CN105154439A - Nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, and application of nucleotide - Google Patents
Nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, and application of nucleotide Download PDFInfo
- Publication number
- CN105154439A CN105154439A CN201510473545.9A CN201510473545A CN105154439A CN 105154439 A CN105154439 A CN 105154439A CN 201510473545 A CN201510473545 A CN 201510473545A CN 105154439 A CN105154439 A CN 105154439A
- Authority
- CN
- China
- Prior art keywords
- nucleotide
- hafnia alvei
- alvei
- primer
- special
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to a nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, and an application of the nucleotide. The nucleotide comprises one of nucleotides shown in SEQ ID NO:1-8. The nucleotides can be used for preparing a PCR kit and a gene chip for detecting hafinia alvei. The invention provides the nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, as well as the PCR kit and the gene chip comprising the nucleotide. The technology has the advantages of simple and convenient operation method, short detection cycle, low detection cost, high accuracy and high sensitivity, and is suitable for industrial production.
Description
Technical field
The present invention relates to hafnia alvei G5902, the Nucleotide that G5903, G5904, G5906 are special, particularly relate to hafnia alvei G5902, the Nucleotide that in the O antigen gene cluster of G5903, G5904, G5906, individual gene is special and application thereof.
Background technology
Hafnia alvei (Hafniaalvei) is the one in enterobacteriaceae, and thalline is direct rod shape, without pod membrane, active, amphimicrobian, has breathing and the metabolic way of two types of fermenting, at human airway, enteron aisle, be comparatively common in the foods such as animal intestinal and meat milk preparation.Hafnia alvei is a kind of conditioned pathogen, this bacterium can cause microbemia in the crowd of hypoimmunity, respiratory tract infection, urinary tract infections and other infection, it may have certain relation with gastroenteritis, in addition, muco-enteritis and the hepatosplenomegaly of laying hen can also be caused, the Animal diseases such as Epizootic septicemia in Bulgarian rainbow trout.
Typing of bacteria and authentication method mainly contain traditional phenotypic approach, serological method and molecular assay method.But along with molecular biological development, traditional serotype and authentication method also exist certain problem, diagnostic method as this in serotype needs a large amount of antiserum(antisera)s, and antiserum(antisera) general classes is incomplete, quantity not sufficient, a large amount of antiserum(antisera)s is in preparation and also there are some difficulties in storing.On the other hand serotype method length consuming time, sensitivity is low, loss is high, poor accuracy, often there is cross reaction between the antiserum(antisera) that different O antigen produces.Therefore, the serological diagnosis method set up based on Protocols in Molecular Biology becomes developing direction.
The surface antigen of hafnia alvei, existing O antigen also has H antigen, but mainly carries out somatotype with O antigen, and the research of O antigen is more thorough.Determine that the formal serotype scheme of hafnia alvei studies a laboratory proposition of the plum Qi Nikefu institute of vaccine and serum by Moscow, Russia at present, confirmed 39 O and 36 H type.This sorting technique is the prefered method of epidemiology relation between research bacterial strain always, and in comparison from particularly useful in the bacterial strain of the local different time of difference.Also be more and more subject to people's attention for its Molecular Identification, it is fast and be easy to the extensive advantage used that molecular Biological Detection technology has speed, is the developing direction of the pathogenic microbes detect of generally acknowledging in the world at present.
In recent years, increasing molecular engineering is used for the somatotype of pathogenic bacteria, qualification, detection and disease screening, comprises transcribed spacer (ITS) sequential analysis, random amplification length polymorphism (RAPD) is analyzed, rDNA restriction fragment length polymorphism (RFLP) is analyzed.Molecular biology method not only can be used for the rapid serum somatotype examination of hafnia alvei, and stable qualification result can make up the deficiency of phenotypic characteristic authentication method.Compare with traditional sensing techniques, these are based on the molecular detection technology of polymerase chain reaction (PCR), do not need the process such as separation, pure culture through pathogenic bacteria, and have the advantages such as quick, sensitive, high specificity.
Polymerase chain reaction technology (Polymerasechainreaction, be called for short round pcr) admitted at present as microorganism detection technology and promoted, this technology has relative to traditional method that high-throughput, detection speed are fast, high specificity, sensitivity advantages of higher, only need simply increase bacterium process to sample, again by the centrifugal and detailed bacterium DNA profiling of cracking, just can to increase target sequence in the PCR process under the mediation of high specific primer, reach the object detected in sample whether containing invasive organism to be measured.The amplification procedure of PCR only needs 1.5 hours.This greatly improves working speed beyond doubt to inspection and quarantine department and Clinical Laboratory, also reduces job costs simultaneously.
Summary of the invention
The object of the present invention is to provide and the present invention relates to hafnia alvei G5902, the Nucleotide that G5903, G5904, G5906 are special, it is characterized in that described Nucleotide has:
1) one in the Nucleotide shown in SEQIDNO:1-8;
2) with the one in the Nucleotide of the nucleotide complementary shown in SEQIDNO:1-8; Described SEQIDNO:1-8 is as follows:
Present invention also offers a kind of PCR kit, comprise PCR primer, dNTP, damping fluid and archaeal dna polymerase, described PCR primer is the one in the Nucleotide such as shown in SEQIDNO:1-8.Described test kit, also comprises following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; The upstream and downstream primer that each reference culture of mix primer 10 μ l(is special, odd number is upstream primer, and even numbers is downstream primer G5902 is SEQIDNO:1-2; G5903 is SEQIDNO:3-4; G5904 is SEQIDNO:5-6; G5906 is SEQIDNO:7-8); Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o5ml.
Wherein said PCR primer is preferably the one in described Nucleotide as shown in SEQIDNO:1-8.
The present invention further discloses hafnia alvei G5902, the special SEQIDNO:1-8 Nucleotide of G5903, G5904, G5906 for the preparation of this bacterium different strains G5902, the PCR kit of G5903, G5904, G5906.
Hafnia alvei of the present invention refers to and samples in the crude extract of clinical samples culture or the crude extracts of the pure growth of hafnia alvei such as septicemia, urinary tract infection, wound infections.Collecting hafnia alvei and extracting genome is adopt ordinary method to prepare.
For the PCR kit of hafnia alvei, whole detecting step comprises sample pretreatment-amplification-electrophoresis detection result.Primer and the reagent required for PCR reaction system add in amplification pipe in advance, and pretreated sample only need be added amplification pipe by user, and start amplified reaction, simple and quick completes testing.
The present invention also provides a kind of Liquid Detection chip, comprises liquid phase magnetic bead and is connected to the oligonucleotide probe on liquid phase magnetic bead, and the corresponding primer corresponding to the fragment of correspondent probe place; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-8.
The present invention also provides a kind of micro-array, and it comprises above-mentioned Nucleotide; Wherein said Nucleotide is preferably the Nucleotide as shown in SEQIDNO:1-8.
The present invention further discloses hafnia alvei G5902, G5903, the application of Nucleotide in the gene chip for the preparation of detection hafnia alvei PCR kit, detection hafnia alvei, in detection hafnia alvei microarray that G5904, G5906 are special.Described detection hafnia alvei refers to detection and causes bronchitis, pneumonia, urinary tract infections, the bacterium of wound infection and septicemia.
Disclosed by the invention to hafnia alvei G5902, compared with prior art, tool of the present invention has the following advantages the special Nucleotide of G5903, G5904, G5906:
(1) practical
A kind of PCR reaction system that the present invention sets up, can detect hafnia alvei, provides the special primer used by serotype detection, utilizes this PCR method can detect clinical samples.
(2) accuracy is high
The present invention passes through the PCR reaction to the special gene of each serotype of hafnia alvei, and each sample obtains the band of an entry, will obtain object fragment compared with known length, and just can obtain strain number corresponding to hafnia alvei.
(3) testing cost is relatively low
The fields such as Food Hygiene Surveillance, environmental monitoring, the quarantine of commodity supervision and inspection can be applied to, and provide technology mode for other different pathogenic microbes detects combine.
Accompanying drawing illustrates:
Fig. 1 represents that G5902 special primer of the present invention detects hafnia alvei and other reference cultures electrophoresis result figure,
wzygene P1 and P2 object band are 235bp, and remaining bacterial strain is without any band, and concrete bacterial strain information is in table 2;
Fig. 2 represents the species specific qualification electrophoresis result figure of G5902 special primer of the present invention, and wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 3 represents G5903's of the present invention
wzygene P3 and P4 primer detect hafnia alvei and other reference cultures electrophoresis result figure, and object band is 240bp, and concrete bacterial strain information is in table 2;
Fig. 4 represents wzy gene P3 and the species specific qualification electrophoresis result figure of P4 primer of this G5903, and wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in Table;
Fig. 5 represents this G5904's
wzygene P5 and P6 primer detect hafnia alvei and other reference cultures electrophoresis result figure, and object band is 233bp, and remaining bacterial strain is without any band, and concrete bacterial strain information is in table 2;
Fig. 6 represents G5904's of the present invention
wzygene P5 and the species specific qualification electrophoresis result figure of P6 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 7 represents this G5906's
wzygene P5 and P6 primer detect hafnia alvei and other reference cultures electrophoresis result figure, and object band is 286bp, and remaining bacterial strain is without any band, and concrete bacterial strain information is in table 2;
Fig. 8 represents G5906's of the present invention
wzygene P5 and the species specific qualification electrophoresis result figure of P6 primer, wherein have detected 6 strain vibrios and 1 strain salmonella, 1 strain intestinal bacteria, all without any band, concrete bacterial strain information is in table 2;
Fig. 9 represents and uses hafnia alvei G5902 respectively, the electrophoresis result figure of the corresponding serotype of G5903, G5904, G5906 specific primers amplify, and concrete bacterial strain information is in table 2;
Wherein: hafnia alvei G5902, G5903, G5904, G5906 represent corresponding serotype primer amplification result, and first swimming lane is 2000bpDNAmarker or 1kbplusDL.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments should be understood only be not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition as people such as Sambrook, molecular cloning: the condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989).Wherein hafnia alvei derives from Warsaw, POL (PCM, PolishCollectionofMicroorganismsatIITDPAN, Wroclaw).
embodiment 1: genomic extraction
37 DEG C of nutrient broth mediums cultivate hafnia alvei, collect bacterium, extract genome concrete steps as follows:
With 500ul50mMTris-HCl (pH8.0) and 10ul0.4MEDTA re-suspended cell, 37 DEG C of incubations 20 minutes, the N,O-Diacetylmuramidase then adding 10ul10mg/ml continues insulation 20 minutes.Add the Proteinase K of 3ul20mg/ml, 15ul10%SDS afterwards, 50 DEG C of incubations 2 hours, then add the RNase of 3ul10mg/ml, 65 DEG C of incubations 30 minutes.Add the extracting of equal-volume phenol, get supernatant liquor, then use isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) solution extracting twice, get supernatant liquor, then with isopyknic ether extraction to remove remaining phenol.Supernatant liquor 2 times of volume ethanol precipitation DNA, roll out DNA with glass yarn and wash DNA with 70% ethanol, being finally resuspended in 30ulTE by DNA.Genomic dna is detected by the agarose gel electrophoresis of 0.4%.
embodiment 2:sequence is decoded
Extract hafnia alvei G5902, G5903, G5904, the genome of G5906 reference culture, by Solexapair-end sequencing technologies, the sequence that genome sequencing obtains this O serotype is carried out to each standard gene group of hafnia alvei, Blast and PSI-Blast is used to carry out sequence alignment, TMHMMServer2.0program is adopted to carry out transmembrane structure prediction, ClustalWprogram is used to carry out sequence alignment and screen conservative and specific gene fragment, final O antigen gene cluster sequence and the decoding result obtaining each serotype of hafnia alvei.
embodiment 3: design of primers
Decode situation according to gene cluster and build storehouse comparison result, finding that wzy and wzx gene is the gene of hafnia alvei O antigen-specific, so choose this gene specific section design special primer.Because wzy is more special, thus main with wzy gene for target gene.
Design of primers is the core of this invention.Design primer designs according to the specific gene described in document.These two genes of wzx and wzy are genes more special in hafnia alvei O antigen gene cluster, can as the target gene of Serotype Identification.Said gene is imported PrimerPremier5 and carry out design of primers, the length of primer is preferably between 18 ~ 24bp, and Tm value is at 53 ~ 58 DEG C.Each gene design pair of primers, has single purpose band.
In Genbank, BLAST is carried out after design of primers, the primer of design can not be too high with the sequence similarity of other nearly edge bacterium, so just can guarantee that this primer only increases in the predetermined position of oneself, and not produce positive reaction with the nearly edge bacterium in the environment of other nearly edge bacterium or collect specimen.This point is very important for the success or failure of the generation and experiment of avoiding non-specific band.
The primer designed is as shown in table 1.
Table 1 is for the primer sequence of PCR
embodiment 4: the screening of special primer
Have collected hafnia alvei G5902, G5903, G5904, the reference culture of G5906 comprises: 6 strain Vibrios, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source provide hafnia alvei entry and exit electronic edition to prove in table 2. simultaneously, and file papery of affixing one's seal version is in Tianjin board of health, use when examining, see other supporting documentss:
Table 2 is for the bacterial strain of specific detection
The PCR system that gene identification primer screening is used be 5 μMs of primer 0.4 μ l, 10 × enzyme spcificity reaction buffer 2.5 μ l, 10mMdNTP0.25 μ l, 5U/ μ l hot resistant DNA polymerase 0.2 μ l and 3 μ l testing sample template in the thin-walled PCR pipe of 0.2ml, last ddH
2o supplies 25 μ l.All primers all obtain positive findings in bacterial strain corresponding separately, do not obtain any PCR primer band in other groups.
Reaction cycle parameter in PCR instrument in this step comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 53 DEG C/58 DEG C, 45 seconds;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes
Wherein, G5902, G5903, G5904, G5906 use 53-6 DEG C of amplification, and above-mentioned steps is electrophoresis amplified production in electrophoresis equipment, and the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 1:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 30 minutes, contrast with DL2000Marker;
observe and record result.
Substantially terminated by the work of primer screening after basic PC R reaction, necessary length adjustment is little on the impact of W-response condition, and the primer sequence used in the present invention is all summed up in Table 1.
Table 1 is for the primer sequence of PCR
the preparations and applicatio of embodiment 6:PCR detection kit
1, the composition of PCR kit:
dNTP(10mM)30μl；
10 × Buffer (10 × enzyme spcificity reaction buffer) 50 μ l;
Taq polysaccharase (5U/ μ l hot resistant DNA polymerase) 5 μ l;
PCR primer (5 μMs)
sEQID-NO:1-810 μ l;
Positive reference substance (KP) 10 μ l;
Negative controls (KN) 10 μ l;
ddH
2O5ml；
Each test kit can be used for detection 10 samples.
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by precious biotechnology company limited; Primer is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH
2o is prepared voluntarily by us.
2, plant and instrument
Wherein 10 × Buffer, dNTP, Taq polysaccharase are provided by the raw work in Shanghai; Primer is that the sequence of designed, designed is supplied to the synthesis of Shanghai Ying Jun biotech company; Positive reference substance, negative controls and ddH2O are prepared voluntarily by us.The equipment PCR instrument (having another name called DNA thermal cycling amplification instrument) of experiment, electrophoresis equipment (comprising electrophoresis apparatus and electrophoresis chamber), gel imaging instrument ,-20 DEG C of refrigerators, supercentrifuge, micropipet and 0.2mlPCR thin-walled tubes.
3, the use specific examples of PCR kit
The PCR detection method using above-mentioned PCR kit to detect hafnia alvei comprises the steps:
(1) environmental sample template to be measured is extracted;
(2) add in PCR thin-walled tube, dNTP, 10 × Buffer, Taq polysaccharase, primer, testing sample template and ddH
2o mixes;
(3) by increasing in PCR instrument of mixing in thin-walled PCR pipe;
(4) electrophoresis amplified production in electrophoresis equipment, record result;
(5) analyze and carry out result judgement.
Environmental sample template in above-mentioned steps (1) is sample the crude extract in clinical samples hafnia alvei cultures such as septicemia, urinary tract infection, wound infections, the crude extract of the pure growth of hafnia alvei or pure dna, or positive reference substance and negative controls.
The extracting method of the environmental sample template in above-mentioned steps (1) is:
get 1.5ml culture, under 12000rpm condition centrifugal 1 minute, remove supernatant liquor;
get the ddH of 500 μ l
2the resuspended precipitation of O, under 8000rpm condition centrifugal 5 minutes, removes supernatant liquor, dries;
get 100 μ lddH
2the resuspended precipitation of O, water-bath 10 minutes in 100 DEG C of boiling water;
be placed on ice after 10 minutes again, under 12000rpm condition centrifugal 2 minutes;
5. 3 μ l middle layer supernatant are got as pcr template
Reaction cycle parameter in PCR instrument in above-mentioned steps (3) comprises the sex change of DNA, renaturation, the temperature and time of extension, cycle index, is specially:
Early stage for enable sex change reach required temperature and required early stage treating processes a circulation be 95 DEG C, 5 minutes;
Denaturation temperature and time are 95 DEG C, 45 seconds;
Renaturation temperature and time is 53 DEG C/58 DEG C, 1 minute;
Elongating temperature and time are 72 DEG C, 1 minute;
The cycle index of sex change, renaturation, extension is 35 circulations;
For stable amplified production and carry out one circulation temperature and time be 72 DEG C, 5 minutes.
Above-mentioned steps (4) electrophoresis amplified production in electrophoresis equipment, the concrete steps of record result are:
get 2 ~ 5 μ l amplified productions to mix with the volume ratio of 5:1 with 6 × tetrabromophenol sulfonphthalein sample-loading buffer;
mixed solution is splined on the sepharose of 1.0%;
by agarose gel electrophoresis 120v voltage stabilizing electrophoresis about 30 minutes, contrast with DL2000Marker;
observe and record result.
The present invention by configuration a kind of detect hafnia alvei can industrialization produce PCR kit, PCR detection method is needed the combination of components of use together, during use, extract testing sample, just quick, sensitive, easy detection can be carried out through comparatively simple operation sequence simultaneously, in test kit, the consumption of each component and concentration are test gained, and detect with this test kit the testing installation that hafnia alvei uses simple, testing cost is low.
Use object that is positive and negative controls to be for the whole operating process of Quality Control, judge accurately to draw.If containing hafnia alvei object Strain type, then can observe the band with positive reference substance same position from electrophoresis result; If not containing hafnia alvei object Strain type, then the same with negative controls do not have this band.
The amount of reagent that one-time detection of the present invention is tested in the test kit used sees the following form shown in 3, and DNA profiling amount is 3 μ l
Table 3 one-time detection tests the amount of reagent in the test kit used
Hot resistant DNA polymerase in the present invention is Taq enzyme.
Above-mentioned positive reference substance is determined it is the sample of hafnia alvei reference culture, and negative controls is then for determining it is not the sample of hafnia alvei through laboratory.
This PCR kit bacteria suspension of hafnia alvei carries out pcr amplification, with consistent as template acquired results through extracting the DNA obtained.Susceptibility and specificity indifference, like this, can save the extraction step of template DNA, working method is simplified.Meanwhile, compare routine biochemistry detection method, the testing sample that present method adopts can be directly clinical sample nutrient solution, or to detection sample carry out simple separation cultivate just can detect, thus save manpower and materials.
4, the providing of testing sample
Have collected hafnia alvei G5902, G5903, G5904, G5906 reference culture, and 6 other bacterial strains of strain Vibrio, the specificity of 1 strain Salmonella strain and 1 strain coli strain checking primer, strain number and source are in table 2.
The above, only operation of the present invention and implementation method, not any pro forma restriction is done to the present invention, every above embodiment is done according to technical spirit of the present invention any simple modification, equivalent variations and modification, all still belong in the scope of technical solution of the present invention.
SEQUENCELISTING
<110> Nankai University
<120> to hafnia alvei G5902, the Nucleotide that G5903, G5904, G5906 are special and application thereof
<160>8
<170>PatentInversion3.5
<210>1
<211>25
<212>DNA
<213> artificial sequence
<400>1
atgatagacccatacaaattttaag25
<210>2
<211>16
<212>DNA
<213> artificial sequence
<400>2
actcagcccgcacgtt16
<210>3
<211>25
<212>DNA
<213> artificial sequence
<400>3
ttaatcttgtgctatgtcttttatg25
<210>4
<211>18
<212>DNA
<213> artificial sequence
<400>4
gccaatcgcgctatacaa18
<210>5
<211>21
<212>DNA
<213> artificial sequence
<400>5
tgagaagttgactcctatgcc21
<210>6
<211>26
<212>DNA
<213> artificial sequence
<400>6
ttttgttctctatgattgtacaatct26
<210>7
<211>19
<212>DNA
<213> artificial sequence
<400>7
aggaaatcctggggaaatt19
<210>8
<211>18
<212>DNA
<213> artificial sequence
<400>8
cgtagcgcttaatgtggg18
Claims (6)
1. couple hafnia alvei G5902, the Nucleotide that G5903, G5904, G5906 are special, is characterized in that described Nucleotide has: the one in the Nucleotide shown in SEQIDNO:1-8.
2. according to claim 1 to hafnia alvei G5902, G5903, G5904, the Nucleotide that G5906 is special, wherein above-mentioned Nucleotide may be used for preparation detection hafnia alvei G5902, G5903, G5904, G5906 PCR kit, gene chip or microarray; Wherein said hafnia alvei refers to and samples in the crude extract of clinical samples culture or the crude extracts of the pure growth of hafnia alvei such as septicemia, urinary tract infection, wound infections.
3. one kind according to claim 1 to hafnia alvei G5902, the PCR kit of the Nucleotide that G5903, G5904, G5906 are special, comprise PCR primer, dNTP, damping fluid and archaeal dna polymerase, described PCR primer is the one in the Nucleotide such as shown in SEQIDNO:1-8; Also comprise following reagent: 10mMdNTP30 μ l; 10 × enzyme spcificity reaction buffer 50 μ l; 5U/ μ l hot resistant DNA polymerase 5 μ l; Primer 10 μ l; Positive reference substance 10 μ l; Negative controls 10 μ l; ddH
2o1ml.
4. described in claim 1 to hafnia alvei G5902, the special Nucleotide of G5903, G5904, G5906 for the preparation of detecting hafnia alvei PCR kit, detect application in the gene chip of hafnia alvei.
5. described in claim 1 to hafnia alvei G5902, the special Nucleotide of G5903, G5904, G5906 is for the preparation of the application detected in hafnia alvei microarray.
6. the application described in claim 4-5, wherein said detection hafnia alvei refers to detection and causes bronchitis, pneumonia, urinary tract infections, the bacterium of wound infection and septicemia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510473545.9A CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510473545.9A CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105154439A true CN105154439A (en) | 2015-12-16 |
| CN105154439B CN105154439B (en) | 2019-04-05 |
Family
ID=54795484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510473545.9A Active CN105154439B (en) | 2015-08-04 | 2015-08-04 | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154439B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763753A (en) * | 2020-06-28 | 2020-10-13 | 南开大学 | Detection method for typing of Hafnia alvei PCM1188 serotype O antigen molecules |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040002080A1 (en) * | 2001-12-14 | 2004-01-01 | Creighton University | Primers for use in detecting beta-lactamases |
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| CN101679986A (en) * | 2007-03-26 | 2010-03-24 | 诺维信公司 | hafnia phytase |
| WO2011155859A3 (en) * | 2010-06-11 | 2012-02-23 | Instytut Immunologii i Terapii Doświadczalnej PAN | Polysaccharide and derivatives thereof, showing affinity to ficolin-3, method of preparation and use |
-
2015
- 2015-08-04 CN CN201510473545.9A patent/CN105154439B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040002080A1 (en) * | 2001-12-14 | 2004-01-01 | Creighton University | Primers for use in detecting beta-lactamases |
| CN101679986A (en) * | 2007-03-26 | 2010-03-24 | 诺维信公司 | hafnia phytase |
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| WO2011155859A3 (en) * | 2010-06-11 | 2012-02-23 | Instytut Immunologii i Terapii Doświadczalnej PAN | Polysaccharide and derivatives thereof, showing affinity to ficolin-3, method of preparation and use |
Non-Patent Citations (2)
| Title |
|---|
| CHITRITA ET AL.: "Development of PCR Assays Targeting Genes in O-Antigen Gene Clusters for Detection and Identification of Escherichia coli O45 and O55 Serogroups", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| EWA KATZENELLENBOGEN ET AL.: "Structures of the biological repeating units in the O-chain polysaccharides of Hafnia alvei strains having a typical lipopolysaccharide outer core region", 《FEMS IMMUNOLOGY AND MEDICAL MICROBIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763753A (en) * | 2020-06-28 | 2020-10-13 | 南开大学 | Detection method for typing of Hafnia alvei PCM1188 serotype O antigen molecules |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154439B (en) | 2019-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN104372078B (en) | The HDA primer of C.perfringens and application process thereof in a kind of food | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN110423835A (en) | Primer composition for lower respiratory tract the pathogenic microorganism examination | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN105018486A (en) | HDA kit for detecting bacterial leaf streak pathogens of rice and detecting method | |
| CN105154439A (en) | Nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, and application of nucleotide | |
| CN105154438A (en) | Nucleotide specific to hafinia alvei G5907, G5908, G5913 and G5916, and application of nucleotide | |
| CN105112406A (en) | Nucleotides specific to Hafnia alveibifermentans G58097, G5898 and G5900 and their application | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof | |
| CN105256042A (en) | Nucleotide specific to Aeromonas hydrophila O13, O36, O16 and O19 and application | |
| Jiang et al. | Rapid on-the-spot detection of Edwardsiella piscicida using recombinase polymerase amplification with lateral flow | |
| CN105256028A (en) | Specific nucleotides for citrobacter 017 and 039 and application of special nucleotides | |
| CN105112505A (en) | Nucleotides with specificity on Klebsiella K44, K59, K61, and K63 serotypes, and applications thereof | |
| CN105087569B (en) | To vibrio cholerae O 18, O19, O23 and the special nucleotides of O12 and its application | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| CN105112405A (en) | Nucleotides with specificity on Klebsiella K8, K20, K38, and K39 serotypes, and applications thereof | |
| CN105255871A (en) | Specific nucleotide for aeromonas hydrophila O7, O8, O9 and O10 and application thereof | |
| CN105177133A (en) | Nucleotide specific to vibrio cholerae O6, O4, O7 and O15 and application of nucleotide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |