CN115029459A - Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application - Google Patents
Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application Download PDFInfo
- Publication number
- CN115029459A CN115029459A CN202210778136.XA CN202210778136A CN115029459A CN 115029459 A CN115029459 A CN 115029459A CN 202210778136 A CN202210778136 A CN 202210778136A CN 115029459 A CN115029459 A CN 115029459A
- Authority
- CN
- China
- Prior art keywords
- seq
- pcr
- rpa
- pasteurella multocida
- cas12a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a kit and a method for visually detecting Pasteurella multocida based on CRISPR-Cas12a, wherein the kit is used for amplifying a sample to be detected, guiding a CRISPR-Cas12a system to recognize and bind an RPA amplification product and cut a target double-stranded DNA to activate a non-specific nuclease function under the mediation of a crRNA guide sequence, and then randomly cutting a ssDNA fluorescent probe in the system to obtain a cut product and performing chromogenic detection and judgment. The kit provided by the invention has the detection sensitivity of 2 copies/mu L for pasteurella multocida nucleic acid, can be used for amplifying RPA (RPA-related amplified RNA) and is carried out in an environment of 37 ℃ in the whole process, and can be directly observed by naked eyes, so that the purposes of separating from the dependence of large instruments in laboratories and rapidly and visually detecting target nucleic acid on site are achieved.
Description
Technical Field
The invention relates to the technical field of bacterial molecular diagnosis, in particular to a kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application thereof.
Background
Pasteurella multocida (Pm) is a major zoonotic pathogen that causes infection and serious morbidity in a variety of animals and humans. Once the organism is infected with Pm, acute, hemorrhagic or septicemic symptoms often appear, such as swine plague, hemorrhagic septicemia of cattle, sheep and rabbits, fowl cholera and other serious infectious diseases. Traditionally, Pm can be classified into A, B, D, E and F, 5 serotypes by its capsular antigen typing method (10.1007/82_2012_ 216). The host tropism and pathogenic characteristics of each serotype are different. Humans have been shown to infect Pm by scratching and biting by cats and dogs (10.1056/NEJM 199901143400202). In addition, Pm can also cause other diseases and infections in humans, such as: urinary tract infections, meningitis, septicemia, and even death. The occurrence and prevalence of the disease directly jeopardize the health development of the breeding industry and the safety of public health. At present, the Pm is clinically detected mainly by carrying out separation culture, biochemical identification, smear staining microscopy and the like on pathogenic bacteria, and the methods have long detection period, complicated steps, time and labor consumption, strong subjectivity, easy occurrence of factors such as omission, false detection and the like, and are not suitable for the requirement of clinical rapid detection. In recent years, PCR and fluorescence quantitative PCR are sequentially and widely applied to diagnosis of Pasteurella multocida, but the PCR and the fluorescence quantitative PCR have certain technical requirements on operators, require complex instruments and higher detection environment, are long in time consumption, and are difficult to meet the requirement of on-site rapid detection under the conditions of poor basic conditions and lack of technicians.
The CRISPR-Cas technology is a gene editing technology which is popular in recent years, and the technology brings great changes to the fields of bioengineering, medicine, nucleic acid detection and the like. Recent research advances have shown that CRISPR-associated (Cas) endonucleases, such as Cas12a, Cas13a and Cas14a, all have useful nucleic acid detection features, such as Human Papilloma Virus (HPV), ZIKV, dengue virus (DENV) (10.1126/science. While the CRISPR-Cas12a technology is often used as an ideal means for recognizing cleaved DNA fragments, when Cas12a recognizes target DNA, Cas12a/crRNA/DNA forms a ternary complex to be activated, Cas12a can specifically cleave target sequence and at the same time can nonspecifically cleave arbitrary single-stranded DNA (ssdna) in the system (10.1126/science. aar6245). At present, the method mainly depends on detecting fluorescent signals to judge the existence of target genes in a detected sample, and related instruments and equipment still need to be used during detection. Therefore, there is an urgent need to develop a rapid, high-sensitivity, high-specificity, naked-eye visualization method suitable for rapid detection of pasteurella multocida in situ.
The recombinase polymerase isothermal amplification technology (RPA) is a novel in vitro nucleic acid isothermal amplification technology developed by TwistDx Inc., UK in 2006, can detect DNA and RNA, and the whole reaction mainly depends on three enzymes: compared with other isothermal amplification technologies (doi.org/10.1371/journal.pone.0103091), the technology is simpler, quick in reaction and low in requirements on reaction equipment.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a kit for visually detecting Pasteurella multocida based on CRISPR-Cas12 a.
It is a first object of the present invention to provide a composition.
The second purpose of the invention is to provide the application of the composition in preparing a kit for detecting pasteurella multocida.
The third purpose of the invention is to provide a kit for detecting Pasteurella multocida based on CRISPR-Cas12a visualization.
In order to achieve the purpose, the invention is realized by the following scheme:
a composition comprising a crRNA guide sequence and ssDNA fluorescent probes; the nucleotide sequence of the crRNA guide sequence is shown as SEQ ID NO: 1. SEQ ID NO: 2 or SEQ ID NO: 3, respectively.
Specifically, the nucleotide sequence information of the crRNA guide sequence is as follows:
crRNA-KMT1(SEQ ID NO：1)：
5’-AAUUUCUACUAAGUGUAGAUCCCAGUGGGGCGGUGCGAAU-3’；
crRNA-KMT2(SEQ ID NO：2)：
5’-AAUUUCUACUAAGUGUAGAUCAUGUUGAGUUACGUUUCUU-3’；
crRNA-KMT3(SEQ ID NO：3)：
5’-AAUUUCUACUAAGUGUAGAUUGGCUCGUUGUGAGUGGGCU-3’；
the underlined sequences in the crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 sequence information are stem-loop sequences homologous to LbCas12a (see 10.3784/jbjc.202108090442).
Preferably, the nucleotide sequence of the crRNA guide sequence is as shown in SEQ ID NO: 2, respectively.
Preferably, the composition further comprises an amplification primer pair.
More preferably, the amplification primer pair is an RPA primer pair or a PCR primer pair.
Further preferably, the nucleotide sequence of the upstream primer Pm-RPA2-F of the RPA primer pair is shown in SEQ ID NO: 4, the nucleotide sequence of the downstream primer Pm-RPA2-R is shown as SEQ ID NO: 5, respectively.
Further preferably, the nucleotide sequence of the upstream primer PCR-Kmt1-PM-F of the PCR primer pair is shown in SEQ ID NO: 6, the nucleotide sequence of the downstream primer PCR-Kmt1-PM-R is shown as SEQ ID NO: shown at 7.
Specifically, the nucleotide sequence information of the RPA primer pair and the PCR primer pair is as follows:
RPA upstream primer Pm-RPA2-F (SEQ ID NO: 4):
5’-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3’；
RPA downstream primer Pm-RPA2-R (SEQ ID NO: 5):
5’-ACTCGCTACTTTTTGTTTCATTTGGACT-3’；
PCR upstream primer PCR-Kmt1-PM-F (SEQ ID NO: 6):
5’-ATCCGCTATTTACCCAGTGG-3’；
PCR downstream primer PCR-Kmt1-PM-R (SEQ ID NO: 7):
5’-GCTGTAAACGAACTCGCCAC-3’；
preferably, the composition further comprises a Cas12a enzyme.
Preferably, the nucleotide sequence of the ssDNA fluorescent probe is as shown in SEQ ID NO: shown in fig. 8.
Specifically, the nucleotide sequence information of the ssDNA fluorescent probe is as follows:
ssDNA fluorescent probe (SEQ ID NO: 8): 5 '- (ROX) -GTATCCAGTGCA- (BHQ2) -3'.
More preferably, the ssDNA fluorescent probe is labeled with a fluorescent group at the 5 'end and a quenching group at the 3' end.
Further preferably, the fluorophore is ROX and the quencher is BHQ 2.
The invention also claims the application of the composition in preparing a kit for detecting pasteurella multocida.
A kit for detecting pasteurella multocida, said kit comprising the above composition.
Preferably, the kit further comprises an amplification reaction reagent and a CRISPR-Cas12a cleavage detection reagent.
More preferably, the amplification reaction system is an RPA amplification reaction system or a PCR amplification reaction system.
The invention designs specific amplification primers and crRNA guide sequences aiming at Kmt1 sequence conserved regions in the Pasteurella multocida genome; the method comprises the steps of firstly amplifying a sample to be detected, then guiding a CRISPR-Cas12a system to recognize and combine an amplification product and cut a target double-stranded DNA to activate a non-specific nuclease function under the mediation of a crRNA guide sequence, then randomly cutting a ssDNA fluorescent probe in the system to obtain a cut product, and finally judging through the color development detection of the cut product.
A method for non-diagnostic visual detection of pasteurella multocida comprising the steps of:
s1, extracting genome DNA in a sample to be detected;
s2, taking the genome DNA in the step S1 as a template, and carrying out isothermal amplification reaction by using the RPA primer (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)) to obtain an RPA amplification product;
s3, preparing a Cas12a-crRNA compound by using the crRNA-KMT2(SEQ ID NO: 2), adding a ssDNA probe (SEQ ID NO: 8) and the RPA amplification product obtained in the step S2, and performing a cleavage reaction in a CRISPR-Cas12a system to obtain a cleavage product;
s4, performing color development or naked eye observation on the cut product obtained in the step S3 under blue light, ultraviolet light and/or a gel imager, wherein if the cut product is observed to be blue under visible light, blue light and ultraviolet light or has no fluorescence brightness under the gel imager, the sample to be detected is not infected with Pasteurella multocida; if the cutting product is pink under visible light, bright orange under blue light, bright pink under ultraviolet light or has fluorescence brightness under a gel imager, the condition that the sample to be detected is infected with the Pasteurella multocida is indicated.
Preferably, the system of the isothermal amplification reaction in step S2 is: mu.L of 10. mu.M Pm-RPA2-F (SEQ ID NO: 4), 1. mu.L of 10. mu.M Pm-RPA2-R (SEQ ID NO: 5), 29.5. mu.L of RPA reaction Buffer (regeneration Buffer), 2.5. mu.L of 280mM MgOAc, sterile water added to 48. mu.L, and 2. mu.L of sample DNA, mixed well and reacted at 37 ℃ for 15 min.
Preferably, the system of the cleavage reaction in step S3 is: mu.L of sterile water, 2. mu.L of NEbuffer2.1, 1. mu.L of Cas12a protein, 1. mu.M of crRNA-KMT2(SEQ ID NO: 2). mu.L, 3. mu.L of RPA amplification product, and 4. mu.L of 20. mu.M of ssDNA fluorescent probe (SEQ ID NO: 8).
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a kit for visually detecting pasteurella multocida based on CRISPR-Cas12a, which comprises the steps of firstly amplifying a sample to be detected, then guiding a CRISPR-Cas12a system to recognize and combine an amplification product and cut a target double-stranded DNA to activate a non-specific nuclease function under the mediation of a crRNA guide sequence, then obtaining a cut product by a ssDNA fluorescent probe in an arbitrary cut system, and finally judging through the color development detection of the cut product. The kit provided by the invention has the detection sensitivity of 2 copies/mu L for pasteurella multocida nucleic acid, can be amplified by RPA (recombinant ribonucleic acid), is carried out in an environment of 37 ℃ in the whole process, can be directly observed by naked eyes, and achieves the purposes of separating from the dependence of large-scale instruments in laboratories and rapidly and visually detecting target nucleic acid on site.
Drawings
FIG. 1 is a flow chart of an experiment according to the present invention;
FIG. 2 is a fluorescent color development of different crRNA guide sequences for detecting Pasteurella multocida;
FIG. 3 is a graph of fluorescence signal intensity for different crRNA guide sequences to detect Pasteurella multocida;
FIG. 4 is a fluorescent color development of different concentrations of ssDNA fluorescent probe for detecting Pasteurella multocida;
FIG. 5 is an agarose gel electrophoresis identification of PCR amplification products of different concentrations of PUC 19-PM;
FIG. 6 is a fluorescent color development diagram of different concentrations of PUC19-PM plasmid PCR combined with CRISPR-Cas12a for detecting Pasteurella multocida;
FIG. 7 is a graph showing the fluorescence signal intensity of different concentrations of PUC19-PM for detecting Pasteurella multocida;
FIG. 8 is a diagram showing the agarose gel electrophoresis identification of PCR amplification products of different plasmids;
FIG. 9 is a fluorescent color chart of different plasmids for detecting Pasteurella multocida;
FIG. 10 is a graph showing the agarose gel electrophoresis identification of the RPA amplification products of PUC19-PM plasmid at different concentrations;
FIG. 11 is a fluorescent color development graph of different concentrations of PUC19-PM plasmid RPA combined with CRISPR-Cas12a for detecting Pasteurella multocida;
FIG. 12 is a specific fluorescence chromogenic diagram for the one-step method RPA combined CRISPR-Cas12 visual detection of Pasteurella multocida;
FIG. 13 is a fluorescent color chart of different experimental components for detecting Pasteurella multocida;
FIG. 14 is an electrophoretic identification chart of 16 porcine lung tissue samples;
FIG. 15 is a fluorescent color rendering of 16 porcine lung samples;
FIG. 16 is a graph of fluorescence signal intensity for 16 porcine lung samples.
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
The experimental flow chart of the invention is shown in figure 1.
Example 1 screening of guide sequences of crRNA with conserved and high Activity
1. Experimental methods
(1) Design of crRNA sequence screening and design of amplification primer pairs
295 genome sequences of Pasteurella multocida are downloaded from NCBI (national center for biological information in America), conserved and interspecies-specific gene fragments in Pasteurella multocida species are searched by analysis, after NCBI comparison evaluation, a gene fragment with similarity of more than 99% of Pasteurella multocida is selected as target DNA, namely Kmt1 gene is taken as target DNA, and a specific PCR primer pair, a specific RPA primer pair and a crRNA guide sequence which are commonly used by Pasteurella multocida are designed on a conserved region. Design primer pairs and crRNA were synthesized by Biotechnology engineering (Shanghai) Inc.
Three crRNA guide sequences are designed and named as: crRNA-KMT1(SEQ ID NO: 1), crRNA-KMT2(SEQ ID NO: 2), and crRNA-KMT3(SEQ ID NO: 3).
crRNA-KMT1(SEQ ID NO：1)：
5’-AAUUUCUACUAAGUGUAGAUCCCAGUGGGGCGGUGCGAAU-3’；
crRNA-KMT2(SEQ ID NO：2)：
5’-AAUUUCUACUAAGUGUAGAUCAUGUUGAGUUACGUUUCUU-3’；
crRNA-KMT3(SEQ ID NO：3)：
5’-AAUUUCUACUAAGUGUAGAUUGGCUCGUUGUGAGUGGGCU-3', the underlined sequences in the crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 sequence information are stem-loop sequences homologous to LbCas12a (see 10.3784/jbjc.202108090442).
PCR primer pair:
PCR upstream primer PCR-Kmt1-PM-F (SEQ ID NO: 6):
5’-ATCCGCTATTTACCCAGTGG-3’；
PCR downstream primer PCR-Kmt1-PM-R (SEQ ID NO: 7):
5’-GCTGTAAACGAACTCGCCAC-3’。
RPA primer pair:
RPA upstream primer Pm-RPA2-F (SEQ ID NO: 4):
5’-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3’；
RPA downstream primer Pm-RPA2-R (SEQ ID NO: 5):
5’-ACTCGCTACTTTTTGTTTCATTTGGACT-3’。
(2) PCR amplification
The Kmt1 gene (AE004439.1) was inserted into a pUC19 vector at the Xbal single-enzyme cleavage site to construct an expression plasmid, which was designated as pUC 19-PM. Measuring plasmid concentration with spectrophotometer, adjusting pUC19-PM concentration to 100 ng/. mu.L, and calculating copy number of expression plasmid to 2.03 × 10 by copy number calculation formula 10 copies/. mu.L for use.
The pUC19-PM thus prepared was diluted to 2.03X 10 in a double ratio 8 And (3) taking the copier/mu L as a template, and taking the PCR-Kmt1-PM-F and the PCR-Kmt1-PM-R which are designed in the step (1) as PCR primers for amplification to obtain an amplification product. At the same time, pUC19-PM (2.03X 10) 8 copier/. mu.L) was replaced with equal amount of sterile ddH 2 And O, setting as a negative control to obtain a negative control amplification product.
The PCR reaction program is: pre-denaturation at 94 ℃ for 10min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, PCR amplification for 30 cycles, re-extension at 72 ℃ for 10min, and then holding at 16 ℃.
mu.L of each amplification product and 3. mu.L of each negative control amplification product were electrophoretically identified on a 1.5% agarose gel.
(3) Are respectively provided withmu.L of the amplification product from step (2) and 3. mu.L of the negative control amplification product were added to two centrifuge tubes, and to each centrifuge tube were added 4. mu.L of crRNA-KMT1(SEQ ID NO: 1) (1. mu.M) 1. mu. L, Cas12a (1. mu.M) 1. mu. L, ssDNA fluorescent probe (20. mu.M), 2. mu.L of NEbuffer2.1 and 9. mu.L of sterile ddH 2 And O. The reaction was carried out at 37 ℃ for 15min and immediately after completion of the reaction, the reaction was terminated by placing on ice for 5 min.
An equivalent experiment was performed by replacing crRNA-KMT1 with crRNA-KMT2(SEQ ID NO: 2) and crRNA-KMT3(SEQ ID NO: 3), respectively.
Specifically, the nucleotide sequence information of the crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 is shown in table 1, and the underlined sequences in the sequence information of the crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 are stem-loop sequences homologous to LbCas12a (refer to 10.3784/jbjc.202108090442).
TABLE 1 specific nucleotide sequence information
| Sequence name | Nucleotide sequence (5 '-3') |
| crRNA-KMT1(SEQ ID NO：1) | AAUUUCUACUAAGUGUAGAUCCCAGUGGGGCGGUGCGAAU |
| crRNA-KMT2(SEQ ID NO：2) | AAUUUCUACUAAGUGUAGAUCAUGUUGAGUUACGUUUCUU |
| crRNA-KMT3(SEQ ID NO：3) | AAUUUCUACUAAGUGUAGAUUGGCUCGUUGUGAGUGGGCU |
(4) And respectively placing the centrifuge tube containing the reaction liquid in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection.
2. Results of the experiment
The fluorescence color development graph of different crRNA guide sequence detection pasteurella multocida is shown in figure 2, the fluorescence signal intensity graph is shown in figure 3, and the experimental result shows that the fluorescence color development graph is 2.03 multiplied by 10 8 A colpier/mu L PUC19-PM is used as a template, a crRNA-KMT2 is used for detecting that a centrifugal tube of pasteurella multocida has pink under visible light, bright yellow under blue light, bright pink under ultraviolet light and bright white under a gel imager, shows a fluorescent signal, and can realize naked eye observation under visible light; and the centrifuge tubes for detecting Pasteurella multocida by the crRNA-KMT1 and the crRNA-KMT3 have no obvious fluorescence coloration.
The crRNA-KMT2 guide sequence is obviously superior to the crRNA-KMT1 and the crRNA-KMT3 guide sequence, and the detection activity of the crRNA-KMT2 is highest.
Example 2 screening for optimal visualized concentration of ssDNA fluorescent probes
1. Experimental methods
(1) PCR amplification target gene fragment
PCR amplification was performed using 25. mu.L of the reaction system as a positive control, and the PCR reaction system is shown in Table 2.
TABLE 2 PCR reaction System
The specific nucleotide information of the PCR-Kmt1-PM-F and PCR-Kmt1-PM-R is shown in Table 3.
TABLE 3 nucleotide information
| Sequence name | Nucleotide sequence (5 '-3') |
| PCR-Kmt1-PM-F(SEQ ID NO：6) | ATCCGCTATTTACCCAGTGG |
| PCR-Kmt1-PM-R(SEQ ID NO：7) | GCTGTAAACGAACTCGCCAC |
Kmt1 the gene amplification reaction program is: pre-denaturation at 94 ℃ for 10min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, performing PCR amplification for 30 cycles, extending again at 72 ℃ for 10min, and keeping at 16 ℃ to obtain a positive control PCR amplification product.
The negative control and the positive control differ in that pUC19-PM (2.03X 10) 8 copies/. mu.L) template was replaced with an equal amount of sterile ddH 2 And O, obtaining a negative control amplification product.
(2) Cas12a enzyme digestion reaction
The Kmt1 gene was detected using ssDNA fluorescent probes modified at 5 '-ROX-N12-BHQ 2-3' (N represents any base selected from A, T, C, G) at concentrations of 500nM, 1. mu.M, 2.5. mu.M, 5. mu.M, 10. mu.M, 20. mu.M and 35. mu.M, respectively.
The specific nucleotide sequence of the ssDNA fluorescent probe is as follows:
ssDNA fluorescent probe (SEQ ID NO: 8): 5 '- (ROX) -GTATCCAGTGCA- (BHQ2) -3'.
Add 20 μ L CRISPR-Cas12a cut detection system to centrifuge tube: crRNA-KMT2 (1. mu.M) (SEQ ID NO: 2) 1. mu. L, Cas12a (1. mu.M) 1. mu.L, the positive control PCR amplification product obtained in step (1) 3. mu. L, ssDNA fluorescent probe (SEQ ID NO: 8) 4. mu.L, 2. mu.L of NEbuffer2.1 and 9. mu.L of sterile water. Reacting at 37 ℃ for 15min, immediately placing on ice for 5min after the reaction is finished, and stopping the reaction to obtain a positive control cutting product.
And (3) equally treating the negative control amplification product obtained in the step (1).
(3) And respectively placing the centrifuge tubes containing the cutting products corresponding to the ssDNA fluorescent probes with different concentrations in a visible light, blue light, ultraviolet light and gel imager for visual detection.
2. Results of the experiment
The detection result is shown in fig. 4, if the centrifuge tube is observed to be blue under visible light, blue light and ultraviolet light or has no fluorescence brightness under a gel imager, it indicates that the sample to be detected is not infected with pasteurella multocida; if the centrifugal tube is pink under visible light, bright orange under blue light, bright pink under ultraviolet light or has fluorescence brightness under a gel imager, the sample to be detected is infected with the Pasteurella multocida.
The experimental result shows that the naked eye detection has better color development effect and is easier to distinguish when the concentration of the ssDNA fluorescent probe is more than or equal to 10 mu M; whereas the minimum concentration at which ssDNA can be clearly developed is 500nM for fluorescence intensity under blue, UV and gel imaging. Taken together, the subsequent experiments were performed with the selection of 20. mu.M ssDNA fluorescent probes.
Example 3 sensitivity test for PCR-coupled CRISPR-Cas12a two-step amplification visual detection of Pasteurella multocida
1. Experimental methods
2.03X 10 prepared in example 1 10 The plasmid pUC19-PM was diluted to 2.03X 10 by two-fold 8 copier/μL、2.03×10 7 copier/μL、2.03×10 6 copier/μL、2.03×10 5 copier/μL、2.03×10 4 copier/μL、2.03×10 3 copier/μL、2.03×10 2 copier/μL、2.03×10 1 copier/. mu.L and 2.03X 10 0 copier/μL。
(1) PCR amplification
PCR-Kmt1-PM-F (SEQ ID NO: 6) and PCR-Kmt1-PM-R (SEQ ID NO: 7) obtained in example 2 were amplified using pUC19-PM of different concentrations as templates, respectively, to obtain pUC19-PM corresponding amplification products of different concentrations. While replacing pUC19-PM by equalAmount of sterile ddH 2 And O, setting as a negative control to obtain a negative control amplification product.
The PCR reaction program is: pre-denaturation at 94 ℃ for 10min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, PCR amplification for 30 cycles, re-extension at 72 ℃ for 10min, and then holding at 16 ℃.
mu.L of the amplification product and 3. mu.L of the negative control amplification product were separately subjected to electrophoresis on 1.5% agarose gel.
(2) mu.L of the negative control amplification product obtained in step (1) and 3. mu.L of the amplification product were added to two centrifuge tubes, and crRNA-KMT2(SEQ ID NO: 2) (1. mu.M), 1. mu. L, Cas12a (1. mu.M), 1. mu. L, ssDNA fluorescent probe (SEQ ID NO: 8) (20. mu.M), 4. mu.L of 2. mu.L of NEbuffer2.1 and 9. mu.L of sterile ddH were added to each centrifuge tube 2 And O. The reaction was carried out at 37 ℃ for 15min and immediately after completion of the reaction, the reaction was terminated by placing on ice for 5 min.
The corresponding amplification products obtained at each concentration were treated equally.
(3) And respectively placing the centrifuge tube containing the reaction liquid in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection, comparing the signals amplified by using different copy digital templates, detecting the intensity change of the fluorescence visual detection signals, quantifying the fluorescence intensity value by using ImageJ, and judging the detection sensitivity.
2. Results of the experiment
The result of agarose gel electrophoresis identification of PCR amplification products of pUC19-PM plasmids with different concentrations is shown in FIG. 5, and the result shows that the lowest sensitivity of PCR amplification combined with gel electrophoresis detection of pasteurella multocida Kmt1 gene is 2.03X 10 7 copier/. mu.L; the fluorescence color development of the PCR products with different concentrations after the cleavage with Cas12 under visible light, ultraviolet light, blue light and a gel imager is shown in FIG. 6, and the result shows that the lowest sensitivity is 2.03X 10 6 copier/. mu.L; the fluorescence signal intensity of pUC19-PM plasmids with different concentrations is shown in figure 7, and the result shows that the sensitivity of the PCR combined CRISPR-Cas12a detection method is 10-100 times that of the common PCR amplification method.
Example 4 PCR in combination with CRISPR-Cas12a two-step amplification visualization of specificity test for detecting Pasteurella multocida
1. Experimental methods
(1) Inserting 821bp of a conserved region of Haemophilus parasuis (M75065.1) into a pUC19 vector by using an Xbal single-enzyme cutting site to construct an expression plasmid, and naming the expression plasmid as pUC 19-HPS; an Xbal single-enzyme cutting site is utilized to insert the 363bp conserved region of the actinobacillus pleuropneumoniae (HM021153.1) into a pUC19 vector to construct an expression plasmid, and the expression plasmid is named as pUC 19-APP.
(2) PCR amplification
pUC19-PM (2.03X 10) prepared in example 1 8 copier/. mu.L) as template, PCR-Kmt1-PM-F (SEQ ID NO: 6) and PCR-Kmt1-PM-R (SEQ ID NO: 7) carrying out PCR amplification reaction on the primer to obtain an amplification product 1;
pUC19-HPS (2.03X 10) obtained in step (1) 8 copier/. mu.L) as template, PCR-Kmt1-HPS-F (SEQ ID NO: 9) and PCR-Kmt1-HPS-R (SEQ ID NO: 10) carrying out PCR amplification reaction on the primer to obtain an amplification product 2;
using pUC19-APP (2.03X 10) obtained in step (1) 8 copier/. mu.L) as template, PCR-Kmt1-APP-F (SEQ ID NO: 11) and PCR-Kmt1-APP-R (SEQ ID NO: 12) carrying out PCR amplification reaction on the primer to obtain an amplification product 3;
pUC19-PM (2.03X 10) 8 copier/μL)、pUC19-HPS(2.03×10 8 copier/. mu.L) and pUC19-APP (2.03X 10) 8 copier/. mu.L) in a volume ratio of 1: 1: 1 mixing the raw materials as a template to perform PCR amplification reaction to obtain an amplification product 4;
and (3) carrying out PCR amplification reaction by taking sterile water as a template to obtain an amplification product 5.
Specifically, the nucleotide sequence information of the PCR primers is shown in Table 4.
TABLE 4 PCR primer nucleotide sequences
The PCR reaction program is: pre-denaturation at 94 ℃ for 10min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, PCR amplification for 30 cycles, re-extension at 72 ℃ for 10min, and then holding at 16 ℃.
And respectively taking 3 mu L of amplification products 1-5 to carry out electrophoresis identification on agarose gel with the concentration of 1.5%.
(3) Adding the amplification products 1-5 obtained in the step (2) into different centrifuge tubes, respectively, adding 4 muL of crRNA-KMT2(SEQ ID NO: 2) (1 muM) 1 mu L, Cas12a (1 muM) 1 mu L, ssDNA fluorescent probe (SEQ ID NO: 8) (20 muM), 2 muL of NEbuffer2.1 and 9 muL of sterile ddH into each centrifuge tube 2 And O. The reaction was carried out at 37 ℃ for 15min and immediately after completion of the reaction, the reaction was terminated by placing on ice for 5 min.
(4) And respectively placing the centrifuge tube containing the reaction liquid in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection, and comparing the signal intensity change of the visual detection of fluorescence after amplification by using different copy digital templates.
2. Results of the experiment
As shown in FIG. 8, the results of agarose gel electrophoresis of the amplification products 1 to 5 were only determined by using pUC19-PM (2.03X 10) 8 copier/. mu.L) and pUC19-PM, pUC19-HPS and pUC19-APP in a volume ratio of 1: 1: 1 PCR amplification product with the mixed plasmid as a template, i.e., the amplification product 1 and the amplification product 4, and a specific target band detected as pUC19-HPS plasmid (2.03X 10) 8 copier/. mu.L) and pUC19-APP plasmid (2.03X 10) 8 copier/. mu.L) as a template, no electrophoretic band was detected in the PCR amplification product, indicating that the specificity of the selected PCR-Kmt1-PM-F and PCR-Kmt1-PM-R of the present invention is high.
The fluorescence and color results of different plasmids for detecting Pasteurella multocida are shown in FIG. 9. The fluorescence results showed that only the plasmid containing pUC19-PM (2.03X 10) 8 copier/μ L) appears pink under visible light, bright yellow under blue light, bright pink under ultraviolet light and bright white under a gel imager, and an obvious fluorescent signal can be observed, namely the pasteurella multocida positive group can observe the obvious fluorescent signal.
The results show that the CRISPR-Cas12 a-based detection of pasteurella multocida has high specificity, and the detection method is not easy to cross-react with haemophilus parasuis and actinobacillus pleuropneumoniae.
Example 5 sensitivity assay for visual detection of Pasteurella multocida with RPA-binding CRISPR-Cas12
1. Experimental methods
(1) RPA primer design: the RPA primers (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)) were synthesized by Biotechnology engineering (Shanghai) Inc. (PAGE purification).
(2) RPA amplification of fragments of interest
2.03X 10 prepared in example 1 10 The plasmid pUC19-PM was diluted to 2.03X 10 by two-fold 8 copier/μL、2.03×10 7 copier/μL、2.03×10 6 copier/μL、2.03×10 5 copier/μL、2.03×10 4 copier/μL、2.03×10 3 copier/μL、2.03×10 2 copier/μL、2.03×10 1 copier/. mu.L and 2.03X 10 0 copier/μL。
Respectively taking pUC19-PM with different concentrations as templates and Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5) as RPA primers to carry out RPA isothermal amplification reaction, and obtaining RPA amplification products with corresponding concentrations. And setting a negative control to obtain a corresponding negative control RPA amplification product.
Specifically, the nucleotide sequence information of the RPA primer is shown in table 5.
TABLE 5 specific nucleotide sequence information
| Sequence name | Nucleotide sequence (5 '-3') |
| Pm-RPA2-F(SEQ ID NO：4) | AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA |
| Pm-RPA2-R(SEQ ID NO：5) | ACTCGCTACTTTTTGTTTCATTTGGACT |
The RPA isothermal amplification reaction system is shown in Table 6.
TABLE 6 RPA isothermal amplification reaction System
| Components | Dosage (mu L) |
| pUC19-PM plasmid template | 2.0 |
| RPA-Kmt1-F(SEQ ID NO：4)(10μM) | 1.0 |
| RPA-Kmt1-R(SEQ ID NO：5)(10μM) | 1.0 |
| RPA reaction Buffer (hydration Buffer) | 29.5 |
| |
14 |
| MgOAc(280mM) | 2.5 |
| In total | 50 |
The RPA isothermal amplification reaction program is as follows: the reaction was stopped by reacting at 37 ℃ for 15min and immediately placing on ice for 5 min.
3 μ L of the RPA amplification product and the negative control RPA amplification product were separately subjected to electrophoresis on 1.5% agarose gel.
(2) The cleavage reaction step of Cas12a is identical to step (3) of example 3.
(3) And respectively placing the centrifuge tube containing the reaction liquid in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection, comparing the intensity change of fluorescence visual detection signals after different copy digital templates are used for amplification, and judging the detection sensitivity.
2. Results of the experiment
The results of agarose gel electrophoresis identification of the RPA amplification products of pUC19-PM with different concentrations are shown in FIG. 10, which shows that the lowest sensitivity of detecting Pasteurella multocida Kmt1 gene by RPA amplification combined with gel electrophoresis is 2.03X 10 0 copier/. mu.L; fluorescence development under visible light, ultraviolet light, blue light and gel imager after cleavage of different concentrations of RPA product with Cas12a is shown in FIG. 11, which indicates that the lowest sensitivity is 2.03X 10 0 copier/μL。
Compared with the result of example 3, the sensitivity is greatly improved, and the pasteurella multocida can be identified and detected more accurately.
Example 6 one-step method for visual detection of Pasteurella multocida by RPA combined with CRISPR-Cas12a and specificity test
1. Experimental method
(1) Establishment of one-step method for visually detecting Pasteurella multocida by combining RPA with CRISPR-Cas12a
mu.L of crRNA-KMT2(SEQ ID NO: 2) (1. mu.M) 1. mu. L, Cas12a (1. mu.M) 1. mu. L, ssDNA fluorescent probe (SEQ ID NO: 8) (20. mu.M) and 4. mu.L of NEbuffer2.1 were mixed to obtain a Cas12a mixture, and 8. mu.L of the Cas12a mixture was previously added to an RPA kit equipped with a centrifuge tube (Twist)
Inside the dome of Basic Kit (TwistDX lnc, UK)), 21. mu.L of the RPA reaction system (shown in Table 7) was placed at the bottom of the centrifuge tube to establish the RPA-binding CRISPR-Cas12a integrated reaction.
TABLE 7 RPA reaction System
| Components | Dosage (mu L) |
| pUC19-PM plasmid template (2.03X 10) 8 copier/μL) | 2.0 |
| RPA-Kmt1-F(10μM) | 1.0 |
| RPA-Kmt1-R(10μM) | 1.0 |
| RPA reaction Buffer (hydration Buffer) | 11.8 |
| Sterile water | 4.2 |
| MgOAc(280mM) | 1.0 |
The RPA amplification is reacted for 10min at 37 ℃, then the transient dissociation is carried out, the Cas12a mixed solution in the inner part of the round cap tube cover is centrifuged into a centrifuge tube, the mixture is mixed uniformly and reacted for 15min at 37 ℃, and the mixture is immediately placed on ice for 5min after the reaction is finished to stop the reaction.
And placing the reacted centrifugal tube in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager respectively for visual detection.
(2) Specificity test for visual detection of Pasteurella multocida by one-step method RPA combined CRISPR-Cas12
Using pUC19-PM constructed in example 1 and pUC19-HPS and pUC19-APP constructed in example 4, an experimental group was set up by the method of step (2) of example 4, which is different from step (2) of example 4 in that: the amplification primers used were Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5).
And respectively amplifying the experimental groups, respectively placing the centrifugal tubes containing the corresponding substances in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection, and detecting the strength change of signals through fluorescence visualization.
2. Results of the experiment
Specific fluorescent color development results of one-step RPA combined CRISPR-Cas12 visual detection of Pasteurella multocida are shown in FIG. 12, and the fluorescent color development results show that only pUC19-PM (2.03X 10) is contained 8 copier/. mu.L) appears pink under visible light, appears bright yellow under blue light, appears bright pink under ultraviolet light, and appears bright white under a gel imager, so that an obvious fluorescent signal can be observed, namely an obvious fluorescent signal can be observed by a Pasteurella multocida positive group.
The one-step RPA combined with CRISPR-Cas12a visual detection shows that the Pasteurella multocida has high specificity and is not easy to generate cross reaction with Haemophilus parasuis and Actinobacillus pleuropneumoniae.
Example 7 validation of CRISPR-Cas12a cleavage Activity
1. Experimental method
And placing the centrifuge tubes containing the reaction solutions of the experimental groups 1 to 6 in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager respectively for visual detection.
2. Results of the experiment
The fluorescence results of the different experimental groups are shown in fig. 13, and the results show that only the full-component experimental group (experimental group 1) appears pink under visible light, bright yellow under blue light, bright pink under ultraviolet light and bright white under a gel imager, and shows fluorescence signals, that is: the DNA of the fragment to be detected, Cas12a and crRNA-KMT2 form a ternary complex, so that any single-stranded DNA (ssDNA) in a system can be cut while the target DNA is directionally cut, and an obvious fluorescence signal can be generated.
No signal was generated in any of the experimental groups 2-6. The results indicate that Cas12a has a cleavage activity that non-specifically cleaves ssDNA triggered by specific recognition of the target DNA.
Example 8 kit for visually detecting Pasteurella multocida
1. Composition of the kit
A kit for visually detecting Pasteurella multocida comprises crRNA-KMT2(SEQ ID NO: 2), a specific RPA primer pair (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)), a ssDNA fluorescent probe (SEQ ID NO: 8), an RPA reaction Buffer (regeneration Buffer), MgOAc (280mM), NEbuffer2.1, sterile water and Cas12a enzyme (1 mu M).
The crRNA-KMT2(SEQ ID NO: 2):
5’-AAUUUCUACUAAGUGUAGAUCAUGUUGAGUUACGUUUCUU-3’；
specific RPA primer pair:
Pm-RPA2-F(SEQ ID NO：4)：5’-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3’；
Pm-RPA2-R(SEQ ID NO：5)：5’-ACTCGCTACTTTTTGTTTCATTTGGACT-3’；
ssDNA fluorescent probe (SEQ ID NO: 8): 5 '- (ROX) -GTATCCAGTGCA- (BHQ2) -3'.
2. Method for using kit
Extracting the genomic DNA of a sample to be detected, adding the extracted genomic DNA into a kit, fully mixing with RPA reaction buffer solution, MgOAc (280mM) and sterile water, amplifying for 15 minutes at 37 ℃ under the action of a specific RPA primer pair (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)), fully mixing with Cas12a enzyme (1 mu M), NEbuffer2.1 and ssDNA fluorescent probe (SEQ ID NO: 8) in the kit after amplification is finished, and reacting for 15 minutes at 37 ℃ for cleavage reaction. And placing the reacted kit in a visible light, blue light, ultraviolet light or gel imager for visual detection.
3. Interpretation of results
If the kit appears pink under visible light or bright yellow under blue light or bright pink under ultraviolet light or bright white under a gel imager, a fluorescence signal is expressed, namely the detection result is positive, and the sample to be detected is infected with pasteurella multocida. Otherwise, the detection result is negative, and the sample to be detected is not infected with the pasteurella multocida.
Example 9 kit for visual detection of Pasteurella multocida
1. Composition of the kit
A kit for visually detecting Pasteurella multocida comprises crRNA-KMT2(SEQ ID NO: 2), a specific PCR primer pair (shown as SEQ ID NO: 6 and SEQ ID NO: 7), a ssDNA fluorescent probe (SEQ ID NO: 8), Nebuffer2.1, sterile water and Cas12a enzyme (1 mu M).
The crRNA-KMT2(SEQ ID NO: 2):
5’-AAUUUCUACUAAGUGUAGAUCAUGUUGAGUUACGUUUCUU-3’；
specific PCR primer pair:
PCR-Kmt1-F(SEQ ID NO：6)：5’-ATCCGCTATTTACCCAGTGG-3’；
PCR-Kmt1-R(SEQ ID NO：7)：5’-GCTGTAAACGAACTCGCCAC-3’；
ssDNA fluorescent probe (SEQ ID NO: 8): 5 '- (ROX) -GTATCCAGTGCA- (BHQ2) -3'.
2. Method for using kit
Extracting the genome DNA of a sample to be detected, adding the extracted genome DNA into a kit, fully mixing with sterile water, and carrying out PCR amplification reaction under the action of a specific PCR primer pair (PCR-Kmt1-F (SEQ ID NO: 6) and PCR-Kmt1-R (SEQ ID NO: 7)), wherein the PCR reaction program is as follows: pre-denaturation at 94 ℃ for 10min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, PCR amplification for 30 cycles, re-extension at 72 ℃ for 10min, and then holding at 16 ℃.
After PCR reaction, the mixture was mixed well with Cas12a enzyme (1. mu.M), NEbuffer2.1 and ssDNA fluorescent probe (SEQ ID NO: 8) in a kit, and reacted at 37 ℃ for 15min to perform cleavage reaction. And placing the reacted kit in a visible light, blue light, ultraviolet light or gel imager for visual detection.
3. Interpretation of results
If the kit appears pink under visible light or bright yellow under blue light or bright pink under ultraviolet light or bright white under a gel imager, a fluorescence signal is expressed, namely the detection result is positive, and the sample to be detected is infected with pasteurella multocida. Otherwise, the detection result is negative, and the sample to be detected is not infected with the pasteurella multocida.
Example 10 clinical application of one-step method RPA combined CRISPR-Cas12 in visual detection of Pasteurella multocida
1. Experimental method
(1) And (3) selecting a blood and tissue sample genome extraction kit (DP304-03) for extracting genomes from the pig lung tissue samples from the vegetable market, collecting 16 pig lung tissue samples in total, and numbering 1-16 respectively.
The procedure shown in step (2) of example 3 was first performed on 16 porcine lung tissue samples, and the results were confirmed by electrophoresis.
16 porcine lung tissue samples were tested using the kit described in example 8.
And (4) carrying out the same operation on each pig lung tissue sample to obtain a corresponding centrifuge tube containing the reaction liquid.
(2) And respectively placing the detection kit corresponding to each pig lung tissue sample in a visible light imager, a blue light imager, an ultraviolet imager and a gel imager for visual detection, detecting the change of the intensity of a signal through fluorescence visualization, quantifying the fluorescence intensity value by using ImageJ, and judging the detection sensitivity.
2. Results of the experiment
The results of the electrophoretic identification are shown in fig. 14, and the results show that the porcine lung tissue samples numbered 5, 6, 12 and 14 have bands, and all show positive pasteurella multocida; the fluorescence color development result of the RPA combined CRISPR-Cas12a technology is shown in FIG. 15, the fluorescence signal intensity is shown in FIG. 16, the results show that the pig lung tissue samples numbered 5, 6, 12 and 14 show pink under visible light, bright yellow under blue light, bright pink under ultraviolet light and bright white under a gel imager, all show fluorescence signals, and the detection result is positive; the rest samples show no fluorescence signals, and the detection result is not negative.
The detection result of the RPA combined with the CRISPR-Cas12a technology is consistent with the electrophoresis identification result, and the technology can be used for accurately detecting the clinical Pasteurella multocida.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> kit for visual detection of Pasteurella multocida based on CRISPR-Cas12a and application
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 40
<212> RNA
<213> crRNA-KMT1
<400> 1
aauuucuacu aaguguagau cccagugggg cggugcgaau 40
<210> 2
<211> 40
<212> RNA
<213> crRNA-KMT2
<400> 2
aauuucuacu aaguguagau cauguugagu uacguuucuu 40
<210> 3
<211> 40
<212> RNA
<213> crRNA-KMT3
<400> 3
aauuucuacu aaguguagau uggcucguug ugagugggcu 40
<210> 4
<211> 30
<212> DNA
<213> RPA upstream primer Pm-RPA2-F
<400> 4
agttttgttg ggcggagttt ggtgtgttga 30
<210> 5
<211> 28
<212> DNA
<213> RPA downstream primer Pm-RPA2-R
<400> 5
actcgctact ttttgtttca tttggact 28
<210> 6
<211> 20
<212> DNA
<213> PCR upstream primer PCR-Kmt1-PM-F
<400> 6
atccgctatt tacccagtgg 20
<210> 7
<211> 20
<212> DNA
<213> PCR downstream primer PCR-Kmt1-PM-R
<400> 7
gctgtaaacg aactcgccac 20
<210> 8
<211> 12
<212> DNA
<213> ssDNA fluorescent probe
<400> 8
<210> 9
<211> 20
<212> DNA
<213> PCR-Kmt1-HPS-F
<400> 9
atccgctatt tacccagtgg 20
<210> 10
<211> 20
<212> DNA
<213> PCR-Kmt1-HPS-R
<400> 10
gctgtaaacg aactcgccac 20
<210> 11
<211> 20
<212> DNA
<213> PCR-Kmt1-APP-F
<400> 11
cgtaactcgg tgattgatgc 20
<210> 12
<211> 21
<212> DNA
<213> PCR-Kmt1-APP-R
<400> 12
cgtttgctca ttcgataaac g 21
Claims (10)
1. A composition comprising a crRNA guide sequence and ssDNA fluorescent probes; the nucleotide sequence of the crRNA guide sequence is shown as SEQ ID NO: 1. SEQ ID NO: 2 or SEQ ID NO: 3, respectively.
2. The composition of claim 1, wherein the nucleotide sequence of the crRNA guide sequence is as set forth in SEQ ID NO: 2, respectively.
3. The composition of claim 1, further comprising an amplification primer pair.
4. The composition of claim 3, wherein the amplification primer pair is a PCR primer pair or an RPA primer pair.
5. The composition of claim 4, wherein the nucleotide sequence of the upstream primer Pm-RPA2-F of the RPA primer pair is as shown in SEQ ID NO: 4, the nucleotide sequence of the downstream primer Pm-RPA2-R is shown as SEQ ID NO: 5, respectively.
6. The composition of claim 4, wherein the nucleotide sequence of the upstream primer PCR-Kmt1-PM-F of the PCR primer pair is as shown in SEQ ID NO: 6, the nucleotide sequence of the downstream primer PCR-Kmt1-PM-R is shown as SEQ ID NO: shown at 7.
7. The composition of claim 1, wherein the ssDNA fluorescent probe has a nucleotide sequence as set forth in SEQ ID NO: shown in fig. 8.
8. The composition of claim 7, wherein the ssDNA fluorescent probe is labeled with a fluorophore at the 5 'end and a quencher at the 3' end.
9. The composition of claim 8, wherein the fluorophore is ROX and the quencher is BHQ 2.
10. A kit for detecting pasteurella multocida, comprising the composition of any one of claims 1 to 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210778136.XA CN115029459A (en) | 2022-06-28 | 2022-06-28 | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210778136.XA CN115029459A (en) | 2022-06-28 | 2022-06-28 | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115029459A true CN115029459A (en) | 2022-09-09 |
Family
ID=83129194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210778136.XA Pending CN115029459A (en) | 2022-06-28 | 2022-06-28 | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115029459A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115992284A (en) * | 2022-09-16 | 2023-04-21 | 上海市农业科学院 | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system |
| CN116042926A (en) * | 2023-01-12 | 2023-05-02 | 深圳海关动植物检验检疫技术中心 | Visual rapid detection method for peste des petits ruminants virus nucleic acid and kit thereof |
| CN117210593A (en) * | 2023-10-25 | 2023-12-12 | 四川省畜牧科学研究院 | Primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and detection method |
| CN117305484A (en) * | 2023-10-25 | 2023-12-29 | 四川省畜牧科学研究院 | Detection system and method for simultaneously detecting Pasteurella multocida and mannheimia haemolytica |
-
2022
- 2022-06-28 CN CN202210778136.XA patent/CN115029459A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115992284A (en) * | 2022-09-16 | 2023-04-21 | 上海市农业科学院 | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system |
| CN116042926A (en) * | 2023-01-12 | 2023-05-02 | 深圳海关动植物检验检疫技术中心 | Visual rapid detection method for peste des petits ruminants virus nucleic acid and kit thereof |
| CN116042926B (en) * | 2023-01-12 | 2023-09-15 | 深圳海关动植物检验检疫技术中心 | Visual rapid detection method for peste des petits ruminants virus nucleic acid and kit thereof |
| CN117210593A (en) * | 2023-10-25 | 2023-12-12 | 四川省畜牧科学研究院 | Primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and detection method |
| CN117305484A (en) * | 2023-10-25 | 2023-12-29 | 四川省畜牧科学研究院 | Detection system and method for simultaneously detecting Pasteurella multocida and mannheimia haemolytica |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235232B (en) | Visual rapid nucleic acid detection method based on CRISPR-Cas12a system and application | |
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN107849618A (en) | Differentiate and detect the genetic marker of aquatile infectious disease Causative virus and using its Causative virus discriminating and detection method | |
| CN110656187B (en) | Kit for detecting pathological tissues or echinococcus in canine feces by multiple RAA and multiple PCR and detection method | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| WO2017050934A1 (en) | Improved detection of short homopolymeric repeats | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| CN110656037B (en) | Micro-fluidic chip for pathogen nucleic acid detection and detection method | |
| CN110894550A (en) | RAA constant temperature fluorescence detection method and reagent for eel Herpes Virus (HVA) | |
| CN103725761B (en) | Group B streptococcus (GBS) nucleic acid detection kit and detection method | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN110894532A (en) | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) | |
| CN114410799A (en) | PCR-CRISPR/Cas13 a-based treponema pallidum detection method | |
| CN113388700A (en) | Kit for detecting FCV (FCV), FPV (FPV) and FHV-1 viruses by using nucleic acid hand-free triple fluorescence RT-LAMP (reverse transcription loop-mediated isothermal amplification) | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN112760395A (en) | Primer probe set, kit and detection method for multiple detection of intestinal pathogenic bacteria based on fluorescence RMA method | |
| CN112195257A (en) | Primer group, reagent, kit and detection method for detecting vibrio parahaemolyticus | |
| CN112063734A (en) | Primer, probe and method for quantitatively detecting brucella in human blood by adopting real-time fluorescent quantitative PCR technology | |
| CN104762414A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for fluorescent visual fast detection of Japanese encephalitis B virus | |
| CN110592270A (en) | RAA constant-temperature fluorescence detection method and reagent for Koi Herpesvirus (KHV) | |
| CN111172305B (en) | Method and kit for detecting escherichia coli | |
| CN110592275A (en) | RAA constant temperature fluorescence detection method and reagent for Infectious Spleen and Kidney Necrosis Virus (ISKNV) of mandarin fish | |
| CN113846182B (en) | Kit for rapidly and visually detecting PCV3 and detection method thereof | |
| CN108384833A (en) | RPA methods, its primer special and the probe and purposes of a kind of 2 type Streptococcus suis of detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |