CN117305484A - Detection system and method for simultaneously detecting Pasteurella multocida and mannheimia haemolytica - Google Patents

Abstract

The invention discloses a detection system and a method for simultaneously detecting Pasteurella multocida and Mannheimia haemolytica, belonging to the technical field of biology. The detection system comprises: cas12a protein, cas13a protein, and crRNA. The method is simple to operate and suitable for rapidly detecting the Pasteurella multocida and the Mannheimia haemolytica on site.

Description

Detection system and method for simultaneously detecting Pasteurella multocida and mannheimia haemolytica

Technical Field

The invention relates to the technical field of biology, in particular to a detection system and a method for simultaneously detecting Pasteurella multocida and Mannheimia haemolytica.

Background

Pasteurella multocida (Pasteurella multocida) belongs to the genus Pasteurella of the family Pasteurellaceae, and more than 20 bacteria of the genus Pasteurella have been reported, and Pasteurella multocida is the most important pathogenic bacteria of livestock and poultry in the genus Pasteurella. The strain can cause various livestock and poultry pasteurellosis, and is manifested by hemorrhagic septicemia or infectious pneumonia. The bacteria are widely distributed around the world, normally exist in oral and pharyngeal mucous membranes of various healthy animals, and belong to conditional pathogenic bacteria. Pasteurella multocida can infect humans and various animals, cause various infectious diseases of livestock and poultry, such as cholera fowl, swine plague, bovine hemorrhagic septicemia, rabbit hemorrhagic septicemia and the like, and cause serious harm to the breeding industry. According to the Carter typing method and the Heddleston typing method, the pasteurella multocida is divided into 5 capsular serotypes (A, B, D, E, F) and 16 thallus serotypes (1-16) according to different capsular antigens and different lipopolysaccharide antigens, and the pasteurella multocida serotypes are complex, so that the cross protectiveness among the types is not strong, the vaccine prevention and control difficulty is high, and the occurrence and the epidemic of the disease can be effectively prevented only through pathogen monitoring, sanitary disinfection, biosafety and the like.

The haemolytic Mannheimia is a microorganism of the genus Mannheimia, is one of pathogens causing ruminant respiratory disease syndromes (bovine respiratory disease complex, BRD) such as cattle, sheep and the like, and causes diseases when the host resistance is reduced due to stress such as transportation, environment and the like or other pathogen co-infection, and huge losses are caused to cattle farm cultivation due to pathogen invasion into the lung. Although more serotype strains can cause morbidity, the A1, A2 and A6 serotypes predominate in animals worldwide infected with Mannheimia, with the A1 and A6 serotypes primarily affecting cattle and the A2 serotypes primarily affecting sheep.

In recent years, with the development of livestock breeding to the intensive and large-scale direction, respiratory diseases are rapid in onset and strong in infectivity, are one of the most harmful and extensive important common epidemic diseases for the breeding industry, are extremely easy to cause huge economic loss for the breeding industry, and seriously endanger the healthy development of the breeding industry. The main respiratory tract pathogenic bacteria of livestock are various types of haemolytic mannich bacillus, pasteurella multocida, mycoplasma, stellera suppuration, klebsiella pneumoniae and the like, the clinical respiratory tract diseases often occur in a mixed infection mode, and the etiology research of the clinical respiratory tract diseases tends to be specialized and complicated more and more, so that the clinical diagnosis is difficult. The traditional diagnosis means is a method of bacterial culture, but the method is long in time consumption and low in sensitivity, and is difficult to meet the clinical diagnosis requirement, so that the rapid detection of the respiratory disease pathogens of livestock is extremely important. At present, no respiratory tract pathogenic bacteria detection method which can be suitable for any poultry and is simple, quick and accurate to operate is available.

Disclosure of Invention

The invention aims to provide a detection system and a method for simultaneously detecting Pasteurella multocida and Mannheimia haemolytica, which solve the problems in the prior art.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a detection system for simultaneously detecting Pasteurella multocida and Mannheimia haemolytica, which is characterized by comprising the following components: cas12a protein, cas13a protein, and crRNA.

Preferably, the Cas12a protein is a Cas12a protein or a Cas protein having a similar bypass single-stranded DNA/RNA cleavage activity to Cas12 a.

Preferably, the Cas13a protein is a Cas13a protein or a Cas protein having a similar bypass single-stranded DNA/RNA cleavage activity to Cas13 a.

Preferably, the nucleotide sequence of the crRNA is shown as SEQ ID NO.7 and SEQ ID NO. 19.

The invention also provides a visual detection method of the non-disease detection or treatment destination Pasteurella multocida and the haemolytic Mannheimia, which utilizes the detection system to carry out enzyme digestion reaction on the sample to be detected, and judges whether the sample to be detected contains the Pasteurella multocida and the haemolytic Mannheimia according to the fluorescent color after the reaction is completed.

Preferably, the fluorescent color is a fluorescent color after the reaction is observed under blue light and ultraviolet excitation.

Preferably, when the liquid is excited to green light, the pasteurella multocida is present in the sample to be tested; when the liquid is excited to red light, the sample to be tested contains the haemolytic mannich bacillus; when the liquid is excited to yellow or red-green-Huang Shi, the pasteurella multocida and the mannheimia haemolytica are simultaneously present in the sample to be tested.

Preferably, the reaction system of the enzyme digestion reaction is as follows: kmt1-crRNA-2 (0.5. Mu.M), LKT-crRNA-6 (0.5. Mu.M), cas12a (0.25. Mu.M) and Cas13a (0.25. Mu.M), kmt1 DNA target product 500ng, LKT RNA target product 500ng, ssDNA-reporter (JOE-6C-BHQ 1, 1.5. Mu.M), ssRNA-reporter (ROX-5U-BHQ 2, 1.5. Mu.M), rCutSmart Buffer 2. Mu.L and 0.5. Mu.L RNase inhibitor, DEPC water was made up to 20. Mu.L;

the reaction procedure is: the reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

The invention also provides a product for simultaneously detecting the Pasteurella multocida and the haemolytic Mannheimia, which comprises the detection system.

Preferably, the product comprises a reagent or kit.

Based on the technical scheme, the invention has the following technical effects:

the invention provides a detection system and a detection method for simultaneously detecting Pasteurella multocida and Mannheimia haemolytica.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1A shows the results of PCR detection of target nucleic acids of M.haemolyticus and Pasteurella multocida, wherein F1-2 is M.haemolyticus, S4 is Pasteurella multocida, and FIG. 1B shows the recovery of the gel of LKT and Kmt1 detected, and sequencing by ligation pmd t;

FIG. 2 shows the detection of CRRNA-2 with high activity of Mannheimia haemolytica Kmt1 based on CRISPR/Cas12a, wherein A is the result interpretation with a portable blue light instrument, and B is the quantification of the fluorescence intensity of FIG. A by an enzyme-labeled instrument; -: no identified Kmt DNA target; +: comprising a recognized DNA target; error bars represent Standard Error of Mean (SEM); n=3;

FIG. 3 is a screen of crRNA-6 for detection of high activity of Pasteurella multocida LKT based on CRISPR/Cas13a, wherein A is result interpretation with a portable blue instrument, B is quantification of the fluorescent intensity of panel A by an enzyme-labeled instrument; -: no recognized LKT RNA target; +: comprising a recognized RNA target; error bars represent Standard Error of Mean (SEM); n=3;

fig. 4 is a graph of the detection results of CRISPR/Cas12a/Cas13a for simultaneous detection of two bacteria, wherein a is a portable blue light instrument, and when pasteurella multocida target Kmt1 alone, mann bacillus haemolyticus target LKT alone, pasteurella multocida target Kmt1 and mann bacillus haemolyticus target LKT are detected separately in the system, the liquid excitation is green, red and yellow, respectively; (traffic light), and B is quantification of the fluorescence intensity of the image A by an enzyme-labeled instrument; -: no recognized LKT RNA target; +: comprising a recognized RNA target. Error bars represent Standard Error of Mean (SEM); n=3.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The technical scheme of the invention is conventional in the field, and the reagents or raw materials are purchased from commercial sources or are disclosed.

EXAMPLE 1PCR detection of Pasteurella multocida Kmt target Gene and Mankt Gene of Mannheimia haemolytica

PCR primers Kmt1-F, kmt1-R and LKT-F, LKT-R (see Table 1) were designed to amplify the Pasteurella multocida Kmt1 target gene and the Mankt gene, target gene fragment, respectively.

TABLE 1 primer set for PCR primer template amplification

	Primer name	Primer sequence (5 '-3')
			SEQ ID NO.1	Kmt1-F	ATCCGCTATTTACCCAGTGG
SEQ ID NO.2	Kmt1-R	GCTGTAAACGAACTCGCCAC
			SEQ ID NO.3	LKT-F	GCAGGAGGTGATTATTAAAGTGG
SEQ ID NO.4	LKT-R	CAGCAGTTATTGTCATACCTGAAC

mu.L of a PCR reaction solution was prepared, and 1. Mu.L (about 100 ng) of the genomic template was added to 10pmoL of each of the above-mentioned primers at the upstream and downstream of 25. Mu.L of Ex taq Mix.

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃. The PCR products were run on agarose gel at 1.5% concentration for identification and recovery.

The detection results are shown as A in FIG. 1, and the primers designed and detected can be used for detecting Pasteurella multocida and Mannheimia haemolytica respectively, wherein F1-2 is Mannheimia haemolytica and S4 is Pasteurella multocida; the detected LKT and Kmt1 were separately gel recovered as in fig. 1B and ligated into pmd19t plasmid for subsequent experiments.

Example 2 screening for crrnas with high activity against CRISPR/Cas12 a-based detection Kmt1

For PCR amplification of the Kmt gene region, 6 crRNAs were designed using CRISPR-offinder software (https:// sourceforge. Net/subjects/CRISPR-offinder-v 1-2 /), PAM being TTTV:

Kmt1-crRNA1：TTTATGCCACTTGAAATGGGAAAT；

Kmt1-crRNA2：TTTATGGCTCGTTGTGAGTGGGCT；

Kmt1-crRNA3：TTTATTTGGCTTGTGGCAAAGAAA；

Kmt1-crRNA4：TTTGTTGGGCGGAGTTTGGTGTGT；

Kmt1-crRNA5：TTTGCCACAAGCCAAATAAAAGAC；

Kmt1-crRNA6：TTTCCCATTTCAAGTGGCATAAAA。

primer pairs for in vitro transcription were designed using the sgRNA empty vector (pUC 57-T7-sgRNA) as template (see Table 2). The experimental procedure for detecting nucleic acids using CRISP-Cas12a is as follows:

TABLE 2 primer pairs and probes for in vitro transcription template amplification of Kmt1-crRNA

	Primer name	Primer sequence (5 '-3')
			SEQ ID NO.5	T7-crRNA-F	TAATACGACTCACTATAGG
SEQ ID NO.6	Kmt1-crRNA-1R	ATTTCCCATTTCAAGTGGCAATCTACAATAGTAGAAAT
			SEQ ID NO.7	Kmt1-crRNA-2R	AGCCCACTCACAACGAGCCAATCTACAATAGTAGAAAT
SEQ ID NO.8	Kmt1-crRNA-3R	TTTCTTTGCCACAAGCCAAAATCTACAATAGTAGAAAT
			SEQ ID NO.9	Kmt1-crRNA-4R	ACACACCAAACTCCGCCCAAATCTACAATAGTAGAAAT
SEQ ID NO.10	Kmt1-crRNA-5R	GTCTTTTATTTGGCTTGTGGATCTACAATAGTAGAAAT
			SEQ ID NO.11	Kmt1-crRNA-6R	TTTTATGCCACTTGAAATGGATCTACAATAGTAGAAAT
	JOE-6C-BHQ1	5’-JOE/CCCCCC/3’BHQ1

(1) PCR amplification of target gene fragment:

mu.L of PCR reaction solution was prepared, in which 10pmoL of each of the Extaq Mix 25. Mu.L, the pMD18T-Kmt1 plasmid template 1. Mu.L (about 10 ng) was used as Kmt-F and Kmt-R primers.

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃.

(2) In vitro transcription of crRNA: templates for in vitro transcription of sgrnas were amplified using PCR techniques with T7-crRNA-F and different crRNA-R primers (see table 2) using a plasmid containing T7 promoter and crRNA scafold (pUC 57-T7-crRNA) as templates.

The experimental reaction system was 50. Mu.L, in which the Extaq Mix was 25. Mu.L, the upstream and downstream primers were 10pmoL each, and the template for the crRNA empty vector (pUC 57-T7-sgRNA) was 1. Mu.L (about 10 ng).

The reaction conditions are as follows: 30 cycles of 94℃for 30s, 55℃for 30s, and 72℃for 5s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit. According to HiScribe ^TM Quick T7High Yield RNA Synthesis Kit (NEB) synthesizes crRNAs under the following reaction conditions: the reaction was carried out at 37℃for about 16h. Purifying the transcribed crRNAs with phenol chloroform method, measuring concentration, packaging, and freezing at-80deg.C for long term storage.

pUC57-T7-sgRNA (vector partial sequence)

T7 promoter sequence:

CGAGGGGACGGTGATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGGATCCCTAATACG；

sgRNA scaffold：19nt：

ACTCACTATAGGGAATTTCTACTGTTGTAGATAATCGCATTGCCTCCGTAGTGAATTTTTTAAAGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA。

cas12a cleavage reaction: in a 20. Mu.L reaction system, crRNA (0.5. Mu.M), cas12a (0.25. Mu.M) purified in step 2, 2. Mu.L PCR amplification product, ssDNA-reporter (JOE-6C-BHQ 1, 1.5. Mu.M), rCutSmart Buffer 2. Mu.L, 0.5. Mu.L RNase inhibitor in step 1 were added. The negative control was set without adding the target gene template, i.e., without adding Kmt1 gene amplification product. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity. The results are shown in FIG. 2, in which a fluorescent signal is clearly detectable, indicating that it can be used in CRISPR-Cas12a nucleic acid detection experiments. Placing the fluorescent light into an enzyme-labeled instrument to accurately read out the fluorescence intensity

Results:

comparing 6 crRNAs aiming at Pasteurella multocida Kmt1 gene, under the template condition of taking Kmt1 gene as a target gene, the 6 crRNAs are found to have obvious fluorescence (A in figure 2), and the fluorescence value is determined by enzyme labeling, so that the fluorescence signal of Kmt-crRNA-2 is the strongest (B in figure 2), which shows that the detection activity of the crRNA is the highest. Used for the subsequent multiple detection experiments.

Example 3 screening for crrnas for detection of LKT high activity based on CRISPR/Cas13a

For PCR amplification of the LKT gene region, 6 crRNAs were designed using CRISPR-offher software (https:// sourcefuge. Net/subjects/CRISPR-offher-v 1-2 /).

LKT-crRNA1：GCTATGGTTATCTAACTGGTCGAATTAA；

LKT-crRNA2：ATCTAACTGGTCGAATTAAACATATTAG；

LKT-crRNA3：GCCCGGATGCGATTGAACAACCTAATGT；

LKT-crRNA4：GCAACTATAGCTATAGATAGGAAGAATC；

LKT-crRNA5：AACCTAATGTAGGCTTAGTTTTTAATGC；

LKT-crRNA6：AACAACCTAATGTAGGCTTAGTTTTTAA。

The crRNA design in vitro transcription primer pairs were designed (table 3). The experimental procedure for detecting nucleic acids using CRISP-Cas13a is as follows:

(1) PCR amplification of target gene fragment:

mu.LPCR reaction solution was prepared in which 25. Mu.L of Ex taq Mix was used to prepare 10pmoL (Table 3) of each of 13a-LKT-F and LKT-R primers, and 1. Mu.L (about 10 ng) of pMD18T-LKT plasmid template.

TABLE 3 primer set and probe for amplification of LKT-crRNA in vitro transcription templates

The PCR reaction program was set as follows: 30 cycles of 94℃for 30s, 53℃for 30s, and 72℃for 35s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit.

(2) In vitro transcription of crRNA and LKT targets: the templates for in vitro transcription of crRNA were amplified using PCR techniques with primers containing 13a-crRNA-F and different LKT-crRNA-R (Table 3) and purified in step (1) to give targets.

The experimental reaction system was 50. Mu.L, in which the Extaq Mix was 25. Mu.L and the upstream and downstream primers were 2. Mu.L each.

The reaction conditions are as follows: 30 cycles of 94℃for 30s, 55℃for 30s, and 72℃for 5s were performed, followed by 5min of extension at 72 ℃.

The PCR product was recovered using agarose gel DNA recovery kit. According to HiScribe ^TM Quick T7High Yield RNA Synthesis Kit (NEB) synthesizes crRNAs and LKT targets under the following reaction conditions: the reaction was carried out at 37℃for about 16h. Purifying the transcribed crRNAs and LKT targets by a phenol-chloroform method, measuring the concentration, sub-packaging, and freezing and storing at-80 ℃ for a long time.

(3) Cas13a cleavage reaction: in a 20. Mu.L reaction system, crRNA (0.5. Mu.M), cas13a (0.25. Mu.M) purified in step 2, 500ng of target product purified in step 2, ssRNA-reporter (ROX-5U-BHQ) ₂ 1.5. Mu.M), rCutSmart Buffer 2. Mu.L, 0.5. Mu.L RNase inhibitor. The negative control was set without the detection target gene template, i.e., without the target product of LKT RNA. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(4) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity. And placing the fluorescent signal into an enzyme-labeled instrument to accurately read the fluorescence intensity, wherein the result is shown in figure 3, and the fluorescent signal can be obviously detected, so that the fluorescent signal can be used for CRISPR-Cas13a nucleic acid detection experiments.

Results:

comparing 6 crRNAs aiming at the LKT gene of the haemolyticum, under the template condition of taking the LKT RNA gene as a target gene, the 6 crRNAs are found to have obvious fluorescence (A in figure 3), and the fluorescence value is found by enzyme-labeled measurement, so that the fluorescence signal of the LKT-crRNA-6 is strongest (B in figure 3), which shows that the detection activity of the crRNA is highest and the crRNA is used for the subsequent multiple detection experiments.

Example 4: method for establishing one-tube CRISPR/Cas12a/Cas13a and simultaneously detecting target gene of Pasteurella multocida Kmt and LKT gene of haemolyticus

To establish a method for simultaneously and visually detecting Pasteurella multocida and Mannheimia haemolytica by one tube of CRISPR/Cas12a/Cas13a, kmt-crRNA-2 and LKT-crRNA-6 are respectively screened.

Used in one-tube nucleic acid detection. The experimental procedure is as follows:

(1) Cas12a/Cas13a one-tube cleavage reaction: to a 20. Mu.L reaction system, kmt-crRNA-2 (0.5. Mu.M), LKT-crRNA-6 (0.5. Mu.M), cas12a (0.25. Mu.M), cas13a (0.25. Mu.M) and Kmt DNA target product purified in examples 2 and 3 500ng, LKT RNA target product 500ng, and ssDNA-reporter (JOE-6C-BHQ 1, 1.5. Mu.M), ssRNA-reporter (ROX-5U-BHQ 2, 1.5. Mu.M), rCutSmartBuffer 2. Mu.L, and 0.5. Mu.L RNase inhibitor were added. The rest is supplemented with DEPC water, different control groups are respectively arranged, and the negative control groups are not added with the same or several samples. The reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

(2) And (3) result detection and judgment: and directly placing the centrifuge tube containing the reaction liquid in a Lan Guangqie gel instrument or an ultraviolet gel imager to detect the change of fluorescence intensity, and placing the centrifuge tube into an enzyme-labeled instrument to accurately read the fluorescence intensity. The results are shown in FIG. 4.

Results:

as shown by tube 7 in fig. 4 a, when the pasteurella multocida target Kmt1 is present in the detection system, the liquid is excited to green light under blue and uv excitation; as shown in tube 8, when the detection system species exists the target LKT of the haemolyticum mannhei, the liquid is excited into red light under the conditions of blue light and ultraviolet excitation; as shown in tube 9, when the pasteurella multocida target Kmt and the mannheimia haemolytica target LKT are present together in the detection system, the liquid is excited to yellow; red-green-yellow (traffic light);

as shown in FIG. 4B, the quantification of fluorescence was performed with a microplate reader, and the tubes 2, 5, 7, 9 were capable of excitation as green light in the case of the JOE probe excitation light range when the excitation light was 520 and 548nM, respectively; when the excitation light is 576 nM and 601nM, respectively, the tubes 3, 6, 8, 9 can be excited to green light in the case of the ROX probe excitation light range; corresponding to the result A; thus, the invention successfully establishes a method for simultaneously detecting two bacteria by one tube of CRISPR/Cas12a/Cas13 a.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (9)

1. A detection system for simultaneously detecting pasteurella multocida and mannheimia haemolytica, the detection system comprising: cas12a protein, cas13a protein, and crRNA.

2. The detection system of claim 1, wherein the Cas12a protein is a Cas12a protein or a Cas protein having a similar bypass single strand DNA/RNA cleavage activity as Cas12 a.

3. The detection system of claim 1 or 2, wherein the Cas13a protein is a Cas13a protein or a Cas protein having a similar bypass single strand DNA/RNA cleavage activity as Cas13 a.

4. A detection system according to any one of claims 1 to 3, wherein the nucleotide sequence of the crRNA is shown in SEQ ID No.7 and SEQ ID No. 19.

5. A visual detection method for non-disease detection or treatment destination Pasteurella multocida and Mannheimia haemolytica, which is characterized in that the detection system in any one of claims 1-4 is utilized to carry out enzyme digestion reaction on a sample to be detected, and whether the sample to be detected contains the Pasteurella multocida and the Mannheimia haemolytica is judged according to the fluorescent color after the reaction is completed.

6. The visual inspection method according to claim 5, wherein the fluorescent color is a fluorescent color after the completion of the observation reaction under blue light and ultraviolet excitation.

7. The visual inspection method according to claim 6, wherein the presence of pasteurella multocida in the sample to be inspected is detected when the liquid is excited to green light; when the liquid is excited to red light, the sample to be tested contains the haemolytic mannich bacillus; when the liquid is excited to yellow or red-green-Huang Shi, the pasteurella multocida and the mannheimia haemolytica are simultaneously present in the sample to be tested.

8. The visual inspection method according to any one of claims 5 to 7, wherein the reaction system of the cleavage reaction is: kmt 1-crRNA-2.5 μ M, LKT-crRNA-6.5 μ M, cas12a 0.25 μ M, cas a 0.25 μ M, kmt1 DNA target product 500ng, LKT RNA target product 500ng, ssDNA-reporter JOE-6C-BHQ 1.5 μ M, ssRNA-reporter ROX-5U-BHQ 2.5 μM, rCutSmart Buffer 2 μL and RNase inhibitor 0.5 μL, DEPC water was made up to 20 μL;

the reaction procedure is: the reaction was terminated at 37℃for 15min and then at 98℃for 2 min.

9. A product for simultaneous detection of pasteurella multocida and mannheimia haemolytica, comprising the detection system according to any one of claims 1-4.