CN103898227B - A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof - Google Patents
A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof Download PDFInfo
- Publication number
- CN103898227B CN103898227B CN201410150358.2A CN201410150358A CN103898227B CN 103898227 B CN103898227 B CN 103898227B CN 201410150358 A CN201410150358 A CN 201410150358A CN 103898227 B CN103898227 B CN 103898227B
- Authority
- CN
- China
- Prior art keywords
- nucleotide
- cronobacter sakazakii
- primer
- pcr
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Abstract
The invention discloses a kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof.Does is described Nucleotide: SEQ? ID? at least one at least one in Nucleotide shown in NO:1-12 or the Nucleotide of complementation.This special Nucleotide can be used for PCR kit and/or the gene chip of preparing rapid detection Cronobacter sakazakii.The Cronobacter sakazakii detected in clinical and food with this test kit is simple and convenient, and accuracy is high, and sensitivity is good, workable, reproducible, and testing cost is low.
Description
Technical field
The present invention relates to a kind of Nucleotide special to Cronobacter sakazakii O antigen gene cluster, particularly relate to a kind of Nucleotide special to individual gene in Cronobacter sakazakii O antigen gene cluster.
Background technology
cronobacter(Cronobacter sakazakii) is a genus of new classification recently, former title Enterobactersakazakii(Enterobacter sakazakii).2007-2008 rises to genus by kind, and one that becomes enterobacteriaceae newly belongs to
cronobacter.Comprise 7 kinds at present,
cronobactersakazakii, C.malonaticus, C.muytjensii, C.dublinensis, C.turicensis, C.condimentiwith
c.universalis.Now there are some researches show, have obvious Difference in Pathogenicity between all Cronobacter sakazakii different strains, bacterium relevant with infant infection in it concentrates on
cronobactersakazakii, C.malonaticuswith
c.dublinensison.
Cronobacter sakazakii is important food-borne pathogens, widely distributed, is detected in the numerous food such as baby milk powder, cheese, butcher's meat, water, vegetables, rice, bread, tealeaves, herbal medicine, food flavouring and bean curd.In the investigation some newborn infant's Cronobacter sakazakii being infected to event, find that baby milk powder is main infection channel.Along with the outburst with great infection event recalled by a series of milk powder relevant to this bacterium, in baby formula milk powder, the infection problems of Cronobacter sakazakii is subject to global common concern, be defined as by the World Health Organization and many countries the essential condition pathogenic bacterium causing Infant and child deaths, the disease of any age level crowd can be caused, especially maximum to the threat of the light baby of premature infant, baby weight or immunocompromised host baby, severe patient can cause septicemia, meningitis or necrotizing enterocolitis, and mortality ratio can reach 40% ~ 80%.The World Health Organization (WHO) and U.S. food Drug Administration (FDA) have held the meeting that this bacterium is discussed in succession 2004 and 2006.
The classification position of current Cronobacter sakazakii is just set up, and the research of its O antigen serotype also becomes focus gradually.Lipopolysaccharides is the major surfaces composition of Gram negative bacteria, comprises lipoid A, core polysaccharide and O antigen.O antigen is the outermost layer structure of gram negative bacterium lipopolysaccharide molecule, the polysaccharide chain that it is made up of multiple oligosaccharides repeating unit, and repeating unit is generally made up of 3 ~ 6 monose.In intestinal bacteria, Salmonellas and Shigellae, the gene arranged adjacent being responsible for the synthesis of O antigen, between two housekeeping gene galF and gnd, forms a gene cluster on chromosome.The gene of O antigen gene cluster inside is divided three classes usually: monose synthase gene, glycosyltransferase gene and oligosaccharide unit treatment enzyme gene.Monose synthetic enzyme is responsible for the synthesis of monose precursor, and glycosyltransferase is responsible for monose to be connected into oligosaccharides repeating unit, and few pool unit treatment enzyme is responsible for oligosaccharide unit to be transported to outside inner membrance from its inner side, and oligosaccharide unit is connected.
The change of the lipopolysaccharides particularly the Nomenclature Composition and Structure of Complexes of O-antigen wherein determines the diversity of gram negative bacterial cell surface antigen determinant, such as identifies that the antigenic type of salmonella reached 2107 according to the structural performance of lipopolysaccharides in the world.Serotype is a kind of classics and conventional epidemiology survey means, for clinical study and vaccine development significant.This diagnostic method needs a large amount of antiserum(antisera)s, and antiserum(antisera) general classes is incomplete, quantity not sufficient, and a large amount of antiserum(antisera)s is in preparation and also there are some difficulties in storing.On the other hand this method length consuming time, sensitivity is low, loss is high, poor accuracy, often there is cross reaction between the antiserum(antisera) that different O antigen produces.Therefore, the serological diagnosis method set up based on Protocols in Molecular Biology becomes current developing direction.Generally believe now that this traditional Serology test will replace for modern molecular biology method.
In recent years, increasing molecular engineering is used for the somatotype of pathogenic bacteria, qualification, detection and disease screening, comprises transcribed spacer (ITS) sequential analysis, random amplification length polymorphism (RAPD) is analyzed, rDNA restriction fragment length polymorphism (RFLP) is analyzed.Molecular biology method not only can be used for the rapid serum somatotype examination of Enterobacter sakazakii, and stable qualification result can make up the deficiency of phenotypic characteristic authentication method.Compare with traditional sensing techniques, these are based on the molecular detection technology of polymerase chain reaction (PCR), do not need the process such as separation, pure culture through pathogenic bacteria, and have the advantages such as quick, sensitive, high specificity.
Not the glycosyltransferase of synantigen and the sequence homology of oligosaccharide unit treatment enzyme very low, have height serotype specificity, can be used as target gene and carry out molecular biology identification.Oligosaccharide unit treatment enzyme gene comprises O antigen delivery enzyme gene (wzx) and O antigen pol gene (wzy).Above-mentioned two genes are utilized to be very good as the specific target gene that Serotypes detects.As intestinal bacteria (Wang Wei, Peng Xia, 2006), Bacillus proteus and Salmonellas all have the example utilizing this gene to do specific detection.
Polymerase chain reaction technology (Polymerasechainreaction, be called for short round pcr) admitted at present as microorganism detection technology and promoted, this technology has relative to traditional method that high-throughput, detection speed are fast, high specificity, sensitivity advantages of higher, only need carry out simple pre-increasing bacterium to sample or increase bacterium process, again by the centrifugal and detailed bacterium DNA profiling of cracking, just can to increase target sequence in the PCR process under the mediation of high specific primer, reach the object detected in sample whether containing invasive organism to be measured.The amplification procedure of PCR only needs 1 and a half hours.This greatly improves working speed undoubtedly to inspection and quarantine department and Clinical Laboratory and reduces job costs.No matter from internal and international angle, identify serum type quickly and accurately, it is very important that the prevention and control for Cronobacter sakazakii provide effect technique support.
Summary of the invention
One object of the present invention there are provided a kind of Nucleotide special to Cronobacter sakazakii O antigen gene, it is characterized in that described Nucleotide is:
1) at least one in the Nucleotide shown in SEQIDNO:1-12
2) with at least one in the Nucleotide of the nucleotide complementary shown in SEQIDNO:1-12.The Nucleotide of wherein said complementation refers to by the Nucleotide shown in SEQIDNO:1-12 according to basepairing rule (A=T, G ≡ C) draw with the Nucleotide of their complementations, the complementary nucleotide as SEQIDNO1:5'GAAGCGGCAGATTCATTTA3' is 5 ' TAAATGAATCTGCCGCTTC3 '.
Another object of the present invention there are provided a kind of PCR kit for detecting Cronobacter sakazakii, comprises PCR primer, dNTP, damping fluid and archaeal dna polymerase, at least one in described PCR primer Nucleotide as shown in SEQIDNO:1-12.As for detect
c.dublinensisprimer SEQIDNO:1 and SEQIDNO:2 of O1, and for detecting
c.dublinensiso2 primer SEQIDNO:3 and SEQIDNO:4.
This test kit, also comprises following reagent: 10mMdNTP30 μ L; 10 × enzyme spcificity reaction buffer 50 μ L; 5U/ μ L hot resistant DNA polymerase 5 μ L; Primer 1(10 μM) 10 μ l; Primer 2 (10 μMs) 10 μ l; Positive reference substance 10 μ L; Negative controls 10 μ L; ddH
2o5mL.
Further object of the present invention there are provided the application of described Nucleotide in the gene chip for the preparation of detection Cronobacter sakazakii.Described gene chip is microarray chip.Comprise solid phase carrier and be fixed on the oligonucleotide probe on solid phase carrier, wherein said oligonucleotide probe comprises above-mentioned Nucleotide; At least one in the Nucleotide of wherein said Nucleotide as shown in SEQIDNO:1-12.
Compared with prior art, the present invention's Nucleotide for rapid detection Cronobacter sakazakii disclosed by the invention has the following advantages:
(1) practical
The compound methods such as the PCR kit that application the present invention prepares are easy, and sense cycle is short, speed is fast, workable, is easy to industrialization produce, and testing cost is relatively low.
(2) accuracy is high
The present invention devises the primer special to Cronobacter sakazakii O antigen gene, with the genome of Cronobacter sakazakii, for template is PCR, can to obtain band single, the object band that size is correct, and with the genome of other bacterium for template be PCR time, correct object band can not be obtained.
Accompanying drawing illustrates:
G2539 in accompanying drawing is
c.sakazakiio1, G2356 are
c.sakazakiio2, G2594 are
c.sakazakiio4, G2732 are
c.dublinensiso1, G3983 are
c.dublinensiso2, G3882 are
c.turicensiso2, G3874 are
c.turicensiso3, G3886 are
c.muytjensiio2, G3864 are
c.malonaticuso1;
Fig. 1 represents g2732
wzmthe screening of gene P1 and P2 primer, object band is 336bp, and remaining bacterium is without any band;
Fig. 2 represents g3983
wzythe screening of gene P3 and P4 primer, object band is 725bp, and remaining bacterium is without any band;
Fig. 3 represents g3882
wzythe screening of gene P5 and P6 primer, object band is 266bp, and remaining bacterium is without any band;
Fig. 4 represents g3874
wzythe screening of gene P7 and P8 primer, object band is 362bp, and remaining bacterium is without any band;
Fig. 5 represents g3886
wzythe screening of gene P9 and P10 primer, object band is 378bp, and remaining bacterium is without any band;
Fig. 6 represents g3864
wzythe screening of gene P11 and P12 primer, object band is 267bp, and remaining bacterium is without any band.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments should be understood only be not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition as people such as Sambrook, molecular cloning: the condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989).
Embodiment 1:
Genomic extraction:
37 DEG C of 2YT liquid nutrient mediums (formula is: peptone 16g/L, yeast powder 10g/L, NaCl5g/L) cultivate Cronobacter sakazakii, collect bacterium, extract genome concrete steps as follows:
With 500ul50mMTris-HCl (pH8.0) and 10ul0.4MEDTA re-suspended cell, 37 DEG C of incubations 20 minutes, the N,O-Diacetylmuramidase then adding 10ul10mg/ml continues insulation 20 minutes.Add the Proteinase K of 3ul20mg/ml, 15ul10%SDS afterwards, 50 DEG C of incubations 2 hours, then add the RNase of 3ul10mg/ml, 65 DEG C of incubations 30 minutes.Add equal-volume phenol extracting mixture, get supernatant liquor, then use isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) solution extracting twice, get supernatant liquor, then with isopyknic ether extraction to remove remaining phenol.Supernatant liquor 2 times of volume ethanol precipitation DNA, roll out DNA with glass yarn and wash DNA with 70% ethanol, being finally resuspended in 30ulTE by DNA.Genomic dna is detected by the agarose gel electrophoresis of 0.4%.
Embodiment 2:
O antigen gene cluster is decoded:
(1) the O antigen gene cluster of the Cronobacter sakazakii that increased by Long-PCR.According in Genbank
galFgene design upstream primer, then basis
gndgene design downstream primer.
PCR response procedures was as follows: 94 DEG C of denaturations 5 minutes; Then 94 DEG C of sex change 30 seconds, anneal 30 seconds for 61 DEG C, 68 DEG C extend 15 minutes, carry out 30 circulations like this, finally, continue extension 8 minutes at 68 DEG C, obtain PCR primer, agarose gel electrophoresis with 0.8% detects the size of PCR primer and specificity thereof, merges 8 pipe 50 μ llongPCR products, and by the WizardPCRPreps Purification Kit PCR primer of Promega company.
build O antigen gene cluster library: build O antigen gene cluster library by shot-gun method, reaction system is 600ngPCR purified product, cuts into 1 ~ 3kb fragment, fills sticky end, the carrier of pUC18 connects (adopt fastlinkligase) and connect the gene library obtaining checking order through nucleic acid fragment instrument.
cloning and sequencing in library: select Insert Fragment and at 200 clone's this lab A BI3730 type automatic dna sequencers of more than 1kb, the Insert Fragment in clone is checked order from library, sequence reaches the fraction of coverage of 8 ~ 10 times, thus obtains all sequences of O antigen gene cluster.
the splicing of nucleotide sequence and analysis: with Pregap4 and the Gap4 software splicing of the Stadenpackage software package of Britain Camb MRC Molecular Biology Lab publication with after editing all sequences, gene is found with the orffinder at American National Biotechnology Information center, find open reading frame, with the genetic comparison in the blast groupware and GenBank to find the function of these open reading frames and to determine that what gene they are, gene annotation is completed again with the Artemis software at Britain Sanger center, the precise alignment between DNA and protein sequence is done with ClustralW software, finally obtain the sequence of the gene cluster of Cronobacter sakazakii.
Embodiment 3:
Design of primers and screening
Decode situation according to gene cluster, we find
wzy/wzmreally be the special gene of Cronobacter sakazakii, so choose this gene specific section design special primer.Said gene is imported PrimerPremier5 and carry out design of primers, the length of primer is preferably between 18 ~ 24bp, and Tm value is at 50 ~ 55 DEG C.
In Genbank, BLAST is carried out after design of primers, the primer of design can not be too high with the sequence similarity of other nearly edge bacterium, so just can guarantee that this primer only increases in the predetermined position of oneself, and not produce positive reaction with the nearly edge bacterium in the environment of other nearly edge bacterium or collect specimen.This point is very important for the success or failure of the generation and experiment of avoiding non-specific band.The primer designed is as shown in table 1.
Table 1 is for the primer sequence of PCR
The PCR system (25 μ l) that gene identification primer screening is used and reaction conditions as follows:
Ultrapure water 15.7 μ l
Damping fluid (10X) 2.5 μ l
dNTP(10mM)0.5μl
Primer 1(10 μM) 0.5 μ l
Primer 2 (10 μMs) 0.5 μ l
Archaeal dna polymerase (rTaq) 0.3 μ l (5U/ μ l)
Template DNA 5 μ l
Reaction cycle parameter in PCR instrument in this step comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Above-mentioned steps is electrophoresis amplified production in electrophoresis equipment, and the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 5:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.2%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 10 minutes, contrast with DL2000Marker;
observe and record result.
The genomic templates that this link of primer screening is used is extracted employing and is boiled bacterium method.Substantially terminated by the work of primer screening after basic PC R reaction, necessary length adjustment is little on the impact of W-response condition, and the primer sequence used in the present invention is all summed up in Table 1.
Embodiment 4
:
The application of PCR detection kit
the composition of PCR kit
Comprise PCR primer, dNTP, damping fluid, archaeal dna polymerase, positive reference substance and negative controls.The amount that test kit uses is all 20 μ l is a basic consumption.Each test kit can detect 20 samples.
(2) preparation of test experience material requested and equipment
Wherein 10 × buffer, dNTP, Taq polysaccharase provide by by Shanghai Sheng Gong company; Primer mixture is that the sequence of designed, designed is supplied to the synthesis of Beijing Ying Jun biotech company; Positive reference substance, negative controls and ddH
2o is prepared voluntarily by us.The equipment PCR instrument of experiment, electrophoresis equipment, gel imaging instrument ,-20 DEG C of refrigerators, supercentrifuge, micropipet and 0.2mlPCR thin-walled tubes.
the use specific examples of PCR kit
the process of testing sample.Extract genome if had ready conditions also passable, in order to save time and consumptive material, directly can get 500 μ l bacterium liquid, centrifugal rear use 500 μ lddH
2o is resuspended, and 100 DEG C are boiled 10 minutes, then the centrifugal 10min of 12000rpm, and getting middle layer supernatant is template.
the reagent 20 μ l getting PCR kit, in PCR pipe, adds 5 μ l templates.
pCR reaction conditions is as follows:
the agarose gel electrophoresis detection experiment result of 1.2%.
the analysis of result and record.
Conclusion: carry out specific detection with these primer pair Cronobacter sakazakii kind bacterial strain close to other, finds primer specific.Carry out specific detection between bacterial classification in being belonged to by these primer pair Cronobacter sakazakii, the results are shown in accompanying drawing.Bacterial strain used in experiment is in table 2.
The bacterial strain that table 2 specific detection is used
| Strain name | Serotype | Source |
| Cronobacter pulveris | O5 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O1 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O2 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O3 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O4 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O5 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O6 | American Type Culture Collection (ATCC), USA |
| Cronobacter sakazakii | O7 | American Type Culture Collection (ATCC), USA |
| Cronobacter dublinensis | O1 | Czech Collection of Microorganisms (CCM), Czech Republic. |
| Cronobacter dublinensis | O2 | Czech Collection of Microorganisms (CCM), Czech Republic. |
| Cronobacter turicensis | O2 | Chinese Academy of Inspection and Quarantine, Beijing ,China. |
| Cronobacter turicensis | O3 | Chinese Academy of Inspection and Quarantine, Beijing ,China. |
| Cronobacter muytjensii | O2 | American Type Culture Collection (ATCC), USA |
| Cronobacter malonaticus | O1 | Chinese Academy of Inspection and Quarantine, Beijing ,China. |
| Enterobacter cloacae | O7 | Isolated by our own lab |
| Escherichia coli | O157 | Tianjin Key Laboratory of Microbial Functional Genomics |
| Salmonella | O52 | Tianjin Key Laboratory of Microbial Functional Genomics |
| vibrio cholerae | O37 | Tianjin Key Laboratory of Microbial Functional Genomics |
| Serratia marcescens | Nothing | Tianjin Key Laboratory of Microbial Functional Genomics |
SEQUENCELISTING
<110> Nankai University
<120> Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof
<160>12
<170>PatentInversion3.5
<210>1
<211>19
<212>DNA
<213> artificial sequence
<400>1
gaagcggcagattcattta19
<210>2
<211>19
<212>DNA
<213> artificial sequence
<400>2
ttccgtcggtatccacatt19
<210>3
<211>19
<212>DNA
<213> artificial sequence
<400>3
tttcatctgagccgttact19
<210>4
<211>18
<212>DNA
<213> artificial sequence
<400>4
gacgataggcattccaag18
<210>5
<211>18
<212>DNA
<213> artificial sequence
<400>5
actgcggcaaataaccac18
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
cacaggcaataacaagaaaa20
<210>7
<211>18
<212>DNA
<213> artificial sequence
<400>7
ttaataaacggcgtcagg18
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
acagagcgagcaaaatacac20
<210>9
<211>20
<212>DNA
<213> artificial sequence
<400>9
gcgttatggtttctattcaa20
<210>10
<211>21
<212>DNA
<213> artificial sequence
<400>10
attttggcaactatctactga21
<210>11
<211>20
<212>DNA
<213> artificial sequence
<400>11
ccttggtagattcggtacta20
<210>12
<211>18
<212>DNA
<213> artificial sequence
<400>12
tattccacatcccatcct18
Claims (4)
1. a Nucleotide special to Cronobacter sakazakii O antigen gene, is characterized in that described Nucleotide is SEQIDNO:1, the Nucleotide shown in 2.
2. a PCR kit, comprises
10mMdNTP30 μ L; 10 × enzyme spcificity reaction buffer 50 μ L;
5U/ μ L hot resistant DNA polymerase 5 μ L; 10 μMs of each 10 μ l of PCR primer;
Positive reference substance 10 μ L, negative controls 10 μ L;
ddH
2O5mL；
Described PCR primer is respectively as shown in SEQIDNO:1,2 in claim 1.
3. the application of Nucleotide in the PCR kit for the preparation of detection Cronobacter sakazakii special to Cronobacter sakazakii O antigen gene described in claim 1.
4. application according to claim 3, is characterized in that primer in described PCR kit is respectively as shown in SEQIDNO:1,2; The method that wherein said PCR kit detects Cronobacter sakazakii is further comprising the steps of:
1) get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 5:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
2) mixed solution is splined on the sepharose of 1.2%;
3) by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 10 minutes, contrast with DL2000Marker;
4) observe and record result;
5) analytical results judging.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410150358.2A CN103898227B (en) | 2014-04-16 | 2014-04-16 | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof |
| CN201510233954.1A CN104862393B (en) | 2014-04-16 | 2014-04-16 | A kind of nucleotides and its application to Cronobacter sakazakii O antigen-specifics |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410150358.2A CN103898227B (en) | 2014-04-16 | 2014-04-16 | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510233954.1A Division CN104862393B (en) | 2014-04-16 | 2014-04-16 | A kind of nucleotides and its application to Cronobacter sakazakii O antigen-specifics |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898227A CN103898227A (en) | 2014-07-02 |
| CN103898227B true CN103898227B (en) | 2015-12-02 |
Family
ID=50989792
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510233954.1A Active CN104862393B (en) | 2014-04-16 | 2014-04-16 | A kind of nucleotides and its application to Cronobacter sakazakii O antigen-specifics |
| CN201410150358.2A Active CN103898227B (en) | 2014-04-16 | 2014-04-16 | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510233954.1A Active CN104862393B (en) | 2014-04-16 | 2014-04-16 | A kind of nucleotides and its application to Cronobacter sakazakii O antigen-specifics |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN104862393B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593487B (en) * | 2014-12-15 | 2017-06-27 | 合肥工业大学 | It is a kind of to distinguish the PCR RFLP molecular typing methods that Cronobacter sakazakii belongs to not of the same race |
| CN105256028B (en) * | 2015-10-20 | 2018-10-26 | 南开大学 | The nucleotide special to citric acid bacillus 017 and O39 and its application |
| CN105219769B (en) * | 2015-10-20 | 2018-05-15 | 南开大学 | The nucleotide special to citric acid bacillus O6 and O9 and its application |
| CN105256041B (en) * | 2015-11-02 | 2018-10-26 | 南开大学 | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application |
| CN105256042B (en) * | 2015-11-02 | 2018-10-26 | 南开大学 | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application |
| CN105256043B (en) * | 2015-11-02 | 2018-10-26 | 南开大学 | The nucleotide special to aeromonas hydrophila O29, O30, O33 and O35 and application |
| CN105255871B (en) * | 2015-11-02 | 2018-10-26 | 南开大学 | The nucleotide special to aeromonas hydrophila O7, O8, O9 and O10 and application |
| CN105331693B (en) * | 2015-11-03 | 2019-05-14 | 南开大学 | To the gene liquid chip and detection method of 8 kinds of O antigens genotypings of Plesiomonas shigelloides |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154270A (en) * | 2011-01-11 | 2011-08-17 | 天津生物芯片技术有限责任公司 | Cronobacter sakazakii O antigen specific nucleotides and use thereof |
| CN103243171A (en) * | 2013-05-29 | 2013-08-14 | 光明乳业股份有限公司 | Method for detecting cronobacter sakazakii as well as kit and primer thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012174119A2 (en) * | 2011-06-17 | 2012-12-20 | Life Technologies Corporation | Compositions and methods for detection of cronobacter spp. and cronobacter species and strains |
-
2014
- 2014-04-16 CN CN201510233954.1A patent/CN104862393B/en active Active
- 2014-04-16 CN CN201410150358.2A patent/CN103898227B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154270A (en) * | 2011-01-11 | 2011-08-17 | 天津生物芯片技术有限责任公司 | Cronobacter sakazakii O antigen specific nucleotides and use thereof |
| CN103243171A (en) * | 2013-05-29 | 2013-08-14 | 光明乳业股份有限公司 | Method for detecting cronobacter sakazakii as well as kit and primer thereof |
Non-Patent Citations (2)
| Title |
|---|
| Identification and Characterization of Five New Molecular Serogroups of Cronobacter spp.;Karen G. Jarvis, et al;《FOODBORNE PATHOGENS AND DISEASE》;20131231;第10卷(第4期);343-352 * |
| Structure and genetics of the O-antigen of Cronobacter turicensis G3882 from a new serotype, C. turicensis O2, and identification of a serotype-specific gene;Yamin Sun,et al;《FEMS Immunol Med Microbiol》;20120821;第66卷;323-333 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104862393A (en) | 2015-08-26 |
| CN104862393B (en) | 2017-08-25 |
| CN103898227A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN105695560A (en) | Method for identifying Bifidobacterium lactis in infant formula milk powder | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN111621578A (en) | RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method | |
| CN104611433B (en) | Target genes for detecting salmonella paratyphi, PCR primer pair as well as detection method and applications thereof | |
| CN105256042B (en) | The nucleotide special to aeromonas hydrophila O13, O36, O16 and O19 and application | |
| CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application | |
| CN102337261A (en) | Neisseria meningitidis antigen-specific nucleotide and application thereof | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
| CN105112406A (en) | Nucleotides specific to Hafnia alveibifermentans G58097, G5898 and G5900 and their application | |
| CN105177133B (en) | The nucleotide special to comma bacillus O6, O4, O7 and O15 and its application | |
| CN105087569B (en) | To vibrio cholerae O 18, O19, O23 and the special nucleotides of O12 and its application | |
| CN105256043B (en) | The nucleotide special to aeromonas hydrophila O29, O30, O33 and O35 and application | |
| CN105255871B (en) | The nucleotide special to aeromonas hydrophila O7, O8, O9 and O10 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |