CN111172305B - Method and kit for detecting escherichia coli - Google Patents

Abstract

The embodiment of the specification relates to a method and a kit for detecting escherichia coli, wherein in the detection scheme, an upstream primer 16F19 and a downstream primer 16R1514 are designed and synthesized based on a homologous sequence of 16SrRNA in the escherichia coli, an upstream primer LF20 and a downstream primer LR1039 are designed and synthesized based on a homologous sequence of LacI gene of lactose operon of escherichia coli K-12MG1655, and a double PCR reaction system is constructed based on a primer combination for amplification identification. The dual PCR detection is used, so that the specificity is ensured, the operation is simple, and the influence of complex factors is avoided; the 16SrDNA is used as a control index to ensure that the escherichia coli is not missed, and the LacI gene is a gene specific to the escherichia coli, so that false positive can be controlled. Therefore, the detection sensitivity and the specificity are improved, and meanwhile, the detection is simple and quick to realize, the cost is low, and the popularization is easy.

Description

Method and kit for detecting escherichia coli

Technical Field

The embodiment of the specification relates to the technical field of biological detection, in particular to a method and a kit for detecting escherichia coli.

Background

Escherichia coli (E.coli) is also known as Escherichia coli, and is one of fecal contamination indicator bacteria. Among the three fecal contamination indicator bacteria, escherichia coli, heat-resistant Escherichia coli and Escherichia coli, escherichia coli has the greatest significance in detection. Therefore, escherichia coli is an index that is often examined in sample testing. The number of Escherichia coli in the water body reflects the pollution of the water body by human and animal feces. The limit standard of the escherichia coli for drinking water in China is undetectable (GB 5479-2006). Three methods for detecting escherichia coli in domestic drinking water (hereinafter referred to as national standard method) are disclosed in national standard of the people's republic of China, and are respectively as follows: multitube fermentation, membrane filtration and enzyme substrate processes (GB/T5750.12-2006). All three methods are identified by using a biochemical reaction peculiar to Escherichia coli, so that the three methods all require a bacterial culture step, wherein the culture time of a multitube fermentation method is 48 hours, the filter method is 28 hours, and the enzyme substrate method is 24 hours.

Since the discovery of PCR (Polymerase Chain Reaction ) technology by the American chemist Kary Mullis in 1985, this technology has been widely used in the field of microbiological inspection. The principle of PCR technology is to aim at specific DNA chain, and to utilize the artificial synthesized upstream and downstream primer of the DNA chain and DNA polymerase to realize the amplification of target DNA in vitro through tens of denaturation, annealing and extension cycles. The amplification products may be identified by agarose gel electrophoresis, oligonucleotide probes, DNA chips, immunological techniques, or other luminescent techniques. Unlike the national standard method, the PCR technology does not need a culturing step of microorganisms, and indirectly reflects the presence or absence of microorganisms to be detected by identifying the presence or absence of specific DNA fragments. The technology has the characteristics of high sensitivity, good specificity, time saving, easy operation and the like.

With the widespread use of PCR technology, a number of extension techniques have been developed, such as: the multiplex PCR technology is also called as a composite PCR (Multiplex PCR), namely more than two pairs of different primers are added into a reaction system for simultaneous amplification, and the two pairs of primers can be different genes from different sources or different genes from the same source; (II) nest type PCR (Nesting PCR), utilizing inner and outer primer to amplify target gene successively; (III) real-time fluorescence quantitative PCR (real-time flurescent quantitive PCR), and a PCR technology for quantitatively detecting by means of a corresponding instrument by utilizing the principle that the fluorescence signal intensity is in direct proportion to the DNA concentration; (IV) immune-PCR, is the antigen-antibody immune reaction and PCR combined technology; fifth, rep-PCR (repeated sequence primer polymerase chain reaction) is a new method developed on the basis of random amplified DNA polymorphism (RAPD) analysis for fingerprint analysis of bacteria, and can be used for bacterial typing; the loop-mediated isothermal amplification (LAMP) method is a novel isothermal nucleic acid amplification method developed in 2000, and is characterized in that 4 specific primers are designed for 6 regions of a target gene, and a strand displacement DNA polymerase is utilized to keep the temperature for 30-60 minutes under isothermal conditions (about 63 ℃), so that the nucleic acid amplification reaction can be completed.

Currently, in the methods for inspecting escherichia coli by PCR technology disclosed in the literature, more pathogenic escherichia coli is detected in food and clinical samples, and detection is mainly performed by using virulence genes of pathogenic escherichia coli, for example, the "multiplex PCR method for detecting diarrhea escherichia coli" published in 2009 such as Zhao Gongqing, and the "multiplex PCR method for rapidly detecting 4 kinds of main diarrhea escherichia coli" published in 2010 such as [1], xu Yigang, and the "immuno-PCR technology for detecting enterohemorrhagic escherichia coli O157" published in 2010 such as [2], zhao Chunyan: the kit comprises an ' infectious diarrhea rapid detection kit ' (patent grant publication No. CN 202322847U) published in H7 ', an ' amplification primer and liquid-phase chip kit for detecting food-borne pathogenic microorganisms ' (patent application publication No. CN 105316398A) published in 2016, a ' six food-borne pathogenic bacteria multiplex LAMP detection primer, detection kit and detection method in fruits and vegetables ' (patent application publication No. CN 107022644A) published in 2017, a ' method for rapidly detecting five diarrhea-causing escherichia coli by multiplex qPCR ' published in 2018, a ' infectious diarrhea rapid detection kit ' (patent application publication No. CN 107760766A) and the like, wherein specific cells are captured by using immunomagnetic beads, and specific one gene is amplified by using PCR.

In addition to national standard, the disclosed publication mainly comprises the following steps of:

method one, 1990, bej et al reported a method for detecting total coliform in environmental water using multiplex PCR [4], which used LacZ and LacB genes to detect bacteria involved in human fecal contamination including E.coli, salmonella enterica, and Shigella. The method is not aimed at the detection of escherichia coli indicator bacteria, but is used for detecting three human fecal pollution bacteria including escherichia coli, wherein the total escherichia coli LacZ region and the escherichia coli lamB region are used as lactose operon genes. The method proves that the lactose operon gene can be applied to the detection of escherichia coli. And limited by the technology at that time, the hybridization of the point-to-point immobilized poly dT tail capture probe with the biotin-labeled DNA was examined, and the operability was complicated.

Method two, 2012, fang Zhendong and the like disclose patent application (patent application publication number CN 102703589A) [5] of a synchronous and rapid detection method of 13 pathogenic microorganisms in a water body based on a gene chip, wherein the method mainly detects pathogenic microorganisms in source water, treated sewage and wastewater, and comprises escherichia coli and escherichia coli O15: h7, the method is combined chip detection by 13-fold PCR technology. This technique is relatively complex to operate because 13 pairs of different primers and 13 different probes are required. And hardware facilities such as a chip, a confocal laser scanner and corresponding processing software are also required, so that the popularization is difficult. The operation time was relatively long (about 8 hours) although having higher sensitivity and specificity.

In the third method, 2014, shan Xuliang and the like, a method for detecting escherichia coli in water and a patent application for detecting culture solution (patent application publication number CN 104087652A) are disclosed, the method does not utilize a molecular biological technology, but utilizes an enzyme substrate principle, utilizes a specific culture solution gradient to dilute and culture escherichia coli, establishes a linear equation of concentration and characteristic time, then detects the characteristic time under the premise that the absorbance of a sample to be detected at 410nm has obvious change, and brings the characteristic time into the equation to calculate the concentration of escherichia coli, wherein the detection time is about 10 hours.

In the fourth and 2016 years, sun Zongke and the like, a patent application (patent application publication No. CN 106086159A) of an enzyme substrate culture medium capable of detecting two fecal pollution indicator bacteria simultaneously is disclosed, and a culture inspection method based on the principle of an enzyme substrate method is disclosed, wherein the method can inspect coliform, escherichia coli and heat-resistant escherichia coli, and at least 24 hours are required.

In the fifth and 2016 years, the Chinese zodiac has disclosed a method for rapidly and jointly detecting total coliform and escherichia coli in a water sample (patent application publication No. CN 105907874A), wherein the total coliform and escherichia coli are detected by adopting a multitube fermentation method and combining double PCR, the total coliform uses LacZ genes, and the escherichia coli uses uidA genes. The specific method comprises the steps of carrying out multi-tube fermentation after gradient dilution of a water sample for 8-18 hours, boiling a culture solution to extract genome for double PCR, and finally identifying a result through agarose gel electrophoresis. The mode is actually the combined application of the national standard method and the PCR technology, and has the bacterial culture and the molecular biology technology, and the operation time is about ten hours.

Methods six, 2018, gu Ruibao et al disclose a rapid method for detecting total coliform bacteria in drinking water (patent application publication number CN 109082455A), which requires the use of a flow cytometer to detect different total coliform active cells, including living cells, dead cells and damaged cells. The method needs to use a precise instrument, so that the method is not easy to popularize.

In view of the above, the existing detection scheme of escherichia coli is complex to implement, takes a long time and is not easy to popularize, so that a new scheme for detecting escherichia coli is needed to solve the above problems.

Disclosure of Invention

The embodiment of the specification provides a method and a kit for detecting escherichia coli, which are used for realizing the detection of escherichia coli in a rapid, simple, low-cost and high-sensitivity and high-specificity mode.

In order to solve the above technical problems, the embodiment of the present specification adopts the following technical solutions:

in a first aspect, there is provided a kit comprising: primer combination for constructing a double PCR reaction system for detecting escherichia coli;

wherein, the primer combination includes: the upstream primer 16F19 and the downstream primer 16R1514 designed and synthesized based on the homologous sequence of 16SrRNA in Escherichia coli, and the upstream primer LF20 and the downstream primer LR1039 designed and synthesized based on the homologous sequence of the LacI gene of the lactose operon of Escherichia coli K-12MG 1655.

In a second aspect, there is provided a method for detecting Escherichia coli, comprising:

extracting a metagenome from a sample to be detected, wherein the metagenome comprises genes of all bacteria carried by the sample to be detected;

preparing a first double PCR system by taking the metagenome as a template gene, combining the template gene with a primer and a reaction raw material mixture according to a preset concentration ratio; wherein, the primer combination comprises: upstream primer 16F19 and downstream primer 16R1514, and upstream primer LF20 and downstream primer LR1039;

placing the first double PCR system into a PCR instrument for amplification, wherein denaturation, annealing and extension are repeatedly and circularly performed for 25-35 times, and then extension is performed again;

and identifying the amplified genes based on an electrophoresis mode, and if the escherichia coli is detected, performing double development on the specific fluorescent band, otherwise, performing not double development on the specific fluorescent band.

The above-mentioned at least one technical scheme that this description embodiment adopted can reach following beneficial effect:

1. compared with the national standard method, the method has the advantages that the time is short, the time for collecting microorganisms in a sample by a filtering method is about 5 minutes, the time for boiling and extracting genome is about 10 minutes, the time for preparing a PCR system is about 10 minutes, the time for PCR circulation is about 90 minutes, and the more the time for electrophoresis identification is 30 minutes, so that the identification result is obtained in about 2.5 hours;

2. compared with the real-time fluorescence quantitative PCR technology, the gene chip technology and the flow cytometry technology, the cost is low, each sample needs a water-based acetate fiber filter membrane with the diameter of 50mm and the aperture of 0.45 mu m for checking the used reagent or consumable material, a reusable centrifuge tube with the volume of 15mL, a PCR tube, 4 primers of 0.5 mu L, 2X Taq PCR Master Mix mu L, 0.2g agarose and the like, and the cost is low;

3. the sensitivity is high, and the lowest detection concentration is 40CFU/L; the sensitivity and the specificity are relatively high, and the synchronous test result of 45 samples proves that the coincidence rate of the method is 100% compared with the national standard method;

4. the method does not need large or precise instruments, can be carried out in laboratories for molecular biology experiments, and only needs common instruments such as a common PCR instrument, an electrophoresis tank, an ultraviolet observation device and the like;

5. compared with the PCR combined technology and the loop-mediated isothermal amplification method, the method has the advantages of simple steps, easy operation and easy popularization.

Drawings

In order to more clearly illustrate the embodiments of the present description or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described below, it being obvious that the drawings in the following description are only some of the embodiments described in the embodiments of the present description, and that other drawings may be obtained according to these drawings without inventive effort to a person skilled in the art.

FIG. 1 is a schematic diagram of a system architecture of a content recommendation scheme according to an embodiment of the present disclosure;

FIG. 2 is a schematic diagram showing the development results of lanes corresponding to a double PCR system after successful construction provided in the examples of the present specification;

FIG. 3 is a schematic diagram showing the development results of the detection of Escherichia coli provided in the examples of the present specification;

FIG. 4 is a schematic diagram of colonies of 6 water samples provided in the examples of the present specification observed under a microscope by a national standard method;

fig. 5 is a schematic diagram showing the development result of the drinking water sample provided in the embodiment of the present disclosure when escherichia coli is detected by double PCR.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present specification more apparent, the technical solutions of the embodiments of the present specification will be clearly and completely described below in connection with the specific embodiments of the present specification and the corresponding drawings. It will be apparent that the described embodiments are only some, but not all, of the embodiments of the present specification. All other embodiments, which can be made by one of ordinary skill in the art without undue burden from the embodiments herein, are intended to be within the scope of the embodiments herein.

The following describes in detail the technical solutions provided by the embodiments of the present specification with reference to the accompanying drawings.

The present description provides in embodiments a kit comprising: primer combination for constructing a double PCR reaction system for detecting escherichia coli; wherein, the primer combination includes: the upstream primer 16F19 and the downstream primer 16R1514 designed and synthesized based on the homologous sequence of 16SrRNA in Escherichia coli, and the upstream primer LF20 and the downstream primer LR1039 designed and synthesized based on the homologous sequence of the LacI gene of the lactose operon of Escherichia coli K-12MG 1655.

Further, the concentration of each primer in the kit is 1mM; wherein the volume of the upstream primer 16F19 was 0.5. Mu.L, the volume of the downstream primer 16R1514 was 0.5. Mu.L, the volume of the upstream primer LF20 was 0.5. Mu.L, and the volume of the downstream primer LR1039 was 0.5. Mu.L.

Therefore, when double PCR detection is carried out, a primer combination is not required to be additionally designed and synthesized, and a required double PCR reaction system can be conveniently and quickly constructed only by collecting the primer combination from the kit.

Referring to FIG. 1, a method for detecting Escherichia coli by double PCR according to the embodiments of the present disclosure may include the steps of:

step 102: and extracting a metagenome from a sample to be detected, wherein the metagenome comprises genes of all bacteria carried by the sample to be detected.

The sample to be detected comprises: drinking water, or other food that may carry bacteria.

Optionally, step 102, when extracting the metagenome from the sample to be detected, is specifically performed as: filtering a sample to be detected through a water system acetate fiber filter membrane by using a vacuumizing filter pump device; immersing the filtered filter membrane in a centrifuge tube filled with ultrapure sterile water, boiling and extracting the metagenome.

Step 104: preparing a first double PCR system by taking the metagenome as a template gene, combining the template gene with a primer and preparing a reaction mixture containing DNA polymerase according to a preset concentration ratio; wherein, the primer combination comprises: upstream primer 16F19 and downstream primer 16R1514, and upstream primer LF20 and downstream primer LR1039.

In the examples herein, the upstream primer 16F19 and the downstream primer 16R1514 were designed and synthesized based on the homologous sequence (GenBank No. J01859.1) of Escherichia coli 16SrRNA (E-16 sDNA) on GenBank (national center for Biotechnology information), and the upstream primer LF20 and the downstream primer LR1039 were designed and synthesized based on the homologous sequence (E-LACI) of Escherichia coli Escherichia coli K-12MG1655 lactose operon LacI gene on GenBank. The double PCR ensures the specificity, is simple to operate, and avoids the influence of complex factors; the 16SrDNA is used as a control index to ensure that the escherichia coli is not missed, the LacI gene is used for the first time, and the gene is a special gene of the escherichia coli, so that false positive can be controlled. The primer sequences of the respective primers are shown in Table 1 below.

TABLE 1

Thereafter, a first double PCR system was prepared according to the constructed E-16SrDNA and E-LACI double PCR method with reference to Table 2.

TABLE 2

It will be appreciated that the primer combinations described in this specification may be collected directly from the kit described above, thereby saving detection time; alternatively, it is configured by:

designing and synthesizing an upstream primer 16F19 and a downstream primer 16R1514 based on the homologous sequence of 16SrRNA in Escherichia coli; designing and synthesizing an upstream primer LF20 and a downstream primer LR1039 based on the homologous sequence of the lactose operon LacI gene of Escherichia coli K-12MG 1655; each primer was placed at a concentration of 1mM, wherein the volume of the upstream primer 16F19 was 0.5. Mu.L, the volume of the downstream primer 16R1514 was 0.5. Mu.L, the volume of the upstream primer LF20 was 0.5. Mu.L, and the volume of the downstream primer LR1039 was 0.5. Mu.L.

Step 106: and (3) placing the first double PCR system into a PCR instrument for amplification, wherein denaturation, annealing and extension are repeatedly performed for 25-35 times, and then extension is performed again.

The prepared PCR reaction system is put into a PCR instrument (for example, a PCR instrument manufactured by Biometa company) for amplification, and the amplification conditions are 94 ℃ for 30 seconds; denaturation at 94℃for 30 seconds, annealing at 56℃for 30 seconds, extension at 72℃for 1.5 minutes, 25-35 cycles total; after the amplification cycle, the extension was carried out again at 72℃for 5-10 minutes.

Step 108: and identifying the amplified genes based on an electrophoresis mode, and if the escherichia coli is detected, performing double development on the specific fluorescent band, otherwise, performing not double development on the specific fluorescent band.

The specific fluorescence band was determined as a marker for detecting Escherichia coli by:

extracting genome from Escherichia coli as positive control and two other strains as negative control; according to a preset concentration ratio, combining the genome with the primer and preparing a reaction mixture containing DNA polymerase to obtain a second double PCR system; wherein, the concentration of each primer in the primer combination is 1mM, the volume of the upstream primer 16F19 is 0.5 mu L, the volume of the downstream primer 16R1514 is 0.5 mu L, the volume of the upstream primer LF20 is 0.5 mu L, and the volume of the downstream primer LR1039 is 0.5 mu L; the volume of the genome is 11 μl; the volume of the reaction mixture containing the DNA polymerase is 12. Mu.L; placing the second double PCR system into a PCR instrument for amplification, wherein denaturation-annealing-extension is repeatedly performed for 25-35 times, and then extension is performed again; and identifying the gene amplified by the PCR instrument based on an electrophoresis mode, and developing the gene in a specific fluorescence band, wherein the specific fluorescence band is double-developed under positive control and is not double-developed under negative control.

In fact, the operation of determining the specific fluorescence band should be realized before detection, and the development position of the fluorescence band corresponding to the escherichia coli is found out through the positive control and the negative control, so that the subsequent detection is convenient for judging whether the sample carries the escherichia coli.

The specific fluorescence bands are 1000bp and 1500bp. As shown in FIG. 2, lanes 1-3 are E-16SrDNA PCR results (E-16), E-LACI PCR results (E-L), E-16SrDNA and E-LACI double PCR results (E-16L), lanes 4-6 are 16SrDNA PCR results (S-16), LACI PCR results (S-L), 16SrDNA and LACI double PCR results (S-16L), lanes 7-9 are 16SrDNA PCR results (P-16), LACI PCR results (P-L), 16SrDNA and LACI double PCR results (P-16L), respectively, of Pseudomonas aeruginosa, respectively.

In addition, long fragments were used for the genes used for the double PCR, and the interference of the polymer formed between the primers during the identification by agarose gel electrophoresis was avoided.

The detection method of the present specification is described in detail below through a complete flow.

It will be appreciated that a dual PCR method system needs to be constructed prior to detection of the sample to be detected.

Primer design and Synthesis

The upstream and downstream primers 16F19 and 16R1514 were designed and synthesized based on the homologous sequence of Escherichia coli 16SrRNA (E-16 sDNA) (GenBank accession number J01859.1) on GenBank (national center for Biotechnology information), and the upstream and downstream primers LF20 and LR1039 were designed and synthesized based on the homologous sequence of Escherichia coli Escherichia coli K-12MG1655 lactose operon LacI gene (E-LACI) on GenBank, both of which were used simultaneously for the examination of Escherichia coli, the primers were synthesized by Bomeid, and the primer sequences are shown in Table 1.

Construction of a Dual PCR method System

The E-16SrDNA and E-LACI double PCR method was established using Escherichia coli 1.3344 (from China center for culture Collection of microorganisms) as a positive control, staphylococcus aureus (Staphylococcus aureus) and Pseudomonas aeruginosa (Pseudomonas aeruginosa) as negative controls. The culture solution of the three bacteria cultured overnight was boiled for 10 minutes, centrifuged at 6000rpm for 10 minutes, and the supernatant was taken as a template for PCR to prepare a double PCR system, as shown in Table 3.

TABLE 3 Table 3

The prepared PCR reaction system is put into a PCR instrument (Biometa company) for amplification, and the amplification conditions are 94 ℃ for 30 seconds; denaturation at 94℃for 30 seconds, annealing at 56℃for 30 seconds, elongation at 72℃for 1.5 minutes, 325-350 cycles total; extending at 72 deg.c for 5-10 min.

1% agarose gel electrophoresis was identified and the electrophoresis results were observed under an ultraviolet gel imager (biospectum 310, UVP company, U.S.A.). The result shows that the positive control has two characteristic fluorescent bands at about 1500bp (DNA unit: base pair) and 1000bp, while the negative control has no or only one characteristic fluorescent band, which proves that the method is successfully constructed.

By constructing the system, the primer combination is determined on one hand, and the position of the fluorescence band under the positive control is determined on the other hand, so that the subsequent detection and observation are facilitated.

-extracting metagenome in a sample to be detected

And (3) sufficiently shaking the water sample, filtering 200mL by using a water system acetate fiber filter membrane, and filtering by using a vacuumizing filter pump device. The filter membrane was removed from the filter device by grasping the edges of the filter membrane with sterile forceps. And then, two clean sterile forceps are used for enabling the bacteria membrane to be folded inwards for two times, and the forceps are not required to touch the bacteria membrane in the folding process, so that loss is avoided.

The folded filter membrane is placed in a centrifuge tube filled with 2mL of ultrapure sterile water, the volume of the centrifuge tube is 15mL, the filter membrane is required to be completely immersed under the water surface, the filter membrane is boiled for 10 minutes, and a metagenome in a sample is extracted for later use (the boiled ultrapure water contains a metagenome of microorganisms in the sample and does not need centrifugal treatment). The filter membrane is adopted to filter and collect the microorganisms to be detected, so that the problem of high false negative in detection caused by low microorganism content in drinking water is solved. Meanwhile, the boiling method is used for collecting the metagenome as a PCR template, so that a lot of complicated steps are omitted, and meanwhile, a lot of time is saved, only 10 minutes is needed, and about one hour is needed for extracting the genome by a manual method.

-configuring a PCR reaction system, amplification

The extracted metagenome is used as a template gene, a primer combination is determined from the kit or according to a synthesis method of the primer combination, a polymer reaction raw material mixture is configured according to the proportion shown in the table 2, and then a configured PCR reaction system is put into a PCR instrument for amplification, wherein the amplification conditions refer to the amplification scheme.

Results authentication

As a result, two characteristic fluorescent bands of 1500bp and 1000bp appear to be positive, otherwise, the bands are negative.

In addition, the present specification also provides for the determination of the sensitivity or accuracy of the detection method. The method specifically adopts the following steps:

selecting a single colony of escherichia coli 1.3344 to a nutrient broth liquid culture medium, and culturing for 4-5 hours at 37 ℃ and 100 rpm;

centrifuging, discarding supernatant, and washing twice with 2mL of sterilized water;

then 100mL of sterilized water is added to prepare a simulated water sample and marked as a stock solution, and nine gradients are diluted ten times for standby after fully and uniformly mixing; after the simulated water sample of each gradient is sufficiently and evenly shaken, 100 mu l of the simulated water sample is respectively coated on a nutrient gravy agar plate, the colony count is counted after the culture is carried out for 12 hours at 37 ℃, and the cell count of the escherichia coli contained in each milliliter is calculated;

the simulated water sample of each dilution gradient was filtered by a filter membrane method by 40ml, the filter membrane was taken in a sterile centrifuge tube, 2ml of sterile water was added, and after boiling for 10 minutes, 11. Mu.l of the solution was taken for double PCR, and the system was the same as in Table 4, and the amplified band brightness was observed by electrophoresis. The lowest detected concentration was calculated from the previous gradient without apparent band concentration, and the result is shown in fig. 3. As shown in FIG. 3, the number of colonies grown after 10-fold gradient dilution of the E.coli simulated water sample gradually decreased to the last dilution (10 ^-9 ) No colonies grew, so the lowest dilution detected by this method was 10 ^-8 The corresponding concentration was 40CFU/L.

A scheme for detecting Escherichia coli in drinking water by double PCR of the 16SrRNA gene and LacI gene is given below.

1. Water sample collection

Collecting 22 brands (1-2 bottles/brand) of baby haha, farmer mountain spring and the like, and 45 samples in total; wherein the sample is derived from commercial bottled drinking water, tap water and direct drinking water. The commercial bottled drinking water is purchased from a supermarket, tap water and direct drinking water are sampled nearby, and non-random sampling is performed.

2. Water sample detection

Each bottle of water sample is filtered in two parts with equal volume, 100-250mL of water sample is filtered according to the volume of each bottle by using the filter membrane method, and one filter membrane is used in the double PCR method; the other filter membrane is placed in a fuchsin plate for detection by the national standard method.

3. Analysis of results

And (3) arranging the results obtained by the national standard method and the double PCR method into a four-grid table, wherein the national standard method is used for analyzing the sensitivity, the specificity, the coincidence rate (consistency rate) and the prediction probability of the double PCR method by using the gold standard statistical analysis.

The data were collated using excel 2007 software and statistically analyzed using SPSS19.0 software. Percentage and mean ± standard for effect evaluation index use

The differences represent the percentage comparison using chi-square test or Fisher exact probability method (P < 0.05, statistically significant) and the mean comparison using double-sided test in t-test (test level α=0.05).

The national standard method detects a positive water sample in 43 bottled drinking water samples, the water sample is positive, the direct drinking water sample is positive, see fig. 4, wherein A: a positive control; b: positive tap water sample; c: positive commercial bottled water samples; d: positive direct drinking water sample; e: negative commercial bottled water sample; f: negative control

The double PCR method is not detected in bottled drinking water, a tap water sample is positive, a direct drinking water sample is positive, and the double PCR method is shown in fig. 5, wherein 1-39 and 41-44 are commercial bottled water samples; 40 is a tap water sample; 45 is a box type direct drinking water sample; 46 is a positive control; 47 is negative control and M is Marker2000.

4. Effect of the double PCR method of the present application

The water samples of the escherichia coli detected by the double PCR method and the national standard method are 2 parts, and the water samples of the escherichia coli not detected by the double PCR method and the national standard method are 42 parts. The detection rate of the national standard method is 6.7%, and the detection rate of the double PCR method is 4.4%. The sensitivity of the double PCR method was 66.7%; the specificity is 100%; positive predictive value was 100%; negative predictive value was 97.67%; the coincidence rate is 97.8% compared with the national standard method.

Therefore, the dual PCR detection method has higher sensitivity and specificity, and the detection is simple, quick and accurate; not only can save cost, but also is easy to popularize.

In this specification, each embodiment is described in a progressive manner, and identical and similar parts of each embodiment are all referred to each other, and each embodiment mainly describes differences from other embodiments. In particular, for system embodiments, since they are substantially similar to method embodiments, the description is relatively simple, as relevant to see a section of the description of method embodiments.

Claims (2)

1. Use of a dual PCR primer combination for the preparation of a kit for detecting escherichia coli in drinking water or a water source, comprising: primer combination for constructing a double PCR reaction system for detecting escherichia coli;

wherein, the primer combination includes: an upstream primer 16F19 and a downstream primer 16R1514 designed and synthesized based on the homologous sequence of 16SrRNA in Escherichia coli, and an upstream primer LF20 and a downstream primer LR1039 designed and synthesized based on the homologous sequence of the LacI gene of the lactose operon of Escherichia coli K-12 MG1655;

the upstream primer 16F19 was ACGATGTCGCAGAGTATGC, the downstream primer 16R1514 was CCTACGGTTACCTTGTTACGA, the upstream primer LF20 was ACGATGTCGCAGAGTATGC, and the downstream primer LR1039 was TTAATGAATCGGCCAACG.

2. The use according to claim 1, wherein the concentration of each primer in the kit is 1mM; wherein, the volume of upstream primer 16F19 is 0.5 mu L, the volume of downstream primer 16R1514 is 0.5 mu L, the volume of upstream primer LF20 is 0.5 mu L, and the volume of downstream primer LR1039 is 0.5 mu L.

Images