CN117210593A - Primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and detection method - Google Patents

Abstract

The application discloses a primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and a detection method, belonging to the technical field of biology. The multiple RPA-CRISPR/Cas12a/Cas13a established by the application aims at a plasmid with the lowest detection limit of 3.4 copies of Kmt genes, and aims at a plasmid with the lowest detection limit of 11 copies of LKT genes, and the plasmid has near single copy detection sensitivity when the multiple RPA is combined with the multiple CRISPR-Cas12a/Cas13a to detect Kmt and Lkt genes simultaneously. Therefore, the method for simultaneously detecting the pasteurella multocida and the mannheimia haemolytica by the high-sensitivity multiplex RPA-CRISPR/Cas12a/Cas13a is established, and has high efficiency, accuracy and sensitivity.

Description

Primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and detection method

Technical Field

The application relates to the technical field of biology, in particular to a primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and a detection method.

Background

Pasteurella multocida (Pasteurella multocida) belongs to the genus Pasteurella of the family Pasteurellaceae, and more than 20 bacteria of the genus Pasteurella have been reported, and Pasteurella multocida is the most important pathogenic bacteria of livestock and poultry in the genus Pasteurella. The strain can cause various livestock and poultry pasteurellosis, and is manifested by hemorrhagic septicemia or infectious pneumonia. The bacteria are widely distributed around the world, normally exist in oral and pharyngeal mucous membranes of various healthy animals, and belong to conditional pathogenic bacteria. Pasteurella multocida can infect humans and various animals, cause various infectious diseases of livestock and poultry, such as cholera fowl, swine plague, bovine hemorrhagic septicemia, rabbit hemorrhagic septicemia and the like, and cause serious harm to the breeding industry. According to the Carter typing method and the Heddleston typing method, the pasteurella multocida is divided into 5 capsular serotypes (A, B, D, E, F) and 16 thallus serotypes (1-16) according to different capsular antigens and different lipopolysaccharide antigens, and the pasteurella multocida serotypes are complex, so that the cross protectiveness among the types is not strong, the vaccine prevention and control difficulty is high, and the occurrence and the epidemic of the disease can be effectively prevented only through pathogen monitoring, sanitary disinfection, biosafety and the like.

The haemolytic Mannheimia is a microorganism of the genus Mannheimia, is one of pathogens causing ruminant respiratory disease syndromes (bovine respiratory disease complex, BRD) such as cattle, sheep and the like, and causes diseases when the host resistance is reduced due to stress such as transportation, environment and the like or other pathogen co-infection, and huge losses are caused to cattle farm cultivation due to pathogen invasion into the lung. Although more serotype strains can cause morbidity, the A1, A2 and A6 serotypes predominate in animals worldwide infected with Mannheimia, with the A1 and A6 serotypes primarily affecting cattle and the A2 serotypes primarily affecting sheep.

In recent years, with the development of livestock breeding to the intensive and large-scale direction, respiratory diseases are rapid in onset and strong in infectivity, are one of the most harmful and extensive important common epidemic diseases for the breeding industry, are extremely easy to cause huge economic loss for the breeding industry, and seriously endanger the healthy development of the breeding industry. The main respiratory tract pathogenic bacteria of livestock are various types of haemolytic mannich bacillus, pasteurella multocida, mycoplasma, stellera suppuration, klebsiella pneumoniae and the like, the clinical respiratory tract diseases often occur in a mixed infection mode, and the etiology research of the clinical respiratory tract diseases tends to be specialized and complicated more and more, so that the clinical diagnosis is difficult. The traditional diagnosis means is a method of bacterial culture, but the method is long in time consumption and low in sensitivity, and is difficult to meet the clinical diagnosis requirement, so that the rapid detection of the respiratory disease pathogens of livestock is extremely important. Therefore, a method with high sensitivity and specificity, simple and rapid operation and on-site detection is needed to make up for the defects of the existing method. At present, no respiratory tract pathogenic bacteria detection method which can be suitable for any poultry and is simple, quick and accurate to operate is available.

Disclosure of Invention

The application aims to provide a primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and a detection method thereof, so as to solve the problems in the prior art.

In order to achieve the above object, the present application provides the following solutions:

the application provides a primer for specifically identifying Pasteurella multocida, which comprises an upstream primer shown as SEQ ID NO.22 and a downstream primer shown as SEQ ID NO. 26.

The application also provides a primer for specifically identifying the haemolytic mannich bacillus, which comprises an upstream primer shown as SEQ ID NO.30 and a downstream primer shown as SEQ ID NO. 33.

The application also provides a multiplex RPA amplification primer group, which comprises the primer for specifically identifying the Pasteurella multocida and the primer for specifically identifying the Mannheimia haemolytica.

The application also provides a detection method of the non-disease detection or treatment destination Pasteurella multocida and the hemolytic Mannheimia, which uses the DNA of the sample to be detected as a template, uses the multiple RPA amplification primer group to carry out amplification reaction, carries out Cas12a/Cas13a one-tube digestion reaction on the amplification product, and judges whether the sample to be detected contains the Pasteurella multocida and the hemolytic Mannheimia according to the fluorescent color after the reaction is completed.

Preferably, the performing the Cas12a/Cas13a one-tube digestion reaction on the amplification product is performing one-tube digestion reaction on the amplification product by using a CRISPR-Cas12a/Cas13a system;

the CRISPR-Cas12a/Cas13a system comprises: cas12a protein, cas13a protein, and crRNA;

the Cas12a protein is a Cas12a protein or a Cas protein having a similar bypass single strand DNA cleavage activity to Cas12 a; the Cas13a protein is a Cas13a protein or a Cas protein having a similar bypass single-stranded RNA cleavage activity to Cas13 a; the nucleotide sequences of the crRNA are shown as SEQ ID NO.1 and SEQ ID NO. 2.

Preferably, the fluorescent color is a fluorescent color after the reaction is observed under blue light and ultraviolet excitation.

Preferably, when the liquid is excited to green light, the pasteurella multocida is present in the sample to be tested; when the liquid is excited to red light, the sample to be tested contains the haemolytic mannich bacillus; when the liquid is excited to yellow or red-green-Huang Shi, the pasteurella multocida and the mannheimia haemolytica are simultaneously present in the sample to be tested.

Preferably, the reaction system of the amplification reaction is: 29.5. Mu. L rehydration buffer,25pmol of the multiplex RPA amplification primer set of claim 3, and 5.1. Mu.L nuclease-free water were added to the PCR tubes of the lyophilized reagent particles in the TwitAmp base kit, and the reaction solution was split into two tubes; 1.25. Mu.L of 280mM magnesium acetate (MgOAc) and 2. Mu.L of template were added to each tube;

the reaction conditions are as follows: the reaction was carried out at 39℃for 4min, and after vortexing and mixing, the reaction was carried out at 39℃for 26 min.

Preferably, the reaction system of the one-tube enzyme digestion reaction is as follows: 2. Mu.L of the amplification product, kmt 1-crRNA-20.5. Mu. M, LKT-crRNA-6.5. Mu. M, cas12a 0.25. Mu. M, cas13a 0.25. Mu. M, ssDNA-reporter JOE-6C-BHQ 1.5. Mu. M, ssRNA-reporter ROX-5U-BHQ 2.5. Mu.M, rCutSmart Buffer 2. Mu.L and 0.5. Mu.L of RNase inhibitor, DEPC water was supplemented to 20. Mu.L;

the reaction procedure is: the reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

The application also provides a product for simultaneously detecting the Pasteurella multocida and the Mannheimia haemolytica, which comprises the multiplex RPA amplification primer group and the CRISPR-Cas12a/Cas13a system.

Preferably, the product comprises a reagent or kit.

Based on the technical scheme, the application has the following technical effects:

the multiple RPA-CRISPR/Cas12a/Cas13a established by the application aims at a plasmid with the lowest detection limit of 3.4 copies of Kmt genes, and aims at a plasmid with the lowest detection limit of 11 copies of LKT genes, and the plasmid has near single copy detection sensitivity when the multiple RPA is combined with the multiple CRISPR-Cas12a/Cas13a to detect Kmt and Lkt genes simultaneously. Therefore, the method for simultaneously detecting the pasteurella multocida and the mannheimia haemolytica by the high-sensitivity multiplex RPA-CRISPR/Cas12a/Cas13a is established, and has high efficiency, accuracy and sensitivity.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1A shows the results of PCR detection of target nucleic acids of M.haemolyticus and Pasteurella multocida, wherein F1-2 is M.haemolyticus, S4 is Pasteurella multocida, and FIG. 1B shows the recovery of the gel of LKT and Kmt1 detected, and sequencing by ligation pmd t;

FIG. 2 shows the detection of CRRNA-2 with high activity of Mannheimia haemolytica Kmt1 based on CRISPR/Cas12a, wherein A is the result interpretation with a portable blue light instrument, and B is the quantification of the fluorescence intensity of FIG. A by an enzyme-labeled instrument; -: no identified Kmt DNA target; +: comprising a recognized DNA target; error bars represent Standard Error of Mean (SEM); n=3;

FIG. 3 is a screen of crRNA-6 for detection of high activity of Pasteurella multocida LKT based on CRISPR/Cas13a, wherein A is result interpretation with a portable blue instrument, B is quantification of the fluorescent intensity of panel A by an enzyme-labeled instrument; -: no recognized LKT RNA target; +: comprising a recognized RNA target; error bars represent Standard Error of Mean (SEM); n=3;

FIG. 4 is a graph showing the results of the detection of the RPA binding/CRISPR/Cas 12a on the respective Mannheimia haemolytica Kmt gene and the RPA binding/CRISPR/Cas 13a Pasteurella multocida LKT gene, wherein A is the result of the detection of each Kmt primer combination by a portable blue-ray instrument, and B is the result of the detection of each Lkt primer combination by a portable blue-ray instrument;

FIG. 5 is a graph of the results of simultaneous detection of multiple RPA-binding multiple CRISPR/Cas12a/Cas13a with high sensitivity, wherein A is the result of detection and quantification when the CRISPR/Cas12a detects the Pasteurella multocida Kmt1 gene in the multiple RPA amplified product by using a portable blue light instrument, B is the result of detection and quantification when the CRISPR/Cas12a detects the Pasteurella multocida Kmt1 gene in the multiple RPA amplified product by using an enzyme-labeled instrument, C is the result of detection and quantification when the CRISPR/Cas12a detects the Pasteurella multocida LKT gene in the multiple RPA amplified product by using a portable blue light instrument, D is the result of detection and quantification by using an enzyme-labeled instrument, when detecting the pasteurella multocida LKT gene in the multiplex RPA amplification product, detecting and quantifying the result, E, H is a plasmid with the lowest detection limit of 3.4 copies of the multiplex RPA binding CRISPR/Cas12a aiming at Kmt gene, F, I is a plasmid with the lowest detection limit of 11 copies of the multiplex RPA binding CRISPR/Cas13a aiming at the LKT gene, G is a portable blue-light instrument, kmt1 and Lkt genes are detected at the same time when the multiplex RPA binding multiplex CRISPR-Cas12a/Cas13a is used for detecting and quantifying the result, J is an enzyme-labeled instrument, kmt1 and Lkt genes are detected at the same time when the multiplex RPA binding multiplex CRISPR-Cas12a/Cas13a is used for detecting and quantifying the result;

fig. 6 is a graph of detection results of clinical samples, wherein a is a pattern diagram of a multiple RPA-CRISPR/Cas12a/Cas13a detection method, B is detection by a portable blue-light instrument, detection results of 18 samples by the multiple RPA-CRISPR/Cas12a/Cas13a detection method are interpreted, and C is quantification of fluorescence intensity of fig. B by an enzyme-labeled instrument; -: no recognized LKT RNA target; +: comprising a recognized RNA target; error bars represent Standard Error of Mean (SEM); n=3;

FIG. 7 is a multiplex RPA-CRISPR/Cas12a/Cas13a detection result of suspected infected sheep sample DNA, PCR verification is performed, wherein A is the case of PCR verification of the LKT gene; b is the case of PCR verification of Kmt1 gene.

Detailed Description

Various exemplary embodiments of the application will now be described in detail, which should not be considered as limiting the application, but rather as more detailed descriptions of certain aspects, features and embodiments of the application.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the application. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present application. The specification and examples of the present application are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The technical scheme of the application is conventional in the field, and the reagents or raw materials are purchased from commercial sources or are disclosed.

EXAMPLE 1PCR detection of Pasteurella multocida Kmt target Gene and Mankt Gene of Mannheimia haemolytica

PCR primers Kmt1-F, kmt1-R and LKT-F, LKT-R (see Table 1) were designed to amplify the Pasteurella multocida Kmt1 target gene and the Mankt gene, target gene fragment, respectively.

TABLE 1 primer set for PCR primer template amplification

Primer name	Primer sequence (5 '-3')
		Kmt1-F	ATCCGCTATTTACCCAGTGG
Kmt1-R	GCTGTAAACGAACTCGCCAC
		LKT-F	GCAGGAGGTGATTATTAAAGTGG
LKT-R	CAGCAGTTATTGTCATACCTGAAC

mu.L of a PCR reaction solution was prepared, and 1. Mu.L (about 100 ng) of the genomic template was added to 10pmoL of each of the above-mentioned primers at the upstream and downstream of 25. Mu.L of Ex taq Mix.

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃. The PCR products were run on agarose gel at 1.5% concentration for identification and recovery.

The detection results are shown as A in FIG. 1, and the primers designed and detected can be used for detecting Pasteurella multocida and Mannheimia haemolytica respectively, wherein F1-2 is Mannheimia haemolytica and S4 is Pasteurella multocida; the detected LKT and Kmt1 were separately gel recovered as in fig. 1B and ligated into pmd19t plasmid for subsequent experiments.

Example 2 screening for crrnas with high activity against CRISPR/Cas12 a-based detection Kmt1

For PCR amplification of the Kmt gene region, 6 crRNAs were designed using CRISPR-offinder software (https:// sourceforge. Net/subjects/CRISPR-offinder-v 1-2 /), PAM being TTTV:

Kmt1-crRNA1：TTTATGCCACTTGAAATGGGAAAT；

Kmt1-crRNA2：TTTATGGCTCGTTGTGAGTGGGCT；

Kmt1-crRNA3：TTTATTTGGCTTGTGGCAAAGAAA；

Kmt1-crRNA4：TTTGTTGGGCGGAGTTTGGTGTGT；

Kmt1-crRNA5：TTTGCCACAAGCCAAATAAAAGAC；

Kmt1-crRNA6：TTTCCCATTTCAAGTGGCATAAAA。

primer pairs for in vitro transcription were designed using the sgRNA empty vector (pUC 57-T7-sgRNA) as template (see Table 2). The experimental procedure for detecting nucleic acids using CRISP-Cas12a is as follows:

TABLE 2 primer pairs and probes for in vitro transcription template amplification of Kmt1-crRNA

Primer name	Primer sequence (5 '-3')
		T7-crRNA-F	TAATACGACTCACTATAGG
Kmt1-crRNA-1R	ATTTCCCATTTCAAGTGGCAATCTACAATAGTAGAAAT
		Kmt1-crRNA-2R	AGCCCACTCACAACGAGCCAATCTACAATAGTAGAAAT
Kmt1-crRNA-3R	TTTCTTTGCCACAAGCCAAAATCTACAATAGTAGAAAT
		Kmt1-crRNA-4R	ACACACCAAACTCCGCCCAAATCTACAATAGTAGAAAT
Kmt1-crRNA-5R	GTCTTTTATTTGGCTTGTGGATCTACAATAGTAGAAAT
		Kmt1-crRNA-6R	TTTTATGCCACTTGAAATGGATCTACAATAGTAGAAAT
JOE-6C-BHQ1	5’-JOE/CCCCCC/3’BHQ1

(1) PCR amplification of target gene fragment:

mu.L of PCR reaction solution was prepared, in which 10pmoL of each of the Extaq Mix 25. Mu.L, the pMD18T-Kmt1 plasmid template 1. Mu.L (about 10 ng) was used as Kmt-F and Kmt-R primers.

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃.

(2) In vitro transcription of crRNA: templates for in vitro transcription of sgrnas were amplified using PCR techniques with T7-crRNA-F and different crRNA-R primers (see table 2) using a plasmid containing T7promoter and crRNA scafold (pUC 57-T7-crRNA) as templates.

The experimental reaction system was 50. Mu.L, in which the Extaq Mix was 25. Mu.L, the upstream and downstream primers were 10pmoL each, and the template for the crRNA empty vector (pUC 57-T7-sgRNA) was 1. Mu.L (about 10 ng).

The reaction conditions are as follows: 30 cycles of 94℃for 30s, 55℃for 30s, and 72℃for 5s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit. According to HiScribe ^TM Quick T7High Yield RNA Synthesis Kit (NEB) synthesizes crRNAs under the following reaction conditions: the reaction was carried out at 37℃for about 16h. Purifying the transcribed crRNAs with phenol chloroform method, measuring concentration, packaging, and freezing at-80deg.C for long term storage.

pUC57-T7-sgRNA (vector partial sequence)

T7promoter sequence:

CGAGGGGACGGTGATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGGATCCCTAATACG；

sgRNA scaffold：19nt：

ACTCACTATAGGGAATTTCTACTGTTGTAGATAATCGCATTGCCTCCGTAGTGAATTTTTTAAAGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA。

cas12a cleavage reaction: in a 20. Mu.L reaction system, crRNA (0.5. Mu.M), cas12a (0.25. Mu.M) purified in step 2, 2. Mu.L PCR amplification product, ssDNA-reporter (JOE-6C-BHQ 1, 1.5. Mu.M), rCutSmart Buffer 2. Mu.L, 0.5. Mu.L RNase inhibitor in step 1 were added. The negative control was set without adding the target gene template, i.e., without adding Kmt1 gene amplification product. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity. The results, as evident in fig. 2, clearly detected fluorescent signals, indicating that the method can be used in CRISPR-Cas12a nucleic acid detection experiments. Placing the fluorescent light into an enzyme-labeled instrument to accurately read out the fluorescence intensity

Results:

comparing 6 crRNAs aiming at Pasteurella multocida Kmt1 gene, under the template condition of taking Kmt1 gene as a target gene, the 6 crRNAs are found to have obvious fluorescence (A in figure 2), and the fluorescence value is determined by enzyme labeling, so that the fluorescence signal of Kmt-crRNA-2 is the strongest (B in figure 2), which shows that the detection activity of the crRNA is the highest. For subsequent multiplex detection experiments:

kmt1-crRNA-2 has the sequence shown in SEQ ID NO. 1:

SEQ ID NO.1：AGCCCACTCACAACGAGCCAATCTACAATAGTAGAAAT。

example 3 screening for crrnas for detection of LKT high activity based on CRISPR/Cas13a

For PCR amplification of the LKT gene region, 6 crRNAs were designed using CRISPR-offher software (https:// sourcefuge. Net/subjects/CRISPR-offher-v 1-2 /).

LKT-crRNA1：GCTATGGTTATCTAACTGGTCGAATTAA；

LKT-crRNA2：ATCTAACTGGTCGAATTAAACATATTAG；

LKT-crRNA3：GCCCGGATGCGATTGAACAACCTAATGT；

LKT-crRNA4：GCAACTATAGCTATAGATAGGAAGAATC；

LKT-crRNA5：AACCTAATGTAGGCTTAGTTTTTAATGC；

LKT-crRNA6：AACAACCTAATGTAGGCTTAGTTTTTAA。

The crRNA design in vitro transcription primer pairs were designed (table 3). The experimental procedure for detecting nucleic acids using CRISP-Cas13a is as follows:

(1) PCR amplification of target gene fragment:

mu.LPCR reaction solution was prepared in which 25. Mu.L of Ex taq Mix was used to prepare 10pmoL (Table 3) of each of 13a-LKT-F and LKT-R primers, and 1. Mu.L (about 10 ng) of pMD18T-LKT plasmid template.

TABLE 3 primer set and probe for amplification of LKT-crRNA in vitro transcription templates

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit.

(2) In vitro transcription of crRNA and LKT targets: the templates for in vitro transcription of crRNA were amplified using PCR techniques with primers containing 13a-crRNA-F and different LKT-crRNA-R (Table 3) and purified in step (1) to give targets.

The experimental reaction system was 50. Mu.L, in which the Extaq Mix was 25. Mu.L and the upstream and downstream primers were 2. Mu.L each.

The reaction conditions are as follows: 30 cycles of 94℃for 30s, 55℃for 30s, and 72℃for 5s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit. According to HiScribe ^TM Quick T7High Yield RNA Synthesis Kit (NEB) synthesizes crRNAs and LKT targets under the following reaction conditions: the reaction was carried out at 37℃for about 16h. Purifying the transcribed crRNAs and LKT targets by a phenol-chloroform method, measuring the concentration, sub-packaging, and freezing and storing at-80 ℃ for a long time.

(3) Cas13a cleavage reaction: in a 20. Mu.L reaction system, crRNA (0.5. Mu.M), cas13a (0.25. Mu.M) purified in step 2, 500ng of target product purified in step 2, ssRNA-reporter (ROX-5U-BHQ) ₂ 1.5. Mu.M), rCutSmart Buffer 2. Mu.L, 0.5. Mu.L RNase inhibitor. The negative control was set without the detection target gene template, i.e., without the target product of LKT RNA. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(4) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity. And the fluorescent intensity is accurately read out by placing the fluorescent signal into an enzyme-labeled instrument, and the fluorescent signal can be obviously detected as shown in FIG. 3, which shows that the fluorescent signal can be used for CRISPR-Cas13a nucleic acid detection experiments.

Results:

comparing 6 crRNAs aiming at the LKT gene of the haemolyticum, under the template condition of taking the LKT RNA gene as a target gene, the 6 crRNAs are found to have obvious fluorescence (A in figure 3), and the fluorescence value is found by enzyme-labeled measurement, so that the fluorescence signal of the LKT-crRNA-6 is strongest (B in figure 3), which shows that the detection activity of the crRNA is highest and the crRNA is used for the subsequent multiple detection experiments.

LKT-crRNA-6 is shown in SEQ ID NO. 2:

SEQ ID NO.2：TTTTATGCCACTTGAAATGGATCTACAATAGTAGAAAT。

example 4 method for the detection of Pasteurella multocida Kmt target Gene and the nucleic acid visual detection of the combination of RPA and CRISPR-Cas13a Gene by establishing nucleic acid visual detection of the combination of RPA and CRISPR-Cas12a, respectively

In order to improve the sensitivity of detecting the two bacteria, in particular to realize on-site rapid detection, strategies have also been evaluated that employ RPA isothermal amplification in combination with CRISPR-Cas12a/Cas13a, respectively, to realize nucleic acid visual detection. The pmd-18t-Kmt1 and pmd-18t-LKT plasmids constructed in example 1 were first diluted as templates for PRA amplification for primer screening, while the amplified products were used in CRISPR-Cas12a and CRISPR-Cas13a visualization nucleic acid detection systems, respectively. The experimental procedure was as follows:

1. specific RPA amplification primers were designed using Primer Premier 5 software for the amplified regions containing Kmt-crRNA-2 and LKT-crRNA-6, respectively (Table 4).

TABLE 4 primer set for RPA isothermal amplification

RPA amplification of fragments of interest: pMD-18T-Kmt1 and pMD-18T-LKT plasmids were diluted to 34 copies/. Mu.L and 11 copies/. Mu.L, respectively, as templates for PRA amplification, and amplified PRA primer combinations were designed for amplification. Kmt1-1 primer combinations are: kmt1-RPA-F1 and Kmt-RPA-R1; kmt1-2 primer combinations are: kmt1-RPA-F1 and Kmt-RPA-R2; kmt1-3 primer combinations are: kmt1-RPA-F2 and Kmt-RPA-R2; kmt1-4 primer combinations are: kmt1-RPA-F2 and Kmt-RPA-R3; kmt1-5 primer combinations are: kmt1-RPA-F3 and Kmt-RPA-R3; lkt-1 primer combinations are Lkt-RPA-F1 and Lkt-RPA-R1; lkt-2 primer combinations are Lkt-RPA-F2 and Lkt-RPA-R3; lkt-3 primer combinations are Lkt-RPA-F2 and Lkt-RPA-R2; lkt-4 primer combinations were Lkt-RPA-F1 and Lkt-RPA-R2; lkt-5 primer combinations are Lkt-RPA-F3 and Lkt-RPA-R3; negative controls were set without plasmid template.

The RPA reaction was performed according to the Twist RPA kit instructions, according to the following system:

to 50. Mu.L of the reaction system were added 29.5. Mu. L rehydration buffer,25pmol of the upstream/downstream primer, and 5.1. Mu.L of nuclease-free water, which were added to PCR tubes of lyophilized reagent particles in the TwitAmp base kit, and the reaction solution was mixed and split into two tubes. To each tube was added 1.25. Mu.L of 280mM magnesium acetate (MgOAc) and 2. Mu.L of template. After the reaction was carried out at 39℃for 4 minutes, the mixture was vortexed and then left to stand at 39℃for 26 minutes.

(3) Cas12a/Cas13a cleavage reaction: for Cas12a cleavage reactions, 2 μl RPA amplification products comprising Kmt1-crRNA-2 (0.5 μΜ), cas12a (0.25 μΜ), ssDNA-reporter (JOE-6C-BHQ 1,1.5 μΜ), rCutSmart Buffer 2 μl,0.5 μl rnase inhibitor and each Kmt1 primer combination in step 2 purified in example 2 were finally made up to 20 μl with DEPC water. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min. For the Cas13a cleavage reaction, 2 μl RPA amplification product comprising purified LKT-crRNA-6 (0.5 μΜ) in example 3, cas13a (0.25 μΜ), ssRNA-reporter (ROX-5U-BHQ 2,1.5 μΜ), rCutSmart Buffer 2 μl,0.5 μl rnase inhibitor and each Lkt primer combination in step 2 was finally made up to 20 μl with DEPC water. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(4) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity. The results are shown in FIG. 4.

Results:

as shown in FIG. 4A, the fluorescence intensities of the Kmt1-2 primer combination and the Kmt1-3 primer combination are highest, which indicates that the effect of amplifying the Pasteurella multocida Kmt1 target under the same condition is optimal; as shown in FIG. 4B, the fluorescence intensities of the Lkt-1 primer combination, the Lkt-2 primer combination, the Lkt-3 primer combination and the Lkt-5 primer combination are better, which means that the effect of amplifying the haemolyticus Mannheimia is best, the Lkt-4 primer group does not generate fluorescence, and the amplification efficiency is poor; all control groups did not fluoresce.

Example 5: high-sensitivity visualization of multiple RPA combined with CRISPR-Cas12a/Cas13a system for simultaneous detection of Pasteurella multocida Kmt1 target gene and Mankt haemolyticus LKT gene

In order to realize high-sensitivity and visual detection of Pasteurella multocida Kmt gene and Mankt gene of haemolyticus, kmt primer set and Lkt primer set which are screened out in embodiment 4 and have the best RPA amplification effect are used for carrying out combination to amplify two target genes simultaneously, and optimal multiple RPA primers are screened in combination with the optimal crRNA identified in embodiment 2 and 3. The sensitivity evaluation was performed on the established multiplex RPA-binding multiplex CRISPR/Cas12a/Cas13a detection method using the pMD-18T-Kmt1 and pMD-18T-LKT plasmids constructed in example 1 as the templates for PRA amplification by double dilution. The experimental procedure was as follows:

(1) Screening of optimal multiplex primer combinations: pairing and amplifying the RPA primer group (Kmt-2 primer group and Kmt-1-3 primer group) of the best amplified Kmt gene and the RPA primer group (Lkt-1 primer group, lkt-2 primer group, lkt-3 primer group and Lkt-5 primer group) of the best amplified LKT gene, respectively, which are screened in the embodiment 5; the multiplex primer combination 1 is Kmt1-3 primer groups and Lkt-1 primer groups; 2 is Kmt-2 primer group and Lkt-1 primer group; 3 is Kmt-3 primer group and Lkt-3 primer group; 4 is Kmt-2 primer group and Lkt-1 primer group; 5 is Kmt-2 primer group and Lkt-5 primer group; 6 is Kmt-2 primer group and Lkt-5 primer group; 7 is Kmt-3 primer set and Lkt-2 primer set; 8 is Kmt-2 primer group and Lkt-2 primer group; negative controls were set without plasmid template. The RPA reaction was performed according to the Twist RPA kit instructions, according to the following system:

to 50. Mu.L of the reaction system were added 29.5. Mu. L rehydration buffer,25pmol of the upstream/downstream primer, and 5.1. Mu.L of nuclease-free water, which were added to PCR tubes of lyophilized reagent particles in the TwitAmp base kit, and the reaction solution was mixed and split into two tubes. To each tube was added 1.25. Mu.L of 280mM magnesium acetate (MgOAc) and 2. Mu.L of template.

After the reaction was carried out at 39℃for 4 minutes, the mixture was vortexed and then left to stand at 39℃for 26 minutes.

(2) Cas12a/Cas13a cleavage reaction: for Cas12a cleavage reactions, 2 μl of RPA amplification product comprising Kmt1-crRNA-2 (0.5 μΜ), cas12a (0.25 μΜ), ssDNA-reporter (JOE-6C-BHQ 1,1.5 μΜ), rCutSmart Buffer 2 μl,0.5 μl rnase inhibitor and the 8-set multiplex RPA primer combination of step 1 purified in example 2 was finally made up to 20 μl with DEPC water. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min. For the Cas13a cleavage reaction, 2 μl RPA amplification product comprising purified LKT-crRNA-6 (0.5 μΜ) in example 3, cas13a (0.25 μΜ), ssRNA-reporter (ROX-5U-BHQ 2,1.5 μΜ), rCutSmart Buffer 2 μl,0.5 μl rnase inhibitor and the 8-set multiplex RPA primer combination in step 1 was finally made up to 20 μl with DEPC water. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(3) Assessing the sensitivity of a multiplex RPA binding multiplex CRISPR/Cas12a/Cas13a detection method: the pMD-18T-Kmt and pMD-18T-LKT plasmids constructed in example 1 were diluted 10-fold as templates for multiplex PRA amplification, and multiplex RPA amplification was performed using the optimal multiplex RPA amplification primer set selected in step (1) as primers. Amplification products Cas12a/Cas13a one-tube cleavage reaction, i.e., 2 μl of amplification product, kmt-crRNA-2 (0.5 μΜ), LKT-crRNA-6 (0.5 μΜ), cas12a (0.25 μΜ), cas13a (0.25 μΜ), ssDNA-reporter (JOE-6C-BHQ 1,1.5 μΜ), ssRNA-reporter (ROX-5U-BHQ 2,1.5 μΜ), rCutSmart Buffer 2 μΜ,0.5 μΜ rnase inhibitor purified in examples 2, 3 were added to a 20 μl reaction system. The rest is supplemented with DEPC water, different control groups are respectively arranged, and the negative control groups are not added with the same or several samples. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(4) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity, and placing the centrifuge tube into an enzyme-labeled instrument to accurately read the fluorescence intensity. The results are shown in FIG. 5.

Results:

as shown in fig. 5 a, when the pasteurella multocida Kmt1 gene in the multiplex RPA amplification product was detected for CRISPR/Cas12a, the corresponding tubes of groups 3, 6 and 7 were found to show green fluorescence; FIG. 5B shows that the fluorescence values of groups 3, 6 and 7 are highest in the excitation light range of the JOE probe when the excitation light wavelength is 520-548 nM, corresponding to A, indicating that the above primer set has an efficient detection effect on Kmt1 gene. Similarly, as shown in C, D of FIG. 5, only 6 groups had high amplification efficiency for the LKT gene. Therefore, by combining the detection results of the above two genes, 6 sets were determined as the optimal multiplex RPA amplification primer set.

Subsequently performing sensitivity assessment on the established nucleic acid visualization detection method of combining multiple RPA with multiple CRISPR-Cas12a/Cas13 a; as shown in figure 5, E, H, the multiplex RPA-binding CRISPR/Cas12a was 3.4 copies of the plasmid with the lowest limit of detection for Kmt1 gene; as shown in figure 5F, I, the multiplex RPA binds to a plasmid with a minimum detection limit of 11 copies of CRISPR/Cas13a for LKT gene; simultaneously, as shown in G, J in 6, kmt and Lkt genes were detected simultaneously at multiple RPA binding multiple CRISPR-Cas12a/Cas13a, also with near single copy detection sensitivity. Thus, a method for detecting Pasteurella multocida and Mannheimia haemolytica by high-sensitivity multiplex RPA-CRISPR/Cas12a/Cas13a is established.

Example 6 evaluation of multiple RPA binding CRISPR-Cas12a/Cas13a System accurate detection of Pasteurella multocida and Mannheimia haemolytica

Further evaluating the application potential of the established multiplex RPA-binding multiplex CRISPR-Cas12a/Cas13a detection method on truly infected samples, first multiplex RPA amplification was performed on 18 pasteurella multocida and mannheimia haemolytica infected clinical samples with the optimal multiplex RPA primer set described in embodiment 5, and diagnosis of whether the samples were infected or not was performed in combination with the Cas12a/Cas13a one-tube cleavage reaction described in embodiment 4. The experimental procedure was as follows:

(1) Rapidly extracting genome of a clinical sample; 50. Mu.L and 50. Mu.L QuickExract of 18 samples of Pasteurella multocida and Mannheimia haemolytica infection were taken respectively ^TM Mixing the crude extract, reacting at 65 ℃ for 10min, and then reacting at 95 ℃ for 5min. The mixed solution after the reaction is used as an amplification templateFor the next step.

(2) Multiplex RPA binding CRISPR/Cas12a/Cas13a detection: multiplex RPA amplification was performed on the 18 Pasteurella multocida and Mannheimia haemolytica infected sample DNA crude extracted in step 1 with the optimal multiplex RPA primer set described in example 6, while pMD-18T-Kmt1 and pMD-18T-LKT plasmids were used as targets for the positive control group, which did not add any nucleic acid targets. Cleavage was performed in combination with Cas12a/Cas13 a-tube cleavage reactions described in embodiment 4.

(3) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity, and placing the centrifuge tube into an enzyme-labeled instrument to accurately read the fluorescence intensity. The results are shown in FIG. 6.

Results:

the pattern diagram of the multiplex RPA-CRISPR/Cas12a/Cas13a detection method as shown in fig. 6 a, 18 sheep sample DNA suspected of infection was extracted and multiplex RPA-CRISPR/Cas12a/Cas13a detection was performed; as shown in fig. 6, B, C, 9 samples were infected with pasteurella multocida and 5 samples were infected with mannheimia haemolytica. Wherein under excitation of blue light and UV light, sample numbers 2, 3, 4, 5, 7, 11 only fluoresce green, which can be judged to be only pasteurella multocida infection; however, in 8, sample numbers 1, 2, 3, 4, 5, 7, 11 all amplified bright bands, judged by PCR bands to be only pasteurella multocida infection, and error occurred in the detection method based on CRISPR establishment; sample number 1 was subjected to Sanger sequencing to find that the band was false positive interpretation due to non-specific amplification; therefore, the method established by the application is more accurate than PCR; sample numbers 6, 8, 12 emitted only red fluorescence, which was judged to be only a haemolytic mannheimia infection, consistent with the PCR identification (see fig. 7); meanwhile, the clinical samples with sample numbers of 9, 14 and 18 emit yellow light, so that the simultaneous infection of the Pasteurella multocida and the hemolytic Mannheimia is judged to be consistent with the result of PCR identification, and the method for simultaneously detecting the Pasteurella multocida and the hemolytic Mannheimia by the multiple RPA-CRISPR/Cas12a/Cas13a has high efficiency and accuracy.

The above embodiments are only illustrative of the preferred embodiments of the present application and are not intended to limit the scope of the present application, and various modifications and improvements made by those skilled in the art to the technical solutions of the present application should fall within the protection scope defined by the claims of the present application without departing from the design spirit of the present application.

Claims (10)

1. A primer for specifically recognizing Pasteurella multocida is characterized by comprising an upstream primer shown as SEQ ID NO.3 and a downstream primer shown as SEQ ID NO. 7.

2. A primer for specifically recognizing the haemolyticus is characterized by comprising an upstream primer shown as SEQ ID NO.11 and a downstream primer shown as SEQ ID NO. 14.

3. A multiplex RPA amplification primer set comprising the primer specifically recognizing pasteurella multocida of claim 1 and the primer specifically recognizing mannheimia haemolytica of claim 2.

4. A method for detecting Pasteurella multocida and Mannheimia haemolytica at a non-disease detection or treatment destination is characterized in that DNA of a sample to be detected is taken as a template, the multiplex RPA amplification primer set of claim 3 is used for carrying out amplification reaction, then Cas12a/Cas13a one-tube digestion reaction is carried out on an amplification product, and whether the sample to be detected contains the Pasteurella multocida and the Mannheimia haemolytica is judged according to the fluorescent color after the reaction is completed.

5. The method of claim 4, wherein the performing a Cas12a/Cas13a one-tube cleavage reaction on the amplification product is performing a one-tube cleavage reaction on the amplification product using a CRISPR-Cas12a/Cas13a system;

the CRISPR-Cas12a/Cas13a system comprises: cas12a protein, cas13a protein, and crRNA;

the Cas12a protein is a Cas12a protein or a Cas protein having a similar bypass single strand DNA cleavage activity to Cas12 a; the Cas13a protein is a Cas13a protein or a Cas protein having a similar bypass single-stranded RNA cleavage activity to Cas13 a; the nucleotide sequences of the crRNA are shown as SEQ ID NO.1 and SEQ ID NO. 2.

6. The method according to claim 4 or 5, wherein the fluorescent color is a fluorescent color after completion of observation of the reaction under blue light and ultraviolet excitation.

7. The method according to any one of claims 4 to 6, wherein pasteurella multocida is present in the sample to be tested when the liquid is excited to green light; when the liquid is excited to red light, the sample to be tested contains the haemolytic mannich bacillus; when the liquid is excited to yellow or red-green-Huang Shi, the pasteurella multocida and the mannheimia haemolytica are simultaneously present in the sample to be tested.

8. The method according to any one of claims 4 to 7, wherein the reaction system of the amplification reaction is: 29.5. Mu. L rehydration buffer,25pmol of the multiplex RPA amplification primer set of claim 3, and 5.1. Mu.L nuclease-free water were added to the PCR tubes of the lyophilized reagent particles in the TwitAmp base kit, and the reaction solution was split into two tubes; 1.25. Mu.L of 280mM magnesium acetate (MgOAc) and 2. Mu.L of template were added to each tube;

the reaction conditions are as follows: the reaction was carried out at 39℃for 4min, and after vortexing and mixing, the reaction was carried out at 39℃for 26 min.

9. The method according to any one of claims 4 to 8, wherein the one-tube digestion reaction system is: 2. Mu.L of the amplification product, kmt 1-crRNA-2.5. Mu. M, LKT-crRNA-6.5. Mu. M, cas12a 0.25. Mu. M, cas13a 0.25. Mu. M, ssDNA-reporter JOE-6C-BHQ 1.5. Mu. M, ssRNA-reporter ROX-5U-BHQ 2.5. Mu.M, rCutSmart Buffer 2. Mu.L and 0.5. Mu.L of RNase inhibitor, DEPC water was supplemented to 20. Mu.L;

the reaction procedure is: the reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

10. A product for simultaneous detection of pasteurella multocida and mannheimia haemolytica, comprising the multiplex RPA amplification primer set of claim 3 and the CRISPR-Cas12a/Cas13a system of claim 5.