CN105256042A - Nucleotide specific to Aeromonas hydrophila O13, O36, O16 and O19 and application - Google Patents
Nucleotide specific to Aeromonas hydrophila O13, O36, O16 and O19 and application Download PDFInfo
- Publication number
- CN105256042A CN105256042A CN201510730619.2A CN201510730619A CN105256042A CN 105256042 A CN105256042 A CN 105256042A CN 201510730619 A CN201510730619 A CN 201510730619A CN 105256042 A CN105256042 A CN 105256042A
- Authority
- CN
- China
- Prior art keywords
- nucleotide
- aeromonas hydrophila
- pcr
- seqidno
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a nucleotide specific to Aeromonas hydrophila O antigens and an application thereof. The nucleotide comprises: (1) at least one of nucleotides shown as SEQ ID NO:1 to 8; and (2) at least one of nucleotides being complementary with the nucleotides shown as SEQ ID NO:1 to 8. The nucleotides can be used for preparing a PCR (Polymerase Chain Reaction) kit for detecting Aeromonas hydrophila and a gene chip. The nucleotide specific to the Aeromonas hydrophila O antigens and the PCR kit and the gene chip including the nucleotide have high practicability. The PCR kit has the advantages of easiness and convenience in preparation, short detection period, high speed, high operability, easiness for industrial production, relatively low detection cost, high accuracy and high sensitivity.
Description
Technical field
The present invention relates to aeromonas hydrophila O13, the Nucleotide that O36, O16 and O19 serotype is special, particularly relate to aeromonas hydrophila O13, the Nucleotide that in O36, O16 and O19 serotype O antigen gene cluster, individual gene is special and application thereof.
Background technology
Aeromonas hydrophila (Aeromonashydrophila) belongs to vibrionaceae Aeromonas, is Gram-negative tyrothricin, does not have gemma and pod membrane, have another name called Aeromonas hydrophila.Aeromonas hydrophila is extensively present in the numerous water body of nature, is the primary pathogenic bacterium of multiple hydrocoles.For conditionality pathogenic bacterium, it is typical people-beast-fish ill pathogenic bacteria altogether.It enters body by enteron aisle, can produce the extracellular toxin that toxicity is very strong, causes fulminant hemorrhagic disease.Generally, the adhesive power of thalline to intestinal tissue is stronger, and its ectotoxic toxicity produced is stronger.The serotype of aeromonas hydrophila is a lot, and symptom is also different, and the disease infected by aeromonas hydrophila is generally in a bad way, and the pernicious propagation of multidigit, mortality ratio is higher.
Typing of bacteria and authentication method mainly contain traditional phenotypic approach, serological method and molecular assay method.But along with molecular biological development, traditional serotype and authentication method also exist certain problem, diagnostic method as this in serotype needs a large amount of antiserum(antisera)s, and antiserum(antisera) general classes is incomplete, quantity not sufficient, a large amount of antiserum(antisera)s is in preparation and also there are some difficulties in storing.On the other hand serotype method length consuming time, sensitivity is low, loss is high, poor accuracy, often there is cross reaction between the antiserum(antisera) that different O antigen produces.Therefore, the serological diagnosis method set up based on Protocols in Molecular Biology becomes developing direction.
The Molecular Identification of aeromonas hydrophila is more and more subject to people's attention, and becomes the important evidence that aeromonas hydrophila bacterial classification and plant type are identified, therefore many new bacterium also produce.For vibrios, the performance of biochemical reaction mainly various zymogram, belongs to the content of formalness, and the similarity of nucleic acid is only the defining the most at all of vibrios kind, the most direct feature.Therefore, somatotype and the qualification of aeromonas hydrophila are the most effectively, the most direct mode should trigger from the research of nucleic acid, by comparing the ownership of the similarity determination aeromonas hydrophila of nucleic acid (comprising genome and nucleic acid fragment).
In recent years, increasing molecular engineering is used for the somatotype of pathogenic bacteria, qualification, detection and disease screening, comprises transcribed spacer (ITS) sequential analysis, random amplification length polymorphism (RAPD) is analyzed, rDNA restriction fragment length polymorphism (RFLP) is analyzed.Molecular biology method not only can be used for the rapid serum somatotype examination of aeromonas hydrophila, and stable qualification result can make up the deficiency of phenotypic characteristic authentication method.Compare with traditional sensing techniques, these are based on the molecular detection technology of polymerase chain reaction (PCR), do not need the process such as separation, pure culture through pathogenic bacteria, and have the advantages such as quick, sensitive, high specificity.
Polymerase chain reaction technology (Polymerasechainreaction, be called for short round pcr) admitted at present as microorganism detection technology and promoted, this technology has relative to traditional method that high-throughput, detection speed are fast, high specificity, sensitivity advantages of higher, only need carry out simple pre-increasing bacterium to sample or increase bacterium process, again by the centrifugal and detailed bacterium DNA profiling of cracking, just can to increase target sequence in the PCR process under the mediation of high specific primer, reach the object detected in sample whether containing invasive organism to be measured.The amplification procedure of PCR only needs 1 and a half hours.This greatly improves working speed undoubtedly to inspection and quarantine department and Clinical Laboratory and reduces job costs.
No matter from internal and international angle, identify serum type quickly and accurately, it is very important that the prevention and control for aeromonas hydrophila provide effect technique support.
Summary of the invention
The object of the present invention is to provide a kind of Nucleotide to aeromonas hydrophila O antigen-specific, it is characterized in that described Nucleotide has:
1) at least one in the Nucleotide shown in SEQIDNO:1-8;
2) with at least one in the Nucleotide of the nucleotide complementary shown in SEQIDNO:1-8; Described SEQIDNO:1-8 is as follows:
Present invention also offers a kind of PCR kit, comprise PCR primer, dNTP, damping fluid and archaeal dna polymerase, described PCR primer is at least one in the Nucleotide such as shown in SEQIDNO:1-8.Described test kit, also comprises following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; Primer mixture 10 μ l; Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o5ml.
Wherein said PCR primer is preferably at least one in described Nucleotide as shown in SEQIDNO:1-8.
The present invention further discloses a kind of SEQIDNO:1-8 Nucleotide to aeromonas hydrophila O antigen-specific for the preparation of the application detected in aeromonas hydrophila O antigen PCR kit, gene chip or microarray.
Hydrophilic gas unit cell of the present invention can sample in the crude extract of the culture in tap water, sewage, seawater, gourd, fruit and vegetable, sick body sample or the crude extract of the pure growth of aeromonas hydrophila.
Collecting aeromonas hydrophila extraction genome is adopt ordinary method to prepare.
For the PCR kit of aeromonas hydrophila, whole detecting step comprises sample pretreatment-amplification-electrophoresis detection result.Primer and the reagent required for PCR reaction system add in amplification pipe in advance, and pretreated sample only need be added amplification pipe and start amplified reaction by user, and simple and quick completes testing.
The present invention also provides a kind of gene chip, and comprise solid phase carrier and be fixed on the oligonucleotide probe on solid phase carrier, wherein said oligonucleotide probe comprises above-mentioned Nucleotide; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-8.
The present invention also provides a kind of micro-array, and it comprises above-mentioned Nucleotide; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-8.Detect the gene chip aspect of hydrophilic gas unit cell, examine the application of hydrophilic gas unit cell microarray aspect.Described aeromonas hydrophila be detect due to polluted source and do not boil, the bacterium of multiple mixed type infection such as acute gastroenteritis, trauma infection contamination, infectious intestinal disease, nosocomial infection etc. that unwashed food causes.
Compared with prior art, tool of the present invention has the following advantages a kind of Nucleotide to aeromonas hydrophila O antigen-specific disclosed by the invention:
(1) practical: a kind of PCR reaction system that the present invention sets up, can aeromonas hydrophila be detected, the special primer used by serotype detection is provided, utilize this PCR method can detect clinical samples.
(2) accuracy is high: the present invention passes through the PCR reaction to the special gene of each serotype of aeromonas hydrophila, each sample obtains the band of an entry, object fragment will be obtained compared with known length, just can obtain the serotype belonging to aeromonas hydrophila.
(3) testing cost is relatively low: can be applied to the field such as Food Hygiene Surveillance, environmental monitoring, the still quarantine of product supervision and inspection, and provides technology mode for other different pathogenic microbes detects combine.
The above, only operation of the present invention and implementation method, not any pro forma restriction is done to the present invention, every above embodiment is done according to technical spirit of the present invention any simple modification, equivalent variations and modification, all still belong in the scope of technical solution of the present invention.
Accompanying drawing illustrates:
Fig. 1 represents that O13 serotype special primer of the present invention detects other serotype reference cultures of aeromonas hydrophila electrophoresis result figure,
wzmthe screening of gene P1 and P2 primer, object band is 165bp, remaining serotype without any the concrete bacterial strain information of band in table 2;
Fig. 2 represents the species specific qualification electrophoresis result figure of O13 serotype special primer of the present invention, and wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 3 represents that O36 serotype wzm gene P3 of the present invention and P4 primer detect other serotype reference cultures of aeromonas hydrophila electrophoresis result figure, and the screening of wzm gene P3 and P4 primer, object band is 198bp, and remaining serotype is without any band.Concrete bacterial strain information is in table 2;
Fig. 4 represents O36 serotype wzm gene the P3 of the present invention and species specific qualification electrophoresis result figure of P4 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band.Concrete bacterial strain information is in table 2;
Fig. 5 represents O16 serotype of the present invention
wzxgene P5 and P6 primer detect other serotype reference cultures of aeromonas hydrophila electrophoresis result figure,
wzxthe screening of gene P5 and P6 primer, object band is 171bp, and remaining serotype is without any band, and concrete bacterial strain information is in table 2;
Fig. 6 represents O16 serotype wzx gene P5 of the present invention and the species specific qualification of P6 primer; Electrophoresis result figure, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 7 represents that O19 serotype GT gene P7 of the present invention and P8 primer detect other serotype reference cultures of aeromonas hydrophila electrophoresis result figure, and the screening of GT gene P7 and P8 primer, object band is 152bp, and remaining serotype is without any band.Concrete bacterial strain information is in table 2;
Fig. 8 represents O19 serotype GT gene the P7 of the present invention and species specific qualification electrophoresis result figure of P8 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band.Concrete bacterial strain information is in table 2;
Fig. 9 represents and uses O13 respectively, the electrophoresis result figure of the corresponding serotype of O36, O16 and O19 specific primers amplify, and concrete bacterial strain information is in table 2;
Wherein O13, O36,016,019 and negative contrast (-) represent corresponding serotype primer amplification result, first swimming lane H and last swimming lane are 2000bpladdermarker.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments should be understood only be not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition as people such as Sambrook, molecular cloning: the condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989).Wherein aeromonas hydrophila O13, O36, O19 derives from JapanCollectionofMicroorganisms(JCM), hydrophilic gas unit cell O16 derives from Huanghai Sea aquatic products institute marine organism diseases and controls and molecular pathology laboratory.
embodiment 1: genomic extraction
37 DEG C of nutrient broth mediums cultivate aeromonas hydrophila, collect bacterium, extract genome concrete steps as follows:
With 500ul50mMTris-HCl (pH8.0) and 10ul0.4MEDTA re-suspended cell, 37 DEG C of incubations 20 minutes, the N,O-Diacetylmuramidase then adding 10ul10mg/ml continues insulation 20 minutes.Add the Proteinase K of 3ul20mg/ml, 15ul10%SDS afterwards, 50 DEG C of incubations 2 hours, then add the RNase of 3ul10mg/ml, 65 DEG C of incubations 30 minutes.Add equal-volume phenol extracting mixture, get supernatant liquor, then use isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) solution extracting twice, get supernatant liquor, then with isopyknic ether extraction to remove remaining phenol.Supernatant liquor 2 times of volume ethanol precipitation DNA, roll out DNA with glass yarn and wash DNA with 70% ethanol, being finally resuspended in 30ulTE by DNA.Genomic dna is detected by the agarose gel electrophoresis of 0.4%.
embodiment 2:sequence is decoded
Extract the genome of each serotype reference culture of aeromonas hydrophila, by Solexapair-end sequencing technologies, the sequence that genome sequencing obtains this serotype is carried out to each serotype genome of aeromonas hydrophila, Blast and PSI-Blast is used to carry out sequence alignment, TMHMM2.0program is adopted to carry out transmembrane structure prediction, ClustalWprogram is used to carry out sequence alignment and screen conservative and specific gene fragment, final O antigen gene cluster sequence and the decoding result obtaining each serotype of aeromonas hydrophila.
embodiment 3: design of primers
The O antigen gene cluster sequence of each serotype of aeromonas hydrophila is tested oneself in this laboratory, and by compare of analysis, we choose Blast comparison result identity and the relatively low gene specific section design primer of similarity value.Wherein O13 serotype
wzmgene comparison result identity value and similarity value are 57% and 76%; The wzm gene comparison result identity value of O36 serotype and similarity value are 73% and 83%; The wzx gene comparison result identity value of O16 serotype and similarity value are 61% and 78%; The GT gene comparison result identity value of O19 serotype and similarity value are 84% and 91%; So each serotype chooses the specific target gene of gene as this serotype of above-mentioned correspondence respectively, the gene specific section for each serotype designs special primer respectively.
Design of primers is the core of this invention.Said gene is imported PrimerPremier5 and carry out design of primers, each gene design pair of primers, has single purpose band.
In Genbank, BLAST is carried out after design of primers, the primer of design can not be too high with the sequence similarity of other nearly edge bacterium, so just can guarantee that this primer only increases in the predetermined position of oneself, and not produce positive reaction with the nearly edge bacterium in the environment of other nearly edge bacterium or collect specimen.This point is very important for the success or failure of the generation and experiment of avoiding non-specific band.
The primer designed is as shown in table 1:
Table 1 is for the primer sequence of PCR
embodiment 4: the screening of special primer
Have collected the reference culture of aeromonas hydrophila O13, O36, O16 and O19 serotype, 6 other bacterial strains of strain Vibrio, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source are in table 2.
Table 2 is for the bacterial strain of specific detection
The PCR system that gene identification primer screening is used be 5 μMs of primer 0.4 μ l, 10 × enzyme spcificity reaction buffer 2.5 μ l, 10mMdNTP0.25 μ l, 5U/ μ l hot resistant DNA polymerase 0.2 μ l and 3 μ l testing sample template in the thin-walled PCR pipe of 0.2ml, last ddH
2o supplies 25 μ l.All primers all obtain positive findings in serotype corresponding separately, do not obtain any PCR primer band in other groups.
Reaction cycle parameter in PCR instrument in this step comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 50 DEG C/55 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes
Wherein, O13 uses 50 DEG C of amplifications, and O36 uses 50 DEG C of amplifications, and O16 uses 55 DEG C of amplifications, and O19 uses 55 DEG C of amplifications.
Above-mentioned steps is electrophoresis amplified production in electrophoresis equipment, and the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 1:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 20 minutes, contrast with DL2000Marker;
observe and record result.
Substantially terminated by the work of primer screening after basic PC R reaction, necessary length adjustment is little on the impact of W-response condition, and the primer sequence used in the present invention is all summed up in Table 1.
Table 1 is for the primer sequence of PCR
the preparations and applicatio of embodiment 5:PCR detection kit
1, the composition of PCR kit:
dNTP(10mM)30μl；
10 × Buffer (10 × enzyme spcificity reaction buffer) 50 μ l;
Taq polysaccharase (5U/ μ l hot resistant DNA polymerase) 5 μ l;
PCR primer mixture (5 μMs) 10 μ l;
Positive reference substance (KP) 10 μ l;
Negative controls (KN) 10 μ l;
ddH
2O5ml；
Each test kit can be used for detection 10 samples.
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by precious biotechnology company limited; Primer mixture is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH
2o is prepared voluntarily by us.
2, plant and instrument
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by the raw work in Shanghai; Primer mixture is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH2O are prepared voluntarily by us.The equipment PCR instrument (having another name called DNA thermal cycling amplification instrument) of experiment, electrophoresis equipment (comprising electrophoresis apparatus and electrophoresis chamber), gel imaging instrument ,-20 DEG C of refrigerators, supercentrifuge, micropipet and 0.2mlPCR thin-walled tubes.
3, the use specific examples of PCR kit
The PCR detection method using above-mentioned PCR kit to detect aeromonas hydrophila comprises the steps:
(1) environmental sample template to be measured is extracted;
(2) add in PCR thin-walled tube, dNTP, 10 × Buffer, Taq polysaccharase, primer, testing sample template and ddH
2o mixes;
(3) mixture mixed in thin-walled PCR pipe is increased in PCR instrument;
(4) electrophoresis amplified production in electrophoresis equipment, record result;
(5) analyze and carry out result judgement.
Environmental sample template in above-mentioned steps (1) is the crude extract of the culture of tap water, polluted water, seawater etc., or the crude extract of the pure growth of aeromonas hydrophila or pure dna, or positive reference substance and negative controls.
The extracting method of the environmental sample template in above-mentioned steps (1) is:
get 1.5ml culture, under 12000rpm condition centrifugal 1 minute, remove supernatant liquor;
get the ddH of 500 μ l
2the resuspended precipitation of O, under 8000rpm condition centrifugal 5 minutes, removes supernatant liquor, dries;
get 100 μ lddH
2the resuspended precipitation of O, water-bath 10 minutes in 100 DEG C of boiling water;
be placed on ice after 10 minutes again, under 12000rpm condition centrifugal 2 minutes;
5. 3 μ l middle layer supernatant are got as pcr template
Reaction cycle parameter in PCR instrument in above-mentioned steps (3) comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 50 DEG C/55 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes.
Above-mentioned steps (4) electrophoresis amplified production in electrophoresis equipment, the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 5:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 20 minutes, contrast with DL2000Marker;
observe and record result.
Result shows: result is as accompanying drawing, and PCR primer result band becomes clear, and band is single.
The present invention by configuration a kind of detect aeromonas hydrophila can industrialization produce PCR kit, PCR detection method is needed the combination of components of use together, during use, extract testing sample, just quick, sensitive, easy detection can be carried out through comparatively simple operation sequence simultaneously, in test kit, the consumption of each component and concentration are test gained, and detect with this test kit the testing installation that aeromonas hydrophila uses simple, testing cost is low.
Use object that is positive and negative controls to be for the whole operating process of Quality Control, judge accurately to draw.If containing aeromonas hydrophila object O antigenic type, then can observe the band with positive reference substance same position from electrophoresis result; If not containing aeromonas hydrophila object O antigenic type, then the same with negative controls do not have this band.
The amount of reagent that one-time detection of the present invention is tested in the test kit used sees the following form shown in 3, and DNA profiling amount is 3 μ l
Table 3 one-time detection tests the amount of reagent in the test kit used
Hot resistant DNA polymerase in the present invention is rTaq enzyme.
Above-mentioned positive reference substance is determined it is the sample of each O antigenic type of aeromonas hydrophila, and negative controls is then for determining it is not the sample of aeromonas hydrophila through laboratory.
If this PCR kit bacteria suspension of aeromonas hydrophila carries out pcr amplification, and through extracting the DNA that obtains as template acquired results always.Susceptibility and specificity indifference, like this, can save the extraction step of template DNA, working method is simplified.Meanwhile, compare routine biochemistry detection method, the testing sample that present method adopts can be directly clinical sample nutrient solution, or to detection sample carry out simple separation cultivate just can detect, thus save manpower and materials.
4, the providing of testing sample
Have collected cholera O13, O36, O16 and O19 serotype reference culture, 6 other bacterial strains of strain Vibrio, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source are in table 2.
SEQUENCELISTING
<110> Nankai University
<120> to cholera bacilli O13, the Nucleotide that O36, O16 and O19 are special and application
<160>8
<170>PatentInversion3.5
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
tgttaaaaactggaatcttatt22
<210>2
<211>20
<212>DNA
<213> artificial sequence
<400>2
acctccagaccatctagctt20
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
atttagcgaagtgttcaaggct22
<210>4
<211>20
<212>DNA
<213> artificial sequence
<400>4
aagattgacaaaagggagtatt22
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
ttacatggagcgttaatagctg22
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
gagcagaagtcactgccatcag22
<210>7
<211>20
<212>DNA
<213> artificial sequence
<400>7
tgcggttctaagtgcggcga20
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
ttcttgacaggagggtgaaaga22
Claims (8)
1., to a Nucleotide for aeromonas hydrophila O antigen-specific, it is characterized in that described Nucleotide has:
1) at least one in the Nucleotide shown in SEQIDNO:1-8;
2) with at least one in the Nucleotide of the nucleotide complementary shown in SEQIDNO:1-8.
2. described in claim 1 to the Nucleotide of aeromonas hydrophila O antigen-specific, it is characterized in that above-mentioned Nucleotide may be used for preparation and detects aeromonas hydrophila PCR kit, gene chip or microarray; Described aeromonas hydrophila can sample in the crude extract of the culture in tap water, sewage, seawater, gourd, fruit and vegetable, sick body sample or the crude extract of the pure growth of aeromonas hydrophila.
3. a PCR kit, is characterized in that comprising PCR primer, dNTP, damping fluid and archaeal dna polymerase, and described PCR primer is at least one in the Nucleotide such as shown in SEQIDNO:1-8.
4. test kit according to claim 2, also comprises following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; Primer mixture 10 μ l; Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o1ml.
5. SEQIDNO:1-8 Nucleotide according to claim 1 is for the preparation of the application detected in aeromonas hydrophila PCR kit.
6. the application of SEQIDNO:1-8 Nucleotide according to claim 1 in the gene chip for the preparation of detection aeromonas hydrophila.
7. SEQIDNO:1-8 Nucleotide according to claim 1 is for the preparation of the application detected in aeromonas hydrophila microarray.
8. the application described in claim 6-7, wherein said detection aeromonas hydrophila refer to detect due to polluted source and do not boil, the bacterium of multiple mixed type infection such as acute gastroenteritis, trauma infection contamination, infectious intestinal disease, nosocomial infection etc. that unwashed food causes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510730619.2A CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510730619.2A CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105256042A true CN105256042A (en) | 2016-01-20 |
| CN105256042B CN105256042B (en) | 2018-10-26 |
Family
ID=55095967
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510730619.2A Active CN105256042B (en) | 2015-11-02 | 2015-11-02 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105256042B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850145A (en) * | 2020-07-08 | 2020-10-30 | 南开大学 | Detection method for serotype O antigen molecule parting of aeromonas hydrophila O7, O16, O19, O24 and the like |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1927664A1 (en) * | 2006-11-28 | 2008-06-04 | Canon Kabushiki Kaisha | Primer for bacterium genome amplification reaction |
| CN103898227A (en) * | 2014-04-16 | 2014-07-02 | 南开大学 | Nucleotide specific to cronobacter O antigen and application of nucleotide |
-
2015
- 2015-11-02 CN CN201510730619.2A patent/CN105256042B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1927664A1 (en) * | 2006-11-28 | 2008-06-04 | Canon Kabushiki Kaisha | Primer for bacterium genome amplification reaction |
| CN103898227A (en) * | 2014-04-16 | 2014-07-02 | 南开大学 | Nucleotide specific to cronobacter O antigen and application of nucleotide |
Non-Patent Citations (1)
| Title |
|---|
| MERINO A: "GenBank：KP856714", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850145A (en) * | 2020-07-08 | 2020-10-30 | 南开大学 | Detection method for serotype O antigen molecule parting of aeromonas hydrophila O7, O16, O19, O24 and the like |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105256042B (en) | 2018-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN109468395A (en) | A kind of primer, kit, detection method and application detecting mycoplasma | |
| CN108823325B (en) | Application of riemerella anatipestifer Imp gene, PCR detection kit and method thereof | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN102002539B (en) | Porcine parvovirus assay kit and application thereof | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN105256042A (en) | Nucleotide specific to Aeromonas hydrophila O13, O36, O16 and O19 and application | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
| CN108715897B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
| CN105886622A (en) | Primer and method for fast typing campylobacter jejuni | |
| CN105255871A (en) | Specific nucleotide for aeromonas hydrophila O7, O8, O9 and O10 and application thereof | |
| CN105256043A (en) | Nucleotide specific to Aeromonas hydrophila O29, O30, O33 and O35 and application | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
| CN105256028A (en) | Specific nucleotides for citrobacter 017 and 039 and application of special nucleotides | |
| CN105087569A (en) | Specific nucleotides for Vibrio cholerae O18, O19, O23 and O12 and applications of specific nucleotides | |
| CN105177133B (en) | The nucleotide special to comma bacillus O6, O4, O7 and O15 and its application | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| CN102140514B (en) | Specific primers and kit for detecting various serotype pathogenic bacteria of legionella pneumophilia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |