CN105154439B - To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence - Google Patents
To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence Download PDFInfo
- Publication number
- CN105154439B CN105154439B CN201510473545.9A CN201510473545A CN105154439B CN 105154439 B CN105154439 B CN 105154439B CN 201510473545 A CN201510473545 A CN 201510473545A CN 105154439 B CN105154439 B CN 105154439B
- Authority
- CN
- China
- Prior art keywords
- hafnia alvei
- primer
- pcr
- nucleotide
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to include one of nucleotide shown in 1) SEQ ID NO:1-8 to Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide and its application, the nucleotide.These nucleotide can be used for preparing the PCR kit and genetic chip of detection Hafnia alvei.The present invention is Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide and the PCR kit comprising the nucleotide, genetic chip, the technology operation method is easy, and detection cycle is short, and testing cost is lower, accuracy is high, and high sensitivity is easy to industrialization production.
Description
Technical field
The present invention relates to Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide is especially related to
And to Hafnia alvei G5902, G5903, G5904, the special nucleotide of individual gene in the O antigen gene cluster of G5906
And its application.
Background technique
Hafnia alvei (Hafnia alvei) is one of enterobacteriaceae, and thallus is in direct rod shape, no pod membrane, energy
Dynamic, amphimicrobian has breathing and the two kinds of metabolic way of fermentation, in human airway, enteron aisle, animal intestinal tract and meat milk
It is more common in the foods such as product.Hafnia alvei is a kind of conditioned pathogen, crowd of the bacterium in hypoimmunity
In can cause bacteremia, respiratory tract infection, urinary tract infections and other infection, it may have certain relationship with enterogastritis, in addition,
It may further result in the muco-enteritis and hepatosplenomegaly of laying hen, the animals disease such as Epizootic septicaemia in Bulgarian rainbow trout
Disease.
Typing of bacteria and identification method mainly have traditional phenotypic approach, serological method and method for identifying molecules.So
And with the development of molecular biology, traditional serotype and identification method be there is a problem that certain, as serotype this
Kind of diagnostic method needs a large amount of antiserum, and antiserum general classes are not complete, lazy weight, a large amount of antiserum in preparation and
There is also some difficulties in storage.Time-consuming, sensitivity is low, omission factor is high for another aspect serotype method, accuracy is poor, no
Cross reaction is frequently present of between the antiserum that same O antigen generates.Therefore, the serum mirror based on Protocols in Molecular Biology is established
Method is determined as developing direction.
The surface antigen of Hafnia alvei, existing O antigen also has H antigen, but mainly carries out parting with O antigen,
And the comparison of O antigen research is thorough.At present have determined that Hafnia alvei formal serotype scheme be by Russia not
What the laboratory that the plum Qi Nikefu research institute of vaccine and serum is studied by this section proposed, it is thus identified that 39 O and 36 H-types.
This classification method is always the prefered method of epidemiology relationship between studying bacterial strain, and different from different places comparing
It is especially useful in terms of the bacterial strain of time.Its Molecular Identification is also increasingly valued by people, molecular Biological Detection skill
Art has the advantages that speed is fast and is easy to large-scale use, is the developing direction for the pathogenic bacteria detection generally acknowledged in the world at present.
In recent years, more and more molecular engineerings are used for parting, identification, detection and the disease screening of pathogen, including turn
Record the analysis of spacer region (ITS) sequence, random amplification length polymorphism (RAPD) is analyzed, rDNA Restriction Fragment Length is more
State property (RFLP) analysis etc..Molecular biology method cannot be only used for the rapid serum parting screening of Hafnia alvei, surely
Fixed qualification result can make up the deficiency of phenotypic characteristic identification method.It is compared with traditional sensing techniques, these are based on polymerase
The molecular detection technology of chain reaction (PCR), needs not move through the processes such as separation, the pure culture of pathogen, and have quickly,
The advantages that sensitive, high specificity.
Polymerase chain reaction technology (Polymerase chain reaction, abbreviation round pcr) is examined as microorganism
Survey technology is currently accepted and is promoted, which has high throughput, detection speed fast, specific relative to traditional method
By force, the advantages that high sensitivity, simple increasing bacterium process need to be only carried out to sample, then DNA of bacteria mould is prepared by centrifugation and cracking
Plate, so that it may expand target sequence during PCR under the mediation of high specific primer, whether reach in test sample containing needing
The purpose of the invasive organism of survey.The amplification procedure of PCR only needs 1.5 hours.This to inspection and quarantine department and clinical examination without
It is suspected to be and greatly improves operating rate, while also reduces job costs.
Summary of the invention
The object of the present invention is to provide the present invention relates to Hafnia alvei G5902, G5903, G5904,
G5906 special nucleotide, it is characterised in that the nucleotide includes
1) one of nucleotide shown in SEQ ID NO:1-8；
2) nucleotide one of complementary with nucleotide shown in SEQ ID NO:1-8；The SEQ ID NO:1-8
It is as follows:
It is described the present invention also provides a kind of PCR kit, including PCR primer, dNTP, buffer and archaeal dna polymerase
PCR primer is one of nucleotide as shown in SEQ ID NO:1-8.The kit further includes following reagent: 10
mM dNTP 30μl；10 × enzyme spcificity reaction buffer, 50 μ l；5 μ l of 5U/ μ l hot resistant DNA polymerase；10 μ l of mix primer
(the special upstream and downstream primer of each reference culture, odd number are upstream primer, and even numbers is that downstream primer G5902 is SEQ ID NO:1-
2；G5903 is SEQ ID NO:3-4；G5904 is SEQ ID NO:5-6；G5906 is SEQ ID NO:7-8)；Positive reference substance
10μl；10 μ l of negative controls；ddH2O 5ml。
Wherein one of preferably described nucleotide as shown in SEQ ID NO:1-8 of the PCR primer.
The present invention further discloses to Hafnia alvei G5902, G5903, G5904, G5906 special SEQ ID
NO:1-8 nucleotide is used for the PCR kit of the bacterium different strains G5902, G5903, G5904, G5906 in preparation.
Hafnia alvei of the present invention refers to sampling in the clinical mark such as septicemia, urinary tract infection, wound infection
The crude extract of the pure culture of the crude extract or Hafnia alvei of this culture.It collects Hafnia alvei and extracts
Genome is prepared using conventional method.
For the PCR kit of Hafnia alvei, entire detecting step includes sample pretreatment-amplification-electrophoresis
Testing result.Reagent required for primer and PCR reaction system has been previously added in amplification pipe, and user only need to will be after pretreatment
Sample amplification pipe is added, start amplified reaction, simple and quick completion detects work.
The present invention also provides a kind of liquid phase detection chips, including liquid phase magnetic bead and the oligonucleotides being connected on liquid phase magnetic bead
Corresponding primer corresponding to segment where probe and correspondent probe；Wherein the nucleotide is preferably such as SEQ ID NO:1-8
Shown in nucleotide.
The present invention also provides a kind of micro- arrays comprising above-mentioned nucleotide；Wherein the nucleotide is preferably such as SEQ
Nucleotide shown in ID NO:1-8.
The present invention further discloses to Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide
In terms of preparing for detecting Hafnia alvei PCR kit, detecting the genetic chip of Hafnia alvei, detection bee
Application in terms of room Hafnia alvei microarray.The detection Hafnia alvei refers to that detection causes bronchitis,
The bacterium of pneumonia, urinary tract infections, wound infection and septicemia.
It is disclosed by the invention to Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide with it is existing
Technology is compared, the present invention has the advantage that
(1) practical
A kind of PCR reaction system that the present invention establishes can detect Hafnia alvei, provide used in serotype detection
The special primer arrived can detect clinical samples using the PCR method.
(2) accuracy is high
The present invention is reacted by the PCR of the special gene of each serotype to Hafnia alvei, and each sample obtains
One purpose band will obtain target fragment and compare with known length, so that it may obtain bacterium corresponding to Hafnia alvei
Strain number.
(3) testing cost is relatively low
The fields such as Food Hygiene Surveillance, environmental monitoring, the quarantine of commodity supervision and inspection can be applied to, and not for other
Technology mode is provided with pathogenic bacteria detection combination.
Detailed description of the invention:
Fig. 1 shows G5902 special primers of the present invention to detect Hafnia alvei and other reference culture electrophoresis result figures,wzyGene P1 and P2 purpose band is 235bp, remaining bacterial strain does not have any band, and specific bacterial strain information is shown in Table 2；
Fig. 2 indicates the species specific identification electrophoresis result figure of G5902 special primer of the present invention, wherein having detected 6 plants of vibrios
And 1 plant of detection of Salmonella, 1 plant of Escherichia coli, without any band, specific bacterial strain information is shown in Table 2；
Fig. 3 indicates G5903's of the present inventionwzyGene P3 and P4 primer detection Hafnia alvei and other reference cultures
Electrophoresis result figure, purpose band 240bp, specific bacterial strain information are shown in Table 2；
Fig. 4 indicates the species specific identification electrophoresis result figure of wzy gene P3 and P4 primer of this hair G5903, wherein detecting
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli, without any band, specific bacterial strain information is shown in Table；
Fig. 5 indicates this hair G5904'swzyGene P5 and P6 primer detection Hafnia alvei and other reference cultures electricity
Swimming result figure, purpose band 233bp, remaining bacterial strain do not have any band, and specific bacterial strain information is shown in Table 2；
Fig. 6 indicates G5904's of the present inventionwzyThe species specific identification electrophoresis result figure of gene P5 and P6 primer, wherein examining
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli are surveyed, without any band, specific bacterial strain information is shown in Table 2；
Fig. 7 indicates this hair G5906'swzyGene P5 and P6 primer detection Hafnia alvei and other reference cultures electricity
Swimming result figure, purpose band 286bp, remaining bacterial strain do not have any band, and specific bacterial strain information is shown in Table 2；
Fig. 8 shows G5906's of the present inventionwzyThe species specific identification electrophoresis result figure of gene P5 and P6 primer, wherein examining
6 plants of vibrios and 1 plant of detection of Salmonella, 1 plant of Escherichia coli are surveyed, without any band, specific bacterial strain information is shown in Table 2；
Fig. 9 indicates that G5906 special primer, which expands, corresponds to blood respectively with Hafnia alvei G5902, G5903, G5904
The electrophoresis result figure of clear type, specific bacterial strain information are shown in Table 2；
Wherein: Hafnia alvei G5902, G5903, G5904, G5906 indicate corresponding serotype primer amplification as a result,
First swimming lane is 2000bp DNA marker or 1kb plus DL.
Specific embodiment
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) condition described in.Wherein Hafnia alvei derives from Warsaw, POL (PCM, Polish
Collection of Microorganisms at IITD PAN, Wroclaw).
Embodiment 1: the extraction of genome
37 DEG C of nutrient broth medium culture Hafnia alveis collect bacterium, and extracting genome, specific step is as follows:
Cell is resuspended with 500ul 50mM Tris-HCl (pH8.0) and 10ul 0.4M EDTA, 37 DEG C incubate 20 minutes,
Then the lysozyme that 10ul 10mg/ml is added continues heat preservation 20 minutes.Proteinase K, the 15ul of 3ul 20mg/ml are added later
10%SDS, 50 DEG C incubate 2 hours, add the RNase of 3 ul 10mg/ml, and 65 DEG C incubate 30 minutes.Isometric phenol is added to take out
Mention, take supernatant, then with isometric phenol: chloroform: isoamyl alcohol (25:24:1) solution extracts twice, takes supernatant, then with etc. bodies
Long-pending ether extraction is to remove remaining phenol.Supernatant precipitates DNA with 2 times of volume ethanols, rolls out DNA with glass fiber and with 70%
Ethyl alcohol washes DNA, and finally DNA is resuspended in 30ul TE.Genomic DNA is detected by 0.4% agarose gel electrophoresis.
Embodiment 2:Sequence is decoded
Hafnia alvei G5902, G5903, G5904 are extracted, the genome of G5906 reference culture passes through Solexa
Pair-end sequencing technologies carry out the sequence that genome sequencing obtains the O serotype to each standard gene group of Hafnia alvei
Column carry out sequence alignment with Blast and PSI-Blast, and it is pre- to carry out transmembrane structure using TMHMM Server2.0 program
It surveys, carries out sequence alignment with ClustalW program and screening is guarded and specific gene segment, it is final to obtain honeycomb Hough
The O antigen gene cluster sequence and decoding result of each serotype of Buddhist nun Asia bacterium.
Embodiment 3: design of primers
Situation is decoded according to gene cluster and builds library comparison result, and discovery wzy and wzx gene is Hafnia alvei O anti-
Former special gene, so choosing gene specific section design special primer.Since wzy is more special, so mainly with wzy
Gene is target gene.
Design of primers is the core of the invention.Design primer is designed according to the specific gene described in document.wzx
The two genes are genes more special in Hafnia alvei O antigen gene cluster with wzy, can be used as Serotype Identification
Target gene.Said gene is imported into Primer Premier 5 and carries out design of primers, the length of primer is preferably in 18~24bp
Between, Tm value is at 53~58 DEG C.Each gene designs pair of primers, there is single goal band.
BLAST is carried out in Genbank after design of primers, the primer of design cannot be with the sequence phase of other nearly edge bacteriums
It is excessively high like property, ensure that the primer is only expanded in the predetermined position of oneself in this way, without with other nearly edge bacterium or
Nearly edge bacterium in the environment of collect specimen does not generate positive reaction.This point is for avoiding the generation and experiment of non-specific band
Success or failure are particularly significant.
The primer designed is as shown in table 1.
Table 1 is used for the primer sequence of PCR
Embodiment 4: the screening of special primer
Having collected Hafnia alvei G5902, G5903, G5904, the reference culture of G5906 includes: 6 plants of vibrios, and 1
The specificity of strain Salmonella strain and 1 plant of coli strain verifying primer, strain number and source are shown in Table 2. while mentioning
It proves that sealed files papery version is used when examining in Tianjin municipal health bureau for Hafnia alvei entry and exit electronic edition, sees it
His documentary evidence:
Table 2 is used for the bacterial strain of specific detection
The PCR system that identified for genes primer screening is used is 5 μM of 0.4 μ l of primer, 10 × enzyme spcificity reaction buffers 2.5
μ l, 0.25 μ l of 10mM dNTP, 5U/ μ l hot resistant DNA polymerase 0.2 μ l and 3 μ l sample to be tested template to 0.2ml thin-walled
In PCR pipe, last ddH2O is supplied to 25 μ l.All primers all obtain positive findings in respectively corresponding bacterial strain, at other
Any PCR product band is not obtained in group.
The reaction cycle parameter in PCR instrument in the step include the denaturation of DNA, renaturation, extension temperature and time,
Cycle-index, specifically:
Early period is to make denaturation that can reach required temperature and a circulation of required pre-processing process is 95 DEG C, 5
Minute；
Denaturation temperature and time are 95 DEG C, 45 seconds；
Renaturation temperature and time is 53 DEG C/58 DEG C, 45 seconds；
Elongating temperature and time are 72 DEG C, 1 minute；
Denaturation, renaturation, the cycle-index of extension are 35 circulations；
The temperature and time that a circulation is carried out to stablize amplified production is 72 DEG C, 5 minutes
Wherein, using 53-6 DEG C of amplification, above-mentioned steps are electric in electrophoresis equipment by G5902, G5903, G5904, G5906
Swimming amplified production, records the specific steps of result are as follows:
2~5 μ l amplified productions are taken to mix with 6 × bromophenol blue sample-loading buffer with the volume ratio of 1:1；
Mixed liquor is splined on 1.0% Ago-Gel；
By agarose gel electrophoresis 120v pressure stabilizing electrophoresis about 30 minutes, compareed with DL2000 Marker；
Observe and record result.
The work of primer screening terminates substantially after being reacted by basic PC R, and necessary length adjustment is to W-response item
Part influences less, and the primer sequence used in the present invention is all summarised in table 1.
Table 1 is used for the primer sequence of PCR
The preparation and application of embodiment 6:PCR detection kit
1, the composition of PCR kit:
dNTP(10mM) 30μl；
10 × Buffer (10 × enzyme spcificity reaction buffer), 50 μ l；
Taq polymerase (5U/ μ l hot resistant DNA polymerase) 5 μ l；
10 μ l of PCR primer (5 μM) SEQ ID-NO:1-8；
10 μ l of positive reference substance (KP)；
10 μ l of negative controls (KN)；
ddH2O 5ml；
Each kit can be used for detecting 10 samples.
Wherein 10 × Buffer, dNTP, Taq polymerase are provided by precious bioengineering Co., Ltd；Primer is designed, designed
Sequence be supplied to Shanghai Ying Jun biotech company synthesis；Positive reference substance, negative controls and ddH2O is voluntarily made by us
It is standby.
2, instrument and equipment
Wherein 10 × Buffer, dNTP, Taq polymerase are provided by the raw work in Shanghai；Primer provides for the sequence of designed, designed
It is synthesized to Shanghai Ying Jun biotech company；Positive reference substance, negative controls and ddH2O are voluntarily prepared by us.Experiment
Equipment PCR instrument (also known as DNA thermal cycling amplification instrument), electrophoresis equipment (including electrophoresis apparatus and electrophoresis tank), gel imager, -20 DEG C
Refrigerator, supercentrifuge, micropipettor and 0.2ml PCR thin-wall tube.
3, the use specific example of PCR kit
PCR detection method using above-mentioned PCR kit detection Hafnia alvei includes the following steps:
(1) environmental sample template to be measured is extracted；
(2) in PCR thin-wall tube addition, dNTP, 10 × Buffer, Taq polymerase, primer, sample to be tested template and
ddH2O is mixed；
(3) it is expanded what is mixed in thin-walled PCR pipe in PCR instrument；
(4) the electrophoresis amplified production in electrophoresis equipment records result；
(5) it analyzes and carries out result judgement.
Environmental sample template in above-mentioned steps (1) is sampling in clinical samples such as septicemia, urinary tract infection, wound infections
The crude extract of Hafnia alvei culture, the crude extract or pure dna of the pure culture of Hafnia alvei, or sun
Property reference substance and negative controls.
The extracting method of environmental sample template in above-mentioned steps (1) are as follows:
1.5ml culture is taken, is centrifuged 1 minute under the conditions of 12000rpm, removes supernatant；
Take the ddH of 500 μ l2Precipitating is resuspended in O, is centrifuged 5 minutes under the conditions of 8000rpm, removes supernatant, dries；
Take 100 μ lddH2Precipitating, the water-bath 10 minutes in 100 DEG C of boiling water is resuspended in O；
It is placed on ice after ten minutes, is centrifuged 2 minutes under the conditions of 12000rpm again；
5. taking 3 μ l middle layer supernatants as pcr template
The reaction cycle parameter in PCR instrument in above-mentioned steps (3) include the denaturation of DNA, renaturation, the temperature of extension and when
Between, cycle-index, specifically:
Early period is to make denaturation that can reach required temperature and a circulation of required pre-processing process is 95 DEG C, 5
Minute；
Denaturation temperature and time are 95 DEG C, 45 seconds；
Renaturation temperature and time is 53 DEG C/58 DEG C, 1 minute；
Elongating temperature and time are 72 DEG C, 1 minute；
Denaturation, renaturation, the cycle-index of extension are 35 circulations；
The temperature and time that a circulation is carried out to stablize amplified production is 72 DEG C, 5 minutes.
Above-mentioned steps (4) electrophoresis amplified production in electrophoresis equipment, records the specific steps of result are as follows:
2~5 μ l amplified productions are taken to mix with 6 × bromophenol blue sample-loading buffer with the volume ratio of 5:1；
Mixed liquor is splined on 1.0% Ago-Gel；
By agarose gel electrophoresis 120v pressure stabilizing electrophoresis about 30 minutes, compareed with DL2000 Marker；
Observe and record result.
The present invention by configure a kind of detectable Hafnia alvei can industrialization production PCR kit, by PCR
Detection method needs component to be used to combine, in use, extracting sample to be tested, while passing through relatively simple operation layer
Sequence can be carried out quick, sensitive, easy detection, and the dosage and concentration of each component are test gained in kit, with this
Testing equipment used in kit detection Hafnia alvei is simple, and testing cost is low.
It the use of positive and negative controls purpose is for Quality Control whole operation process, to obtain accurate judgement.
If containing Hafnia alvei purpose Strain type, from electrophoresis result it can be observed that with positive reference substance same position
Band；If not containing Hafnia alvei purpose Strain type, do not have this band as negative controls.
The amount of reagent that one-time detection of the present invention is tested in used kit see the table below shown in 3, and DNA profiling amount is 3 μ l
3 one-time detection of table tests the amount of reagent in used kit
Hot resistant DNA polymerase in the present invention is Taq enzyme.
Above-mentioned positive reference substance be have determined that be Hafnia alvei reference culture sample, negative controls are then
It is not the sample of Hafnia alvei through laboratory determination.
The bacteria suspension of this PCR kit Hafnia alvei carries out PCR amplification, with extracted obtained DNA conduct
Template acquired results are consistent.Susceptibility and specific indifference make operating method in this way, the extraction step of template DNA can be saved
It is simplified.Meanwhile compared to for routine biochemistry detection method, sample to be tested used by this method can directly be clinical sample
Product culture solution, or simple separation culture is carried out to test sample and can be carried out detecting, thus save manpower and material resources.
4, the offer of sample to be tested
Have collected Hafnia alvei G5902, G5903, G5904, G5906 reference culture and 6 plants of vibrio other bacterium
Strain, the specificity of 1 plant of Salmonella strain and 1 plant of coli strain verifying primer, strain number and source are shown in Table 2.
The above is only operation and implementation method of the invention, not makees limit in any form to the present invention
It makes, according to the technical essence of the invention any simple modification, equivalent change and modification to the above embodiments, still
Belong in the range of technical solution of the present invention.
SEQUENCE LISTING
<110>Nankai University
<120>to Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213>artificial sequence
<400> 1
atgatagacccatacaaattttaag 25
<210> 2
<211> 16
<212> DNA
<213>artificial sequence
<400> 2
actcagcccgcacgtt 16
<210> 3
<211> 25
<212> DNA
<213>artificial sequence
<400> 3
ttaatcttgtgctatgtcttttatg 25
<210> 4
<211> 18
<212> DNA
<213>artificial sequence
<400> 4
gccaatcgcgctatacaa 18
<210> 5
<211> 21
<212> DNA
<213>artificial sequence
<400> 5
tgagaagttgactcctatgc c 21
<210> 6
<211> 26
<212> DNA
<213>artificial sequence
<400> 6
ttttgttctctatgattgtacaatct 26
<210> 7
<211> 19
<212> DNA
<213>artificial sequence
<400> 7
aggaaatcctggggaaatt 19
<210> 8
<211> 18
<212> DNA
<213>artificial sequence
<400> 8
cgtagcgcttaatgtggg 18
Claims (2)
1. the special primer of pair Hafnia alvei, it is characterised in that the nucleotide sequence of the primer are as follows: SEQ ID NO:
Shown in 1-2.
2. a kind of PCR kit containing primer special to Hafnia alvei described in claim 1, it is characterised in that:
Including PCR primer, d NTP, buffer and archaeal dna polymerase, the PCR primer is the primer as shown in SEQ ID NO:1-2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510473545.9A CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510473545.9A CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105154439A CN105154439A (en) | 2015-12-16 |
| CN105154439B true CN105154439B (en) | 2019-04-05 |
Family
ID=54795484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510473545.9A Active CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154439B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763753A (en) * | 2020-06-28 | 2020-10-13 | 南开大学 | Detection method for typing of Hafnia alvei PCM1188 serotype O antigen molecules |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| CN101679986A (en) * | 2007-03-26 | 2010-03-24 | 诺维信公司 | hafnia phytase |
| WO2011155859A3 (en) * | 2010-06-11 | 2012-02-23 | Instytut Immunologii i Terapii Doświadczalnej PAN | Polysaccharide and derivatives thereof, showing affinity to ficolin-3, method of preparation and use |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040002080A1 (en) * | 2001-12-14 | 2004-01-01 | Creighton University | Primers for use in detecting beta-lactamases |
-
2015
- 2015-08-04 CN CN201510473545.9A patent/CN105154439B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101679986A (en) * | 2007-03-26 | 2010-03-24 | 诺维信公司 | hafnia phytase |
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| WO2011155859A3 (en) * | 2010-06-11 | 2012-02-23 | Instytut Immunologii i Terapii Doświadczalnej PAN | Polysaccharide and derivatives thereof, showing affinity to ficolin-3, method of preparation and use |
Non-Patent Citations (2)
| Title |
|---|
| Development of PCR Assays Targeting Genes in O-Antigen Gene Clusters for Detection and Identification of Escherichia coli O45 and O55 Serogroups;Chitrita et al.;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20050831;第71卷(第8期);摘要，第4920页右栏第2段-第4923页左栏第2段，图1，表2 |
| Structures of the biological repeating units in the O-chain polysaccharides of Hafnia alvei strains having a typical lipopolysaccharide outer core region;Ewa Katzenellenbogen et al.;《FEMS Immunology and Medical Microbiology》;20050531;第45卷;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154439A (en) | 2015-12-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| O'Sullivan | Methods for analysis of the intestinal microflora | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105256042B (en) | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application | |
| CN108504756A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application | |
| CN105177133B (en) | The nucleotide special to comma bacillus O6, O4, O7 and O15 and its application | |
| CN105255871B (en) | The nucleotide special to aeromonas hydrophila O7, O8, O9 and O10 and application | |
| CN105256043B (en) | The nucleotide special to aeromonas hydrophila O29, O30, O33 and O35 and application | |
| CN105087569B (en) | To vibrio cholerae O 18, O19, O23 and the special nucleotides of O12 and its application | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
| CN108715897A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| CN108715899A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| CN105219769B (en) | The nucleotide special to citric acid bacillus O6 and O9 and its application | |
| CN105112505A (en) | Nucleotides with specificity on Klebsiella K44, K59, K61, and K63 serotypes, and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |