CN105256042B - The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application - Google Patents
The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application Download PDFInfo
- Publication number
- CN105256042B CN105256042B CN201510730619.2A CN201510730619A CN105256042B CN 105256042 B CN105256042 B CN 105256042B CN 201510730619 A CN201510730619 A CN 201510730619A CN 105256042 B CN105256042 B CN 105256042B
- Authority
- CN
- China
- Prior art keywords
- aeromonas hydrophila
- nucleotide
- primer
- pcr
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of nucleotide to aeromonas hydrophila (Aeromonas hydrophila) O antigen-specifics and its application, the nucleotide includes 1)SEQ ID NO:At least one of nucleotide shown in 1-8;2)With SEQ ID NO:At least one of the nucleotide of nucleotide complementation shown in 1-8.These nucleotide can be used for preparing detection aeromonas hydrophila PCR kit and genetic chip.The present invention the PCR kit to the nucleotide of aeromonas hydrophila O antigen-specifics and comprising the nucleotide, genetic chip it is highly practical, PCR kit preparation method is easy, and detection cycle is short, speed is fast, and operability is strong, it is easy to industrialization production, and testing cost is relatively low;Accuracy is high;High sensitivity.
Description
Technical field
The present invention relates to aeromonas hydrophila O13, O36, the special nucleotide of O16 and O19 serotypes more particularly to right
Individual gene special nucleotide and its application in aeromonas hydrophila O13, O36, O16 and O19 serotype O antigen gene clusters.
Background technology
Aeromonas hydrophila(Aeromonas hydrophila)Belong to vibrionaceae Aeromonas, is that Gram-negative is short
Bacillus, without gemma and pod membrane also known as Aeromonas hydrophila.Aeromonas hydrophila is widely present in the numerous water bodys of nature,
It is the primary pathogenic bacteria of a variety of aquatic animals.It is that typical people-beast-fish is total to illness pathogen for conditionity pathogenic bacteria.It is logical
It crosses enteron aisle and enters body, the very strong exotoxin of toxicity can be generated, cause fulminant hemorrhage.Under normal circumstances, thalline is to intestines
The adhesion strength of road tissue is stronger, and the ectotoxic toxicity generated is stronger.There are many serotype of aeromonas hydrophila, symptom
Different, the disease infected by aeromonas hydrophila is generally in a bad way, the pernicious propagation of multidigit, and the death rate is higher.
Typing of bacteria mainly has traditional phenotypic approach, serological method and method for identifying molecules with identification method.So
And with the development of molecular biology, traditional serotype and identification method there is a problem that it is certain, as serotype this
Kind of diagnostic method needs a large amount of antiserum, and antiserum general classes are not complete, lazy weight, a large amount of antiserum preparing and
There is also some difficulties in storage.Time-consuming, sensitivity is low, omission factor is high for another aspect serotype method, accuracy is poor, no
It is frequently present of cross reaction between the antiserum that same O antigens generate.Therefore, the serum mirror based on Protocols in Molecular Biology is established
Determining method becomes developing direction.
The Molecular Identification of aeromonas hydrophila is increasingly valued by people, and becomes aeromonas hydrophila strain and plant type
Therefore the important evidence of identification, many new bacterium also generate.For vibrios, biochemical reaction is mainly the performance of various zymograms, is belonged to
In the content of formalness, what the similitude of nucleic acid was only vibrios kind defines most basic, most direct feature.Therefore, hydrophilic gas
The parting of monad should be triggered with most effective, most direct mode is identified from the research of nucleic acid, by comparing nucleic acid(Including base
Because of group and nucleic acid fragment)Similitude determine the ownership of aeromonas hydrophila.
In recent years, more and more molecular engineerings are used for parting, identification, detection and the disease screening of pathogen, including turn
Record spacer region (ITS) sequence analysis, random amplification length polymorphism (RAPD) is analyzed, rDNA Restriction Fragment Length is more
State property (RFLP) analysis etc..Molecular biology method cannot be only used for the rapid serum parting screening of aeromonas hydrophila, stablize
Qualification result can make up the deficiency of phenotypic characteristic identification method.It is compared with traditional sensing techniques, these are based on polymerase chain
Formula reacts the molecular detection technology of (PCR), needs not move through the processes such as separation, the pure culture of pathogen, and with quick, spirit
The advantages that quick, high specificity.
Polymerase chain reaction technology (Polymerase chain reaction, abbreviation round pcr) is examined as microorganism
Survey technology is currently accepted and is promoted, which has high throughput, detection speed fast, specific relative to traditional method
By force, the advantages that high sensitivity, simply pre- increasing bacterium need to be only carried out to sample or increases bacterium process, then is prepared carefully by centrifuging and cracking
Bacterium DNA profiling, so that it may with high specific primer mediation under PCR during expand target sequence, reach detection sample in be
The no purpose containing invasive organism to be measured.The amplification procedure of PCR only needs 1 and a half hours.This to inspection and quarantine department and
Clinical examination undoubtedly greatly improves operating rate and reduces job costs.
No matter from the perspective of internal and international, serum type is quickly and accurately identified, is aeromonas hydrophila
It is highly important that prevention and control, which provide effective technical support,.
Invention content
The object of the present invention is to provide a kind of nucleotide to aeromonas hydrophila O antigen-specifics, it is characterised in that
The nucleotide has:
1)SEQ ID NO:At least one of nucleotide shown in 1-8;
2)With SEQ ID NO:At least one of the nucleotide of nucleotide complementation shown in 1-8;The SEQ ID
NO:1-8 is as follows:
It is described the present invention also provides a kind of PCR kit, including PCR primer, dNTP, buffer solution and archaeal dna polymerase
PCR primer is such as SEQ ID NO:At least one of nucleotide shown in 1-8.The kit further includes following reagent:
10 mM dNTP 30μl;10 × enzyme spcificity reaction buffer, 50 μ l;5 μ l of 5U/ μ l hot resistant DNA polymerases;Primer mixture
10μl;10 μ l of positive reference substance;10 μ l of negative controls;ddH2O 5ml。
Wherein the PCR primer is preferably described such as SEQ ID NO:At least one of nucleotide shown in 1-8.
The present invention further discloses a kind of SEQ ID NO to aeromonas hydrophila O antigen-specifics:1-8 nucleotide exists
Application in terms of preparing for detecting aeromonas hydrophila O antigens PCR kit, genetic chip or microarray.
Hydrophilic gas unit cell of the present invention can be sampled in tap water, sewage, the crude extract of culture of seawater, melon and fruit vegetable
In dish, the crude extract of the pure culture of sick body sample or aeromonas hydrophila.
Collecting aeromonas hydrophila extraction genome is prepared using conventional method.
For the PCR kit of aeromonas hydrophila, entire detecting step includes sample pretreatment-amplification-electrophoresis inspection
Survey result.Primer and the required reagent of PCR reaction systems have been previously added in amplification pipe, and user only needs will be pretreated
Sample is added amplification pipe and starts amplified reaction, and simple and quick completion detects work.
The present invention also provides a kind of genetic chips, including solid phase carrier to be visited with the oligonucleotides being fixed on solid phase carrier
Needle, wherein the oligonucleotide probe includes above-mentioned nucleotide;The wherein described nucleotide is preferably such as SEQ ID NO:1-8 institutes
The nucleotide shown.
The present invention also provides a kind of micro- arrays comprising above-mentioned nucleotide;The wherein described nucleotide is preferably such as SEQ
ID NO:Nucleotide shown in 1-8.Answering in terms of detecting the genetic chip of hydrophilic gas unit cell, in terms of the hydrophilic gas unit cell microarray of inspection
With.The aeromonas hydrophila is acute gastroenteritis caused by due to polluted source and not cooked, the unwashed food of detection, outside
The bacterium of a variety of mixed type infection such as sentimental dye, enteric infectious disease, inside-hospital infection.
A kind of nucleotide to aeromonas hydrophila O antigen-specifics disclosed by the invention is compared with prior art, of the invention
It has the following advantages that:
(1)It is highly practical:A kind of PCR reaction systems that the present invention establishes can detect aeromonas hydrophila, provide serum point
The used special primer of type detection, can be detected clinical samples using the PCR method.
(2)Accuracy is high:The present invention is reacted by the PCR of the special gene of each serotype to aeromonas hydrophila, often
A sample obtains a purpose band, will obtain target fragment and compares with known length, so that it may to obtain aeromonas hydrophila
Affiliated serotype.
(3)Testing cost is relatively low:Food Hygiene Surveillance, environmental monitoring, still product supervision and inspection can be applied to
The fields such as quarantine, and provide technology mode for other different pathogenic bacteria detection combinations.
The above is only operation and the implementation of the present invention, not makees limit in any form to the present invention
System, it is every according to the technical essence of the invention to any simple modification, equivalent change and modification made by above example, still
Belong in the range of technical solution of the present invention.
Description of the drawings:
Fig. 1 shows other serotype reference culture electrophoresis of O13 serotypes special primer of the present invention detection aeromonas hydrophila
Result figure,wzmThe screening of gene P1 and P2 primer, purpose band 165bp, remaining serotype do not have the specific bacterium of any band
Strain information is shown in Table 2;
Fig. 2 indicates the species specific identification electrophoresis result figure of O13 serotypes special primer of the present invention, wherein having detected 6 plants
Vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli, without any band, specific bacterial strain information is shown in Table 2;
Fig. 3 indicates other serotype standards of O36 serotypes wzm gene P3 and P4 primer detections aeromonas hydrophila of the present invention
Bacterial strain electrophoresis result figure, the screening of wzm gene P3 and P4 primers, purpose band 198bp, remaining serotype do not have any
Band.Specific bacterial strain information is shown in Table 2;
Fig. 4 indicates the species specific identification electrophoresis result figure of O36 serotypes wzm gene P3 and P4 primers of the present invention, wherein
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli are had detected, without any band.Specific bacterial strain information is shown in Table 2;
Fig. 5 indicates O16 serotypes of the present inventionwzxOther serotype standards of gene P5 and P6 primer detection aeromonas hydrophila
Bacterial strain electrophoresis result figure,wzxThe screening of gene P5 and P6 primer, purpose band 171bp, remaining serotype do not have any
Band, specific bacterial strain information are shown in Table 2;
Fig. 6 indicates the species specific identification of O16 serotypes wzx gene P5 and P6 primers of the present invention;Electrophoresis result figure, wherein
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli are had detected, without any band, specific bacterial strain information is shown in Table 2;
Fig. 7 indicates other serotype standards of O19 serotypes GT gene P7 and P8 primer detections aeromonas hydrophila of the present invention
Bacterial strain electrophoresis result figure, the screening of GT gene P7 and P8 primers, purpose band 152bp, remaining serotype do not have any
Band.Specific bacterial strain information is shown in Table 2;
Fig. 8 shows the species specific identification electrophoresis result figures of O19 serotypes GT gene P7 and P8 primers of the present invention, wherein examining
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli are surveyed, without any band.Specific bacterial strain information is shown in Table 2;
Fig. 9 expressions use O13, O36, the amplification of O16 and O19 special primers to correspond to the electrophoresis result figure of serotype respectively, specifically
Bacterial strain information is shown in Table 2;
Wherein O13, O36,016,019 and negative control (-) indicate corresponding serotype primer amplification as a result, first swimming lane H
It is 2000bp ladder marker with the last one swimming lane.
Specific implementation mode
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as Sambrook et al., molecular cloning:Laboratory manual(New York: Cold Spring Harbor Laboratory
Press,1989)Described in condition.Wherein aeromonas hydrophila O13, O36, O19 derives from Japan Collection of
Microorganisms(JCM), hydrophilic gas unit cell O16 is from the marine organism diseases control of Huanghai Sea aquatic products research institute and molecular disease
Laboratory of science.
Embodiment 1:The extraction of genome
37 DEG C of nutrient broth medium culture aeromonas hydrophilas, collect bacterium, and extraction genome is as follows:
Cell is resuspended with 500ul 50mM Tris-HCl (pH8.0) and 10ul 0.4M EDTA, 37 DEG C incubate 20 minutes,
Then the lysozyme that 10ul 10mg/ml are added continues heat preservation 20 minutes.Proteinase K, the 15ul of 3ul 20mg/ml are added later
10%SDS, 50 DEG C incubate 2 hours, add the RNase of 3 ul 10mg/ml, and 65 DEG C incubate 30 minutes.Isometric phenol is added to extract
Mixture, takes supernatant, then with isometric phenol:Chloroform:Isoamyl alcohol(25:24:1)Solution extracts twice, takes supernatant, then use
Isometric ether extraction is to remove remaining phenol.Supernatant precipitates DNA with 2 times of volume ethanols, rolls out DNA with glass fiber and is used in combination
70% ethyl alcohol washes DNA, and finally DNA is resuspended in 30ul TE.Genomic DNA is detected by 0.4% agarose gel electrophoresis.
Embodiment 2:Sequence is decoded
Skill is sequenced by Solexa pair-end in the genome for extracting each serotype reference culture of aeromonas hydrophila
Art carries out aeromonas hydrophila each serotype genome the sequence that genome sequencing obtains the serotype, with Blast
And PSI-Blast carries out sequence alignment, transmembrane structure prediction is carried out using 2.0 program of TMHMM, with ClustalW
Program carries out sequence alignment and screening is guarded and specific gene segment, the final O for obtaining each serotype of aeromonas hydrophila
Antigen gene cluster sequence and decoding result.
Embodiment 3:Design of primers
The O antigen gene cluster sequences of each serotype of aeromonas hydrophila are that this laboratory is tested oneself, and are analyzed by comparing,
We choose the relatively low gene specific section design primer of Blast comparison result identity and similarity values.Its
Middle O13 serotypeswzmGene comparison result identity values and similarity values are 57% and 76%;The wzm of O36 serotypes
Gene comparison result identity values and similarity values are 73% and 83%;The wzx gene comparison results of O16 serotypes
Identity values and similarity values are 61% and 78%;The GT genes comparison result identity values of O19 serotypes and
Similarity values are 84% and 91%;So each serotype chooses above-mentioned corresponding gene as the special of the serotype respectively
Target gene separately designs special primer for the gene specific section of each serotype.
Design of primers is the core of the invention.Said gene is imported 5 progress primers of Primer Premier to set
Meter, each gene design pair of primers, there is single goal band.
BLAST is carried out in Genbank after design of primers, the primer of design cannot be with the sequence phase of other nearly edge bacteriums
It is excessively high like property, ensure that the primer is only expanded in the precalculated position of oneself in this way, without with other nearly edge bacterium or
Nearly edge bacterium in the environment of collect specimen does not generate positive reaction.This point is for avoiding the generation and experiment of non-specific band
Success or failure are particularly significant.
The primer designed is as shown in table 1:
Table 1 is used for the primer sequence of PCR
Embodiment 4:The screening of special primer
Have collected the reference culture of aeromonas hydrophila O13, O36, O16 and O19 serotype, 6 plants of vibrio other bacterial strains,
The specificity of 1 plant of Salmonella strain and 1 plant of coli strain verification primer, strain number and source are shown in Table 2.
Table 2 is used for the bacterial strain of specific detection
The PCR system that identified for genes primer screening is used is 5 μM of 0.4 μ l of primer, 10 × enzyme spcificity reaction buffers 2.5
μ l, 0.25 μ l of 10mM dNTP, 5U/ μ l hot resistant DNA polymerases 0.2 μ l and 3 μ l sample to be tested template to 0.2ml thin-walled
In PCR pipe, last ddH2O is supplied to 25 μ l.All primers all obtain positive findings in respectively corresponding serotype, at it
Any PCR product band is not obtained in his group.
The reaction cycle parameter in PCR instrument in the step include the denaturation of DNA, renaturation, extension temperature and time,
Cycle-index, specially:
Early period is so that denaturation is reached required temperature and a cycle of required pre-processing process is 95 DEG C, 5
Minute;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 50 DEG C/55 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
Denaturation, renaturation, the cycle-index of extension are 35 cycles;
The temperature and time that a cycle is carried out to stablize amplified production is 72 DEG C, 5 minutes
Wherein, O13 uses 55 DEG C of amplifications using 50 DEG C of amplifications, O16 using 50 DEG C of amplifications, O36 using 55 DEG C of amplifications, O19.
Above-mentioned steps electrophoresis amplified production in electrophoresis equipment, record result the specific steps are:
Take 2~5 μ l amplified productions and 6 × bromophenol blue sample-loading buffer with 1:1 volume ratio mixing;
Mixed liquor is splined on 1.0% Ago-Gel;
By agarose gel electrophoresis 120v voltage stabilizings electrophoresis about 20 minutes, compareed with DL2000 Marker;
Observe and record result.
Terminated substantially by the work of primer screening after basic PC R reactions, necessary length adjustment is to W-response item
Part influences less, and the primer sequence used in the present invention is all summarised in table 1.
Table 1 is used for the primer sequence of PCR
Embodiment 5:The preparation and application of PCR detection kit
1, the composition of PCR kit:
dNTP(10mM) 30μl;
10 × Buffer (10 × enzyme spcificity reaction buffer), 50 μ l;
Taq polymerase(5U/ μ l hot resistant DNA polymerases) 5μl;
PCR primer mixture(5μM) 10μl;
10 μ l of positive reference substance (KP);
Negative controls(KN) 10μl;
ddH2O 5ml;
Each kit can be used for detecting 10 samples.
Wherein 10 × Buffer, dNTP, Taq polymerase are provided by precious bioengineering Co., Ltd;Primer mixture is certainly
The sequence of row design is supplied to Shanghai Ying Jun biotech companies to synthesize;Positive reference substance, negative controls and ddH2O is by us
Voluntarily prepare.
2, instrument and equipment
Wherein 10 × Buffer, dNTP, Taq polymerase are provided by Shanghai life work;Primer mixture is the sequence of designed, designed
Row are supplied to Shanghai Ying Jun biotech companies to synthesize;Positive reference substance, negative controls and ddH2O are voluntarily prepared by us.
The equipment PCR instrument of experiment(Also known as DNA thermal cycling amplification instrument), electrophoresis equipment(Including electrophoresis apparatus and electrophoresis tank), gel imaging
Instrument, -20 DEG C of refrigerators, supercentrifuge, micropipettor and 0.2ml PCR thin-wall tubes.
3, the use specific example of PCR kit
The PCR detection method that aeromonas hydrophila is detected using above-mentioned PCR kit is included the following steps:
(1)Extract environmental sample template to be measured;
(2)In PCR thin-wall tubes addition, dNTP, 10 × Buffer, Taq polymerase, primer, sample to be tested template and
ddH2O mixings;
(3)The mixture of mixing in thin-walled PCR pipe is expanded in PCR instrument;
(4)The electrophoresis amplified production in electrophoresis equipment records result;
(5)It analyzes and carries out result judgement.
Environmental sample template in above-mentioned steps (1) is the crude extract of the culture of tap water, contaminant water, seawater etc., or
It is the crude extract or pure dna or positive reference substance and negative controls of the pure culture of aeromonas hydrophila.
Above-mentioned steps(1)In the extracting method of environmental sample template be:
1.5ml cultures are taken, is centrifuged 1 minute under the conditions of 12000rpm, removes supernatant;
Take the ddH of 500 μ l2Precipitation is resuspended in O, is centrifuged 5 minutes under the conditions of 8000rpm, removes supernatant, dries;
Take 100 μ lddH2Precipitation, water-bath 10 minutes in 100 DEG C of boiling water are resuspended in O;
It is placed on ice after ten minutes, is centrifuged 2 minutes under the conditions of 12000rpm again;
5. taking 3 μ l middle layer supernatants as pcr template
Above-mentioned steps(3)In PCR instrument on reaction cycle parameter include the denaturation of DNA, renaturation, the temperature of extension and when
Between, cycle-index, specially:
Early period is so that denaturation is reached required temperature and a cycle of required pre-processing process is 95 DEG C, 5
Minute;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 50 DEG C/55 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
Denaturation, renaturation, the cycle-index of extension are 35 cycles;
The temperature and time that a cycle is carried out to stablize amplified production is 72 DEG C, 5 minutes.
Above-mentioned steps(4)The electrophoresis amplified production in electrophoresis equipment, record result the specific steps are:
Take 2~5 μ l amplified productions and 6 × bromophenol blue sample-loading buffer with 5:1 volume ratio mixing;
Mixed liquor is splined on 1.0% Ago-Gel;
By agarose gel electrophoresis 120v voltage stabilizings electrophoresis about 20 minutes, compareed with DL2000 Marker;
Observe and record result.
As a result it shows:As a result such as attached drawing, PCR product result band is bright, and band is single.
The present invention by configure a kind of detectable aeromonas hydrophila can industrialization production PCR kit, PCR is examined
Survey method needs component to be used to combine, in use, extraction sample to be tested, while passing through relatively simple operation sequence
It can be carried out quick, sensitive, easy detection, the dosage and concentration of each component are experiment gained in kit, with the examination
Testing equipment is simple used in agent box detection aeromonas hydrophila, and testing cost is low.
The use of positive and negative controls purpose is to be used for Quality Control whole operation process, to obtain accurate judgement.
If containing aeromonas hydrophila purpose O antigenic types, from electrophoresis result it is observed that with positive reference substance same position
Band;If not containing aeromonas hydrophila purpose O antigenic types, do not have this band as negative controls.
Amount of reagent in kit used in one-time detection experiment of the present invention see the table below shown in 3, and DNA profiling amount is 3 μ l
Amount of reagent in kit used in the experiment of 3 one-time detection of table
Hot resistant DNA polymerase in the present invention is rTaq enzymes.
Above-mentioned positive reference substance be have determined that be each O antigenic types of aeromonas hydrophila sample, negative controls
Then be through laboratory determine be not aeromonas hydrophila sample.
If the bacteria suspension of this PCR kit aeromonas hydrophila carries out PCR amplification, with extracted obtained DNA conducts
Template acquired results are always.Susceptibility and specific indifference make operating method in this way, the extraction step of template DNA can be saved
It is simplified.Meanwhile compared to for routine biochemistry detection method, sample to be tested used by this method can directly be clinical sample
Product culture solution, or simple separation culture is carried out to detection sample and can be carried out detecting, thus save manpower and materials.
4, the offer of sample to be tested
Have collected cholera O13, O36, O16 and O19 serotype reference culture, 6 plants of vibrio other bacterial strains, 1 plant of detection of Salmonella
Belong to the specificity of bacterial strain and 1 plant of coli strain verification primer, strain number and source are shown in Table 2.
SEQUENCE LISTING
<110>Nankai University
<120>The nucleotide special to cholera bacilli O13, O36, O16 and O19 and application
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
tgttaaaaactggaatcttatt22
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
acctccagaccatctagctt20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
atttagcgaagtgttcaaggct22
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
aagattgacaaaagggagtatt22
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
ttacatggagcgttaatagctg22
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
gagcagaagtcactgccatcag22
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<400> 7
tgcggttctaagtgcggcga20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
ttcttgacaggagggtgaaaga22
Claims (3)
1. one group of aeromonas hydrophila O13, O36, O16 and O19 specific detection primer, it is characterised in that the specific detection primer
For:SEQ ID NO:Nucleotide shown in 1-8;Nucleotide therein is used to prepare detection aeromonas hydrophila O13, O36, O16
With O19 PCR kits;Aeromonas hydrophila sampling in tap water, sewage, seawater culture crude extract, melon and fruit
In vegetables, the crude extract of the pure culture of sick body sample or aeromonas hydrophila.
2. one kind includes one group of aeromonas hydrophila O13, O36, O16 and O19 specific detection primer as described in claim 1
PCR kit, including PCR primer, dNTP, buffer solution and archaeal dna polymerase, the PCR primer are SEQ ID NO:Shown in 1-8
Nucleotide.
3. one kind is being made including one group of aeromonas hydrophila O13, O36, O16 and O19 specific detection primer as described in claim 1
It is ready for use on the application in terms of detection aeromonas hydrophila microarray;The wherein described detection aeromonas hydrophila refer to detection by
It is really felt with acute gastroenteritis, trauma infection contamination, enteric infectious disease, hospital caused by not cooked, unwashed food in polluted source
Contaminate a variety of mixed type infection.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510730619.2A CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510730619.2A CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105256042A CN105256042A (en) | 2016-01-20 |
CN105256042B true CN105256042B (en) | 2018-10-26 |
Family
ID=55095967
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510730619.2A Active CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105256042B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111850145A (en) * | 2020-07-08 | 2020-10-30 | 南开大学 | Detection method for serotype O antigen molecule parting of aeromonas hydrophila O7, O16, O19, O24 and the like |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1927664A1 (en) * | 2006-11-28 | 2008-06-04 | Canon Kabushiki Kaisha | Primer for bacterium genome amplification reaction |
CN103898227A (en) * | 2014-04-16 | 2014-07-02 | 南开大学 | Nucleotide specific to cronobacter O antigen and application of nucleotide |
-
2015
- 2015-11-02 CN CN201510730619.2A patent/CN105256042B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1927664A1 (en) * | 2006-11-28 | 2008-06-04 | Canon Kabushiki Kaisha | Primer for bacterium genome amplification reaction |
CN103898227A (en) * | 2014-04-16 | 2014-07-02 | 南开大学 | Nucleotide specific to cronobacter O antigen and application of nucleotide |
Non-Patent Citations (1)
Title |
---|
GenBank:KP856714;Merino A;《GenBank》;20150616;全文 * |
Also Published As
Publication number | Publication date |
---|---|
CN105256042A (en) | 2016-01-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
O'Sullivan | Methods for analysis of the intestinal microflora | |
CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
CN104862393B (en) | A kind of nucleotides and its application to Cronobacter sakazakii O antigen-specifics | |
CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
CN107365869B (en) | Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology | |
CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
Hu et al. | Simultaneous analysis of foodborne pathogenic bacteria by an oligonucleotide microarray assay | |
CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application | |
CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
CN108504756B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
CN105256042B (en) | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application | |
CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
CN105255871B (en) | The nucleotide special to aeromonas hydrophila O7, O8, O9 and O10 and application | |
CN105256043B (en) | The nucleotide special to aeromonas hydrophila O29, O30, O33 and O35 and application | |
CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
CN108715897B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
CN105177133B (en) | The nucleotide special to comma bacillus O6, O4, O7 and O15 and its application | |
CN108707679B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
CN108715899B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application | |
CN105087569B (en) | To vibrio cholerae O 18, O19, O23 and the special nucleotides of O12 and its application | |
CN114480680B (en) | Primer group for detecting salmonella serotype antigen genotyping and application thereof | |
JP2004290171A (en) | Molecular biological identification technique of microorganism |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |