0.8.8. Mu.L, RPA amplification product 1. Mu.L, total volume 20. Mu.L.

According to the invention, in the step (4), the LED illuminating lamp is a portable LED illuminating lamp, and the excitation wavelength is 360-450 nanometers.

The invention is not described in detail in the prior art.

The invention has the technical characteristics that:

the Cas13a protein in the detection system of the present invention binds to the crRNA (Vac) to form a Cas13a-crRNA (Vac) complex that specifically recognizes the transcript of DNA (Vac) in the RPA amplified product, and if DNA (Vac) fragments are present in the RPA amplified product, the Cas13a protein is activated and cleaves the ssRNA fluorescent reporter group. The cut ssRNA fluorescent reporter group emits fluorescence after being excited by the LED device, which indicates that the sample is positive, green fluorescence is emitted to be infected by vaccine strain, and red fluorescence is emitted to be infected by wild strain. If no DNA (Vac) fragment is present in the RPA amplification product, cas13a will not be activated, the ssRNA fluorescent reporter will not be cleaved, and no fluorescent display will be formed, indicating that the sample is negative and no brucella infection is present in the sample.

The beneficial effects are that:

1. the fluorescent kit for Brucella provided by the invention can simultaneously distinguish whether the sample to be detected is the wild strain of Brucella bovis or the A19 vaccine strain of Brucella, and effectively solves the problem of respectively identifying and distinguishing the A19 vaccine strain and the wild strain in the prior art. Compared with the traditional detection method, the detection method provided by the invention has the advantages of strong relative bit variability, low detection limit, high sensitivity, low price, simplicity and rapidness in operation and convenience in carrying equipment and instruments, and the detection sensitivity can reach 18aM.

2. The detection method provided by the invention combines the RPA amplification technology, the CRISPR system and the rapid fluorescence detection technology, reduces the mutual interference through reasonable proportion, ensures that the respective functions of the reaction reagents can still be accurately and specifically realized, obtains the result through the combination of amplification and detection, ensures that the whole detection process takes very short time to be completed within 5-30min when qualitatively detecting, has simple operation steps, can visually distinguish whether a sample to be detected is a vaccine strain or a wild strain through fluorescent color, and provides a brand-new thought and method for purifying Brucella.

Drawings

FIG. 1 is a schematic diagram of the detection principle of the fluorescent kit of the invention.

FIG. 2 is a diagram of differential gene analysis of 113 gene.

FIG. 3 is a diagram showing differential gene analysis of methylrotonoyl-CoA carboxylase gene.

FIG. 4 is a differential gene analysis diagram of ABC transporter permease gene.

FIG. 5 is a diagram showing differential gene analysis of MFS transporter gene.

FIG. 6 is a differential gene analysis diagram of the ribD gene.

FIG. 7 is a photograph showing the result of inspection in example 3 of the present invention.

In the figure: the left graph is used for carrying out fluorescence detection on wild strains aiming at five differential genes, the red fluorescence detection positive result and the negative control result are used for carrying out fluorescence detection on vaccine strains aiming at five differential genes, and the right graph is used for carrying out green fluorescence detection positive result and the negative control result.

FIG. 8 is a photograph showing the result of green fluorescence detection of vaccine strain.

FIG. 9 is a graph showing the change of the fluorescence detection of a vaccine strain enzyme-labeled instrument along with time, and the detection sensitivity (concentration gradient dilution of Brucella genome nucleic acid) can reach 18aM.

FIG. 10 is a photograph showing the result of fluorescent detection of red fluorescence from wild strains.

FIG. 11 is a graph showing the change of the wild strain microplate reader fluorescence detection with time, and the detection sensitivity (concentration gradient dilution of Brucella genome nucleic acid) can reach 18aM.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention. All other embodiments, based on the examples herein, which are within the scope of the invention as defined by the claims, will be within the scope of the invention as defined by the claims.

CRISPR-Cas13 protein, (Beijing family, bio Inc.) is commercially available in the examples below.

TwistAmp ^R Basic kit, available from TwitDX corporation.

Example 1 design and acquisition of crRNA and DNA for detection of Brucella

The gene sequence was downloaded from GenBank by logging in NCBI including: the bovine species vaccine strain A19 and wild strain representative strains (A13334, 2308, 9-941, 104M, BD, BAB8416, clpP, MC, BJ strain) and other strains of foreign common vaccine strains (S19, RB 51) are subjected to genome bioinformatics analysis and differential analysis comparison, and the analysis results are shown in FIGS. 2-6.

As can be seen from FIGS. 2 to 6, there are differences in gene sequences between bovine vaccine strain A19, wild strain representative strain and foreign common vaccine strain. The present invention found that the 5 detected genes were 113 gene, methylrotonoyl-CoA carboxylase gene, ABC transporter permease gene, MFS transporter gene and ribD gene, respectively.

Wherein, the specific difference part of the 113 gene region, the bovine vaccine strain A19 and the wild strain is 2 base insertion, the specific difference part is DNA-WT-1 and DNA-Vac-1, the sequences of which are respectively shown as SEQ ID NO.21 and SEQ ID NO.22, wherein, the vaccine strain DNA-Vac-1 contains a base CTTTT, and the corresponding base of the wild strain DNA-WT-1 is C-TT. Then, according to the gene sequences of DNA-WT-1 and DNA-Vac-1, the crRNA-WT-1 and crRNA-Vac-1 are designed, the sequences of which are respectively shown as SEQ ID NO.1 and SEQ ID NO.2, and the crRNA-WT-1 and crRNA-Vac-1 designed by the invention contain partial spacer fragments which can be specifically matched with the common difference C-TT region of vaccine strain CTTTT region and wild strain. Thereby activating the corresponding Cas protein nuclease activity, cleaving the reporter group in the respective detection system.

The specific difference part of the methylrotonoyl-CoA carboxylase gene region, bovine strain A19 and wild strain is 7 base deletion, the specific difference part is DNA-WT-2 and DNA-Vac-2, the sequences of which are respectively shown as SEQ ID NO.23 and SEQ ID NO.24, wherein the vaccine strain DNA-Vac-2 contains base G-A, and the corresponding base of the wild strain DNA-WT-2 is GAGATTTCA. Then, based on the gene sequences of DNA-WT-2 and DNA-Vac-2, crRNA-WT-2 and crRNA-Vac-2 are designed, the sequences of which are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, and the crRNA-WT-2 and crRNA-Vac-2 designed by the invention contain partial spacer fragments which can be specifically matched with the consensus GAGATTTCA region of vaccine strain G-A and wild strain. Thereby activating the corresponding Cas protein nuclease activity, cleaving the reporter group in the respective detection system.

The specific difference of the ABC transporter permease gene region, the bovine vaccine strain A19 and the wild strain is a 68-base deletion, the specific difference is DNA-WT-3 and DNA-Vac-3, the sequences of the sequences are shown in SEQ ID NO.25 and SEQ ID NO.26 respectively, wherein the vaccine strain DNA-WT-3 contains a base GCCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCATCCTTTATTTCC, and the corresponding base of the wild strain DNA-Vac-3 is G-C. Then, based on the gene sequences of DNA-WT-3 and DNA-Vac-3, crRNA-WT-3 and crRNA-Vac-3 are designed, the sequences of which are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively, the crRNA-WT-3 and crRNA-Vac-3 designed by the invention contain partial space fragments which can be specifically matched with the vaccine strain G, the C region and the common differential GCCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCA TCCTTTATTTCC region of the wild strain. Thereby activating the corresponding Cas protein nuclease activity, cleaving the reporter group in the respective detection system.

The specific difference part of the MFS transporter gene region, namely the bovine vaccine strain A19 and the wild strain is 2 base insertion, and the specific difference part is DNA-WT-4 and DNA-Vac-4, the sequences of which are respectively shown as SEQ ID NO.27 and SEQ ID NO.28, wherein the vaccine strain DNA-Vac-4 contains a base CCGC, and the corresponding base of the wild strain DNA-WT-4 is C- - -C. Then, according to the gene sequences of DNA-WT-4 and DNA-Vac-4, the crRNA-WT-4 and crRNA-Vac-4 are designed, the sequences of which are respectively shown as SEQ ID NO.7 and SEQ ID NO.8, and the crRNA-WT-4 and crRNA-Vac-4 designed by the invention contain partial spacer fragments which can be specifically matched with the consensus C-C region of the vaccine strain CCGC region and wild strain. Thereby activating the corresponding Cas protein nuclease activity, cleaving the reporter group in the respective detection system.

The specific difference part of the ribD gene region, the bovine vaccine strain A19 and the wild strain is 2 base insertion, and the specific difference part is DNA-WT-5 and DNA-Vac-5, the sequences of which are respectively shown as SEQ ID NO.29 and SEQ ID NO.30, wherein the vaccine strain DNA-Vac-5 contains a base TAAAAA, and the corresponding base of the wild strain DNA-WT-5 is T-CAA. Then, according to the gene sequences of DNA-WT-5 and DNA-Vac-5, the crRNA-WT-5 and crRNA-Vac-4 are designed, the sequences of which are respectively shown as SEQ ID NO.9 and SEQ ID NO.10, and the crRNA-WT-5 and crRNA-Vac-5 designed by the invention contain partial spacer fragments which can be specifically matched with the consensus T-CAA region of the vaccine strain TAAAAA region and the wild strain. Thereby activating the corresponding Cas protein nuclease activity, cleaving the reporter group in the respective detection system.

The specific procedures for obtaining crRNA-WT and crRNA-Vac are as follows: annealing reaction is respectively carried out by taking crDNA-WT and crDNA-Vac as templates to form double-stranded DNA, agarose gel electrophoresis is carried out, DNA fragments are recovered and purified by glue, RNA is transcribed and generated under the action of T7 RNA polymerase, crRNA (WT) and crRNA (Vac) are recovered and purified, and the purified crRNA-WT and crRNA-Vac are split-packed and frozen to-80 ℃.

Wherein the crDNA-WT-1 sequence is shown as SEQ ID NO. 11; crDNA-Vac-1: the sequence is shown as SEQ ID NO. 12; crDNA-WT-2: the sequence is shown as SEQ ID NO. 13; crDNA-Vac-2: the sequence of the polypeptide is shown as SEQ ID NO. 14; crDNA-WT-3: the sequence is shown as SEQ ID NO. 15; crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16; crDNA-WT-4: the sequence is shown as SEQ ID NO. 17; crDNA-Vac-4: the sequence of the polypeptide is shown as SEQ ID NO. 18; crDNA-WT-5: the sequence is shown as SEQ ID NO. 19; crDNA-Vac-5: the sequence of the polypeptide is shown as SEQ ID NO. 20.

Annealing system: the DNA oligo to be annealed (synthetic primer) was formulated to 50. Mu.M with sterilized enzyme-free water or re-distilled water.

Dissolving Annealing Buffer for DNA Oligos (5X), and mixing.

Adding various reagents in the above sequence, and mixing.

The sequence of the T7 primer is as follows:

5’-GAAATTAATACGACTCACTATAGGG-3’。

the annealing reaction was performed by setting a PCR instrument as follows:

the transcription system is as follows: template DNA 1. Mu.g, T7 RNA polymerase mixture 2. Mu.L, NTP Buffer Mix 10. Mu.L, no enzyme water make up, total volume 30. Mu.L.

The transcription conditions were: 37℃for 16h.

Example 2 kit for detection of Brucella

The kit of this example includes a twist amp ^R Basic kit, 5 crRNA-WT and crRNA-Vac (SEQ ID NO. 1-10) or 5 crDNA-WT and crDNA-Vac (SEQ ID NO. 11-20) for detecting Brucella, fluorescent probe, CRISPR-Cas13 protein, RPA amplification primer, tris-HCl (400 mM), mgCl ₂ (120 mM), ssRNA fluorescent probe (2. Mu.M), RNase Inhibitor, T7 Polymerase 0.5. Mu. L, rNTP 0.8, 0.8. Mu.L.

Wherein the VAC fluorescent probe sequence is 5 '-FAM-UUUU-3' BHQ1; the WT fluorescent probe sequence is 5'-ROX-UUUUU-3' BHQ2.

Example 3 method of performing fluorescence detection of Brucella Using the kit described in example 2

Taking 20 mu L of bovine blood samples with A19 vaccine strain and wild strain-free genome, taking 20 mu L of bovine blood samples with A19 vaccine strain and wild strain-free genome as samples to be detected, and then taking 20 mu L of enzyme-free water as a control group to carry out fluorescent detection of Brucella.

The specific method comprises the following steps:

(1) Pretreating a sample to be detected at 80 ℃ for 10 minutes, then adding 20 mu L of NP-40 lysate, vibrating for 15s until the sample is uniformly mixed, and heating the sample in a thermostat at 95-99 ℃ for 10 minutes to obtain a genome of the sample to be detected;

(2) Taking the extracted genome of the sample to be detected as a template, adding the template into a reaction system containing reaction liquid and RPA, and carrying out nucleic acid amplification of a target gene;

RPA amplification reaction system: one tube of RPA base reaction ball, 29.5 mu L of rehydration buffer, 2.5 mu L of magnesium acetate buffer, 2.5 mu L of forward primer, 2.5 mu L of reverse primer, the balance of enzyme-free water and 8 mu L of total volume are complemented, and then 5 equal parts are distributed, each 9 mu L of sample is added, 1 mu L of sample to be tested is added, and RPA reaction of five samples can be amplified simultaneously, and each reaction volume is 10 mu L.

The amplification conditions were: the reaction temperature was 40℃and the incubation time was 15min.

Wherein the RPA base reaction ball, the rehydration buffer and the magnesium acetate buffer are all from a TwitAmp ^R Basic kit.

The RPA amplification primers are selected from the following primer pairs (five pairs of primers optionally one):

forward primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；

reverse primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GACATATACACGGCATTTGATAGGGGACATA-3'; corresponding to the 113 gene region.

Forward primers for crRNA-WT-2 and crRNA-Vac-2:

5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；

reverse primers for crRNA-WT-2 and crRNA-Vac-2:

5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3'; corresponding to the region of the methylrotonoyl-CoA carboxidase gene.

Forward primers for crRNA-WT-3 and crRNA-Vac-3:

5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；

reverse primers for crRNA-WT-3 and crRNA-Vac-3:

5'-CAGATAAGCGATCAACACACCATTGACCGCG-3'; corresponding to the ABC transporter permease gene region.

Forward primers for crRNA-WT-4 and crRNA-Vac-4:

5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；

reverse primers for crRNA-WT-4 and crRNA-Vac-4:

5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3'; corresponding to the MFS transporter gene region.

Forward primers for crRNA-WT-5 and crRNA-Vac-5:

5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；

reverse primers for crRNA-WT-5 and crRNA-Vac-5:

5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3'; corresponding to the ribD gene region.

RPA amplification conditions: the reaction temperature is 40 ℃ and the incubation time is 10min;

wherein the RPA basic reaction ball, the PBS buffer solution and the magnesium acetate buffer solution are all from TwitAmp ^R Basic kit; RPA amplification is prior art.

(3) Taking RPA amplification products, respectively establishing a WT detection system and a VAC detection system, and incubating for 20min at 37 ℃;

the WT detection system is the same as the VAC detection system, and specifically comprises the following steps: tris-HCl (400 mM), mgCl ₂ (120 mM), ssRNA fluorescent probe (5. Mu.M), crRNA-Vac (corresponding to the gene region used for RPA amplification) 1. Mu.L, RNase Inhibitor 1. Mu. L, cas13a protein 2. Mu. L, T7.7 Polymerase 0.5. Mu. L, rNTP 0.8.8. Mu.L, RPA amplification product 1. Mu.L, and total volume 20. Mu.L.

(4) And respectively placing 20 mu L of WT detection system and 20 mu L of VAC detection system under a portable LED illumination lamp with excitation wavelength of 360-450 nanometers, and obtaining detection results according to fluorescent color development.

According to the principle of FIG. 1, when the fluorescent color of the detection solution is red, the sample to be detected is a wild strain; when the fluorescent color of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when no fluorescent display is formed, it is indicated that the test sample is free of Brucella infection.

Thus, the detection result of this embodiment is shown in fig. 7. As can be seen from fig. 7, the detection result of the enzyme-free water showed no fluorescence (negative group), which is a control group; the fluorescent color of the detection liquid of the bovine blood sample without the A19 vaccine strain and with the wild strain genome is red, and the bovine blood sample is a wild strain; the fluorescent color of the detection liquid of the bovine blood sample with the A19 vaccine strain and the wild strain-free genome is green, and the bovine blood sample is the vaccine strain; the detection liquid of the bovine blood sample with A19 vaccine strain and wild strain genome is red and green in fluorescent color, and is mixed infection of the wild strain and the vaccine strain.

Example 4 sensitivity test of fluorescent kit

The kit in the example 3 is adopted for fluorescence detection of the Brucella by a fluorescence detection method of an enzyme-labeled instrument.

The MFS transporter gene is used as a Brucella detection gene to detect the sensitivity of a sample genome.

The specific method comprises the following steps: taking vaccine strains and wild strains as samples to be tested, extracting genomes of the samples to be tested according to the method described in the embodiment 3, and carrying out concentration gradient dilution on the extracted genomes, wherein the dilution gradient is as follows: 180fM, 18fM, 1.8fM, 180aM, 18aM, 1.8aM, 180ZM. The kit described in example 3 was used to establish a vaccine strain (Vac) and a wild strain (WT) detection system by performing a brucella fluorescence detection method, 20 μl of the WT detection system and 20 μl of the Vac detection system were added to 384-well all-black elisa plates (three replicates per concentration gradient), fluorescence detection was performed using an elisa instrument (brand Thermo, model LUX), and the wild strain used excitation wavelength (excitation wavelength): 575nm, emission wavelength (emission wavelength): 602nm; vaccine strain used excitation wavelength (excitation wavelength): 495nm, emission wavelength (emission wavelength): 521nm. The results are shown in FIGS. 8 to 11.

As can be seen from fig. 8 and 9, the fluorescence color of the vaccine strain detection solution is green, and the detection sensitivity can reach 18aM; as can be seen from FIGS. 10 to 11, the fluorescent color of the wild strain detection solution was red, and the detection sensitivity was 18aM. The detection method provided by the invention has the advantages of strong relative bit variability, low detection limit, high sensitivity, low price, simple and quick operation and convenient carrying of equipment and instruments, and the detection sensitivity can reach 18aM.

SEQUENCE LISTING

<110> university of inner Mongolia

<120> a fluorescent kit for detecting Brucella and a detection method

<160> 30

<170> PatentIn version 3.5

<210> 1

<211> 64

<212> RNA

<213> artificial sequence

<400> 1

gauuuagacu accccaaaaa cgaaggggac uaaaacuugu cuuuugccug cgacaaaagg 60

ggcu 64

<210> 2

<211> 64

<212> RNA

<213> artificial sequence

<400> 2

gauuuagacu accccaaaaa cgaaggggac uaaaaccuuu ugccugcgac aaaaaagggg 60

cuug 64

<210> 3

<211> 64

<212> RNA

<213> artificial sequence

<400> 3

gauuuagacu accccaaaaa cgaaggggac uaaaacuucu gaaaucugaa aucucgacgc 60

gcag 64

<210> 4

<211> 64

<212> RNA

<213> artificial sequence

<400> 4

gauuuagacu accccaaaaa cgaaggggac uaaaacaugc cgguucugaa aucucgacgc 60

gcag 64

<210> 5

<211> 64

<212> RNA

<213> artificial sequence

<400> 5

gauuuagacu accccaaaaa cgaaggggac uaaaacauga ugccgaauuc cugcaagguc 60

acgc 64

<210> 6

<211> 64

<212> RNA

<213> artificial sequence

<400> 6

gauuuagacu accccaaaaa cgaaggggac uaaaacauga gcaccacggc ccagaccggc 60

cagc 64

<210> 7

<211> 64

<212> RNA

<213> artificial sequence

<400> 7

gauuuagacu accccaaaaa cgaaggggac uaaaacuggu ggccgggcuu uauacggugg 60

gccu 64

<210> 8

<211> 64

<212> RNA

<213> artificial sequence

<400> 8

gauuuagacu accccaaaaa cgaaggggac uaaaacggcc gggcuuuaua cgcggugggc 60

cuug 64

<210> 9

<211> 64

<212> RNA

<213> artificial sequence

<400> 9

gauuuagacu accccaaaaa cgaaggggac uaaaaccaga ucauucaaug ucgcuuuuga 60

acgc 64

<210> 10

<211> 64

<212> RNA

<213> artificial sequence

<400> 10

gauuuagacu accccaaaaa cgaaggggac uaaaacucaa ugucgcuuuu uuuaacgcgg 60

aaau 64

<210> 11

<211> 89

<212> DNA

<213> artificial sequence

<400> 11

agcccctttt gtcgcaggca aaagacaagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 12

<211> 89

<212> DNA

<213> artificial sequence

<400> 12

caagcccctt ttttgtcgca ggcaaaaggt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 13

<211> 89

<212> DNA

<213> artificial sequence

<400> 13

ctgcgcgtcg agatttcaga tttcagaagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 14

<211> 89

<212> DNA

<213> artificial sequence

<400> 14

ctgcgcgtcg agatttcaga accggcatgt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 15

<211> 89

<212> DNA

<213> artificial sequence

<400> 15

gcgtgacctt gcaggaattc ggcatcatgt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 16

<211> 89

<212> DNA

<213> artificial sequence

<400> 16

gctggccggt ctgggccgtg gtgctcatgt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 17

<211> 89

<212> DNA

<213> artificial sequence

<400> 17

aggcccaccg tataaagccc ggccaccagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 18

<211> 89

<212> DNA

<213> artificial sequence

<400> 18

caaggcccac cgcgtataaa gcccggccgt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 19

<211> 89

<212> DNA

<213> artificial sequence

<400> 19

gcgttcaaaa gcgacattga atgatctggt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 20

<211> 89

<212> DNA

<213> artificial sequence

<400> 20

atttccgcgt taaaaaaagc gacattgagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 21

<211> 160

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 21

ttgccgcatc ttcttgcgta cggcttcatt ttattcccgg tccatttaca cctaacggct 60

gtatagagga atgcaagccc cttttgtcgc aggcaaaaga caaagtctct cattccgtca 120

caaactagtt atgtccccta tcaaatgccg tgtatatgtc 160

<210> 22

<211> 162

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 22

ttgccgcatc ttcttgcgta cggcttcatt ttattcccgg tccatttaca cctaacggct 60

gtatagagga atgcaagccc cttttttgtc gcaggcaaaa gacaaagtct ctcattccgt 120

cacaaactag ttatgtcccc tatcaaatgc cgtgtatatg tc 162

<210> 23

<211> 139

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 23

cgtcgattgc cgccagcatg gccttgcggt tggcctcgaa gcttgcgctg cgcgtcgaga 60

tttcagattt cagaaccggc atcaacgggt ctcctgaaag agttcccgtc cgatcagcat 120

acgccggatt tccgacgtg 139

<210> 24

<211> 132

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 24

cgtcgattgc cgccagcatg gccttgcggt tggcctcgaa gcttgcgctg cgcgtcgaga 60

tttcagaacc ggcatcaacg ggtctcctga aagagttccc gtccgatcag catacgccgg 120

atttccgacg tg 132

<210> 25

<211> 205

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 25

gctcgtcatc ctcaatggcg gcatcgacct ttcggtcggc tccacgctgg ggctggccgg 60

tgtggtcgcg ggcttcctga tgcagggcgt gaccttgcag gaattcggca tcatccttta 120

tttcccggtc tgggccgtgg tgctcatcac ctgcgcgctc ggcgccttcg tcggcgcggt 180

caatggtgtg ttgatcgctt atctg 205

<210> 26

<211> 137

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 26

gctcgtcatc ctcaatggcg gcatcgacct ttcggtcggc tccacgctgg ggctggccgg 60

tctgggccgt ggtgctcatc acctgcgcgc tcggcgcctt cgtcggcgcg gtcaatggtg 120

tgttgatcgc ttatctg 137

<210> 27

<211> 167

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 27

aatgaaggct gcattggcgg aggcaagttc gcgtcccgtc agctcagacc ccagatgcgc 60

aaggcccacc gtataaagcc cggccaccac gccgccccac aggaacagaa tgcctgccat 120

gaaataccag tgctgcatga ggtagggcag cgccatcatg ccgatga 167

<210> 28

<211> 169

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 28

aatgaaggct gcattggcgg aggcaagttc gcgtcccgtc agctcagacc ccagatgcgc 60

aaggcccacc gcgtataaag cccggccacc acgccgcccc acaggaacag aatgcctgcc 120

atgaaatacc agtgctgcat gaggtagggc agcgccatca tgccgatga 169

<210> 29

<211> 134

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 29

atgagctgac ggtttccgag accggcgata atctggaaac gtagaatggg cgccagcgaa 60

tttccgcgtt caaaagcgac attgaatgat ctgcgcttca tggaagcgac gatccgttat 120

gcgcgccgtc acaa 134

<210> 30

<211> 136

<212> DNA

<213> Brucella (Brucella melitensis)

<400> 30

atgagctgac ggtttccgag accggcgata atctggaaac gtagaatggg cgccagcgaa 60

tttccgcgtt aaaaaaagcg acattgaatg atctgcgctt catggaagcg acgatccgtt 120

atgcgcgccg tcacaa 136

Claims

1. A set of crRNA combinations for detecting brucella, wherein the crRNA combinations have the sequences shown below:

crRNA-WT-1: the sequence is shown as SEQ ID NO. 1;

crRNA-Vac-1: the sequence is shown as SEQ ID NO. 2;

crRNA-WT-2: the sequence is shown as SEQ ID NO. 3;

crRNA-Vac-2: the sequence is shown as SEQ ID NO. 4;

crRNA-WT-3: the sequence is shown as SEQ ID NO. 5;

crRNA-Vac-3: the sequence is shown as SEQ ID NO. 6;

crRNA-WT-4: the sequence is shown as SEQ ID NO. 7;

crRNA-Vac-4: the sequence is shown as SEQ ID NO. 8;

crRNA-WT-5: the sequence is shown as SEQ ID NO. 9;

crRNA-Vac-5: the sequence is shown as SEQ ID NO. 10.

2. A set of crDNA combinations for detecting brucella, wherein the crDNA combinations have the sequences shown below:

crDNA-WT-1: the sequence is shown as SEQ ID NO. 11;

crDNA-Vac-1: the sequence is shown as SEQ ID NO. 12;

crDNA-WT-2: the sequence is shown as SEQ ID NO. 13;

crDNA-Vac-2: the sequence of the polypeptide is shown as SEQ ID NO. 14;

crDNA-WT-3: the sequence is shown as SEQ ID NO. 15;

crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16;

crDNA-WT-4: the sequence is shown as SEQ ID NO. 17;

crDNA-Vac-4: the sequence of the polypeptide is shown as SEQ ID NO. 18;

crDNA-WT-5: the sequence is shown as SEQ ID NO. 19;

crDNA-Vac-5: the sequence of the polypeptide is shown as SEQ ID NO. 20.

3. A set of DNA combinations for detecting brucella, wherein the sequences of the DNA combinations are as follows:

DNA-WT-1: the sequence is shown as SEQ ID NO. 21;

DNA-Vac-1: the sequence of the polypeptide is shown as SEQ ID NO. 22;

DNA-WT-2: the sequence of the polypeptide is shown as SEQ ID NO. 23;

DNA-Vac-2: the sequence is shown as SEQ ID NO. 24;

DNA-WT-3: the sequence is shown as SEQ ID NO. 25;

DNA-Vac-3: the sequence is shown as SEQ ID NO. 26;

DNA-WT-4: the sequence of the polypeptide is shown as SEQ ID NO. 27;

DNA-Vac-4: the sequence of the polypeptide is shown as SEQ ID NO. 28;

DNA-WT-5: the sequence of the polypeptide is shown as SEQ ID NO. 29;

DNA-Vac-5: the sequence of which is shown as SEQ ID NO. 30.

4. A fluorescent kit for detecting brucella comprising the crRNA combination of claim 1 or the crDNA combination of claim 2.

5. The fluorescent kit for detecting brucella of claim 4, wherein the kit comprises a Cas protein and a fluorescent probe; the Cas protein is a CRISPR-Cas13 protein.

6. The fluorescent kit for detecting brucella according to claim 5, wherein the fluorescent probe sequence is labeled with a fluorescent group at the 5 'end and a quenching group at the 3' end;

the fluorescent group is FAM or ROX; the quenching group is BHQ1 or BHQ2.

7. The fluorescent kit for detecting brucella of claim 6, wherein the fluorescent probe is a ssRNA fluorescent probe and the VAC fluorescent probe sequence is 5'-FAM-UUUUU-3' bhq1; the WT fluorescent probe sequence is 5'-ROX-UUUUU-3' BHQ2.

8. A method for detecting a non-disease diagnosis of brucella using the kit of claim 4, comprising the steps of:

(1) Extracting genome of a sample to be detected;

(4) Respectively placing the WT detection system and the VAC detection system under an LED illumination lamp, and when the fluorescent color of the detection liquid is red, indicating that the sample to be detected is Brucella which is not an A19 vaccine strain; when the fluorescent color of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when no fluorescent display is formed, it is indicated that the test sample is free of Brucella infection.

9. The method of claim 8, wherein in step (2), the primers for RPA amplification are each:

forward primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；

reverse primers for crRNA-WT-1 and crRNA-Vac-1:

5'-GACATATACACGGCATTTGATAGGGGACATA-3'；

forward primers for crRNA-WT-2 and crRNA-Vac-2:

5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；

reverse primers for crRNA-WT-2 and crRNA-Vac-2:

5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3'；

forward primers for crRNA-WT-3 and crRNA-Vac-3:

5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；

reverse primers for crRNA-WT-3 and crRNA-Vac-3:

5'-CAGATAAGCGATCAACACACCATTGACCGCG-3'；

forward primers for crRNA-WT-4 and crRNA-Vac-4:

5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；

reverse primers for crRNA-WT-4 and crRNA-Vac-4:

5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3'；

forward primers for crRNA-WT-5 and crRNA-Vac-5:

5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；

reverse primers for crRNA-WT-5 and crRNA-Vac-5:

5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3'；

the RPA amplification system is as follows: one tube of RPA basic reaction ball, 29.5 mu L of rehydration buffer, 2.5 mu L of magnesium acetate buffer, 2.5 mu L of forward primer, 2.5 mu L of reverse primer, and the balance of 8 mu L of enzyme-free water, and then 5 equal parts of the mixture are distributed, wherein each 9 mu L of mixture is added with 1 mu L of sample to be tested, and the total volume is 10 mu L;

the amplification conditions were: the reaction temperature is 39-42 ℃, and the incubation time is 5-20 min;

wherein the RPA base reaction sphere, the rehydration buffer and the magnesium acetate buffer are all derived from TwitAmp ^R Basic kit, RPA Basic reaction ball is spherical solid, contains recombinase, polymerase ingredient.

10. The detection method according to claim 8, wherein in step (3), the WT detection system and the VAC detection system are the same, specifically: tris-HCl 400mM, mgCl ₂ 120mM, ssRNA fluorescent probe 5. Mu. M, crRNA 1. Mu.L, RNase Inhibitor 1. Mu. L, cas13a protein 2. Mu. L, T7 Polymerase 0.5. Mu. L, rNTP 0.8.8. Mu.L, RPA amplification product 1. Mu.L, total volume 20. Mu.L; in the step (4), the LED illuminating lamp is a portable LED illuminating lamp, and the excitation wavelength is 360-450 nanometers.