CN114015792A - Fluorescent kit for detecting brucella and detection method - Google Patents
Fluorescent kit for detecting brucella and detection method Download PDFInfo
- Publication number
- CN114015792A CN114015792A CN202111327518.2A CN202111327518A CN114015792A CN 114015792 A CN114015792 A CN 114015792A CN 202111327518 A CN202111327518 A CN 202111327518A CN 114015792 A CN114015792 A CN 114015792A
- Authority
- CN
- China
- Prior art keywords
- crrna
- vac
- sequence
- seq
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a fluorescence kit and a detection method for detecting brucella. The kit comprises crRNA for detecting Brucella, and the sequence of the crRNA is shown as SEQ ID NO. 1-10; or comprises crDNA for detecting Brucella, and the sequence of the crDNA is shown in SEQ ID NO. 11-20. The fluorescent kit for brucella provided by the invention can simultaneously distinguish whether a sample to be detected is a wild strain of the bovine brucella or a brucella A19 vaccine strain, thereby effectively solving the problem that the A19 vaccine strain and the wild strain are respectively identified and distinguished in the prior art. Compared with the traditional detection method, the detection method provided by the invention has the advantages of strong specificity, low detection limit, high sensitivity, low price, simple and quick operation, and convenience in carrying of equipment and instruments, and the detection sensitivity can reach 18 aM.
Description
Technical Field
The invention relates to a fluorescence kit and a detection method for detecting brucella, belonging to the technical field of biological detection.
Background
Brucellosis (Brucellosis) is a disease caused by Brucella (Brucella) infection, is a zoonosis systemic infectious disease, is called as "Brucellosis" for short, and is also called as Mediterranean atony, Maltapyr, waviness and the like. The world animal health Organization (OIE) lists it as a legal animal reporting disease. Brucella can invade into organism through skin mucosa, respiratory tract, digestive tract, etc., and cause clinical symptoms such as fever, abortion, sterility, weakness, arthralgia, etc. The brucella has wide hosts and strong infectivity, and different species of brucella have the capability of cross infection among hosts, thereby forming serious threats to the animal husbandry and human health. Therefore, the research and development of a simple, rapid and accurate brucella detection technology under the current severe prevention and control situation is very urgent.
Brucella is a gram-negative immobile bacterium, is free of capsules (smooth type with microcapsules), is positive for catalase and oxidase, is absolutely aerobic, can reduce nitrate, is parasitic in cells, and can survive in a plurality of livestock bodies. At present, the Brucella mainly has 7 species, and is 21 biotypes of Brucella melitensis of sheep species, Brucella bovis, Brucella suis of pig species, Brucella canicola, Brucella epididymis ovine species, Brucella sarrinae species and Brucella marinus of marine mammals. Brucella is widely distributed around the world, and 170 countries and regions around the world are investigated for the occurrence of brucella disease, the most serious of which are located along the coast of the mediterranean sea and in the countries of the arabian peninsula, which is also prevalent in india, mexico, the southern and central parts of the united states. Although some countries have effectively controlled brucellosis, the middle asia is gradually a new area of human brucellosis. Statistically, about 50 million cases of brucellosis occur worldwide each year. Brucellosis also widely exists in China, especially in areas where animal husbandry is the main issue. In 2009, the national brucellosis monitoring data shows that 29 provinces and cities in China have brucellosis among livestock, and the infection amount of cattle, sheep, pigs and the like reaches as many as one million, and is seen in pasturing areas such as inner Mongolia, northeast, northwest and the like. Human brucellosis also tends to rise, and the epidemic situation of human brucellosis shows obvious occupational, regional and seasonal characteristics, and the human brucellosis can be related to contact infected animals. Therefore, brucellosis in animals must be fundamentally prevented and controlled.
At present, the brucella detection is mainly carried out by using the traditional pathogen isolation culture, serological detection technology, molecular biological detection technology and the like. The traditional detection methods have many limitations, such as tedious process, long period and low efficiency of the conventional biochemical identification; the specificity of the immunodetection is not strong, and the omission is easily caused; RT-PCR requires time-consuming, cumbersome, expensive and inconvenient instruments to carry, and requires professional operation. This makes it particularly important to develop a simple, rapid, and accurate method for field diagnosis of brucellosis. Therefore, it is desirable to provide a specific fragment and a detection method that are simple, rapid, sensitive, and highly specific.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a fluorescent kit and a detection method for detecting brucella.
The technical scheme of the invention is as follows:
a crRNA for detecting brucella, wherein the crRNA is selected from the group consisting of:
crRNA-WT-1: the sequence is shown as SEQ ID NO. 1;
crRNA-Vac-1: the sequence is shown in SEQ ID NO. 2;
crRNA-WT-2: the sequence is shown in SEQ ID NO. 3;
crRNA-Vac-2: the sequence is shown in SEQ ID NO. 4;
crRNA-WT-3: the sequence is shown as SEQ ID NO. 5;
crRNA-Vac-3: the sequence is shown in SEQ ID NO. 6;
crRNA-WT-4: the sequence is shown as SEQ ID NO. 7;
crRNA-Vac-4: the sequence is shown in SEQ ID NO. 8;
crRNA-WT-5: the sequence is shown as SEQ ID NO. 9;
crRNA-Vac-5: the sequence is shown in SEQ ID NO. 10.
A crDNA for detecting brucella, wherein the crDNA is selected from the group consisting of:
crDNA-WT-1: the sequence is shown in SEQ ID NO. 11;
crDNA-Vac-1: the sequence is shown in SEQ ID NO. 12;
crDNA-WT-2: the sequence is shown as SEQ ID NO. 13;
crDNA-Vac-2: the sequence is shown in SEQ ID NO. 14;
crDNA-WT-3: the sequence is shown in SEQ ID NO. 15;
crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16;
crDNA-WT-4: the sequence is shown in SEQ ID NO. 17;
crDNA-Vac-4: the sequence is shown in SEQ ID NO. 18;
crDNA-WT-5: the sequence is shown in SEQ ID NO. 19;
crDNA-Vac-5: the sequence is shown in SEQ ID NO. 20.
A DNA for detecting Brucella, wherein the DNA is selected from the group consisting of:
DNA-WT-1: the sequence is shown as SEQ ID NO. 21;
DNA-Vac-1: the sequence is shown in SEQ ID NO. 22;
DNA-WT-2: the sequence is shown in SEQ ID NO. 23;
DNA-Vac-2: the sequence is shown as SEQ ID NO. 24;
DNA-WT-3: the sequence is shown in SEQ ID NO. 25;
DNA-Vac-3: the sequence is shown as SEQ ID NO. 26;
DNA-WT-4: the sequence is shown as SEQ ID NO. 27;
DNA-Vac-4: the sequence is shown in SEQ ID NO. 28;
DNA-WT-5: the sequence is shown as SEQ ID NO. 29;
DNA-Vac-5: the sequence is shown in SEQ ID NO. 30.
The crRNA-WT and the crRNA-Vac can be obtained through artificial synthesis or transcription by taking the crDNA-WT and the crDNA-Vac as templates, wherein the DNA-WT is a targeting sequence of the crRNA-WT, and the DNA-Vac is a targeting sequence of the crRNA-Vac and is used for detecting and distinguishing a wild strain of the Brucella and a vaccine strain of the Brucella A19.
A fluorescence kit for detecting Brucella is characterized by comprising the crRNA or crDNA.
Preferably according to the invention, the kit further comprises a Cas protein and a fluorescent probe;
further preferably, the Cas protein is a CRISPR-Cas13 protein;
according to the invention, preferably, the 5 terminal of the fluorescent probe sequence is marked with a fluorescent group, and the 3 terminal is marked with a quenching group.
Further preferably, the fluorophore is FAM or ROX; the quenching group is BHQ1 or BHQ 2.
Further preferably, the fluorescent probe ssRNA fluorescent probe and VAC fluorescent probe have the sequence of 5 '-FAM-UUUUUUU-3' BHQ 1; the WT fluorescent probe sequence is 5 '-ROX-UUUUUUU-3' BHQ 2.
A method for detecting Brucella by using the kit comprises the following steps:
(1) extracting a genome of a sample to be detected;
(2) adding the extracted genome of the sample to be detected as a template into a reaction system containing reaction liquid and polymerase to carry out RPA amplification;
(3) respectively establishing a WT detection system and a VAC detection system for RPA amplification products, and incubating for 5-30min at 37 ℃;
(4) respectively placing the WT detection system and the VAC detection system under an LED (light-emitting diode) irradiation lamp, and when the fluorescence development of the detection liquid is red, indicating that the sample to be detected is a wild strain; when the fluorescence development of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when the fluorescence display is not formed, the brucella infection of the sample to be detected does not exist.
Preferably, in step (1), the sample to be tested is bovine whole blood, bovine urine or bovine saliva which is subjected to inactivation treatment at 65-80 ℃ for 10 minutes.
Preferably, in step (2), the primers for RPA amplification are:
forward primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；
reverse primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GACATATACACGGCATTTGATAGGGGACATA-3'；
forward primers for crRNA-WT-2 and crRNA-Vac-2:
5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；
reverse primers for crRNA-WT-2 and crRNA-Vac-2:
5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3'；
forward primers for crRNA-WT-3 and crRNA-Vac-3:
5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；
reverse primers for crRNA-WT-3 and crRNA-Vac-3:
5'-CAGATAAGCGATCAACACACCATTGACCGCG-3'；
forward primers for crRNA-WT-4 and crRNA-Vac-4:
5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；
reverse primers for crRNA-WT-4 and crRNA-Vac-4:
5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3'；
forward primers for crRNA-WT-5 and crRNA-Vac-5:
5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；
reverse primers for crRNA-WT-5 and crRNA-Vac-5:
5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3'。
preferably, in step (2), the RPA amplification system is: RPA basic reaction ball tube, rehydration buffer 29.5 μ L, magnesium acetate buffer 2.5 μ L, forward primer 2.5 μ L, reverse primer 2.5 μ L, the rest is made up with 8 μ L of non-enzyme water, then 5 equal parts are distributed, each 9 μ L part is added with sample to be tested 1 μ L, total volume is 10 μ L.
The amplification conditions were: the reaction temperature is 39-42 ℃, and the incubation time is 5-20 min.
Wherein the RPA-based reaction ball, the rehydration buffer, and the magnesium acetate buffer are from a twist AmpRIn the Basic kit, the RPA Basic reaction ball is a spherical solid and contains components such as recombinase, polymerase and the like.
According toPreferably, in step (3), the WT detection system is the same as the VAC detection system, and specifically, the WT detection system and the VAC detection system are as follows: Tris-HCl (400mM), MgCl2(120mM), ssRNA fluorescent probe (5. mu.M), crRNA 1. mu.L, RNase Inhibitor 1. mu. L, Cas13a protein 2. mu. L, T7 Polymerase 0.5. mu. L, rNTP 0.8.8. mu.L, RPA amplification product 1. mu.L, total volume 20. mu.L.
According to the invention, in the step (4), the LED irradiation lamp is a portable LED irradiation lamp, and the excitation wavelength is 360-450 nm.
The invention is not described in detail in the prior art.
The invention has the technical characteristics that:
the Cas13a protein in the detection system is combined with crRNA (Vac) to form a Cas13a-crRNA (Vac) complex, the complex can specifically recognize the transcription product of DNA (Vac) in the RPA amplification product, if the DNA (Vac) fragment exists in the RPA amplification product, the Cas13a protein is activated, and ssRNA fluorescent reporter group is cut. The cut ssRNA fluorescent reporter group can emit fluorescence after being excited by LED equipment, which indicates that a sample is positive, green fluorescence is emitted to indicate vaccine strain infection, and red fluorescence is emitted to indicate wild strain infection. If no DNA (Vac) fragment exists in the RPA amplification product, Cas13a is not activated, the ssRNA fluorescent reporter group is not cut, and no fluorescence display is formed, which indicates that the sample is negative and the sample does not have Brucella infection.
Has the advantages that:
1. the fluorescent kit for brucella provided by the invention can simultaneously distinguish whether a sample to be detected is a wild strain of the bovine brucella or a brucella A19 vaccine strain, thereby effectively solving the problem that the A19 vaccine strain and the wild strain are respectively identified and distinguished in the prior art. Compared with the traditional detection method, the detection method provided by the invention has the advantages of strong specificity, low detection limit, high sensitivity, low price, simple and quick operation, and convenience in carrying of equipment and instruments, and the detection sensitivity can reach 18 aM.
2. The detection method combines the RPA amplification technology, the CRISPR system and the rapid fluorescence detection technology, reduces mutual interference through reasonable proportioning, enables reaction reagents to still accurately and specifically realize respective functions, combines amplification and detection, obtains results through observation of a portable LED (light-emitting diode) irradiation lamp, ensures that the whole detection process consumes extremely short time, can be finished within 5-30min when qualitative detection is carried out, has simple operation steps, can visually distinguish whether a sample to be detected is a vaccine strain or a wild strain through fluorescence color, and provides a brand-new thought and method for purification of brucellosis.
Drawings
FIG. 1 is a schematic diagram of the detection principle of the fluorescence kit of the present invention.
FIG. 2 is a diagram showing the differential gene analysis of the 113 gene.
FIG. 3 is a diagram showing a differential gene analysis of methylrotonoyl-CoA carboxylase gene.
FIG. 4 is a diagram showing the differential gene analysis of the ABC transporter permase gene.
FIG. 5 is a diagram showing differential gene analysis of MFS transporter gene.
FIG. 6 is a diagram of differential gene analysis of the ribD gene.
FIG. 7 is a photograph showing the results of detection in example 3 of the present invention.
In the figure: the left graph shows the fluorescence detection of wild strains aiming at the five differential genes, the positive result and the negative control result of the red fluorescence detection, and the right graph shows the fluorescence detection of vaccine strains aiming at the five differential genes, and the positive result and the negative control result of the green fluorescence detection.
FIG. 8 is a photograph showing the result of fluorescence detection of green fluorescence by vaccine strains.
FIG. 9 is a graph showing the change of fluorescence detection with time of a vaccine strain microplate reader, and the detection sensitivity (the concentration gradient dilution of brucella genome nucleic acid) can reach 18 aM.
FIG. 10 is a photograph showing the result of fluorescence detection of red fluorescence by wild strains.
FIG. 11 is a graph showing the time-dependent fluorescence detection of wild strain microplate reader, and the detection sensitivity (Brucella genome nucleic acid concentration gradient dilution) can reach 18 aM.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the examples given herein without any inventive step, are within the scope of the present invention.
The CRISPR-Cas13 protein (Beijing Kogao organism) is commercially available in the examples below.
TwistAmpRThe Basic kit is available from TwistDX company.
Example 1 design and acquisition of crRNA and DNA for detection of Brucella
Accession to NCBI, downloading gene sequences from GenBank includes: the genomic bioinformatics analysis and the differential analysis comparison of strains such as a bovine vaccine strain A19, a wild strain representative strain (A13334, 2308, 9-941, 104M, BD, BAB8416, clpP, MC, BJ1 strains) and foreign common vaccine strains (S19, RB51) are carried out, and the analysis results are shown in FIGS. 2-6.
As can be seen from FIGS. 2 to 6, there are differences in gene sequences between the bovine vaccine strain A19, the wild strain representative strain and the foreign common vaccine strains. The present invention found that 5 detection genes were 113 genes, methylotonoyl-CoA carboxylase gene, ABC transporter permase gene, MFS transporter gene and ribD gene, respectively.
Wherein, in the 113 gene region, the specific difference part of the cattle vaccine strain A19 and the wild strain is 2 base insertions, specifically DNA-WT-1 and DNA-Vac-1, the sequences of which are respectively shown as SEQ ID NO.21 and SEQ ID NO.22, wherein the vaccine strain DNA-Vac-1 contains a base CTTTT, and the base corresponding to the wild strain DNA-WT-1 is C-TT. Then, according to the gene sequences of the DNA-WT-1 and the DNA-Vac-1, the crRNA-WT-1 and the crRNA-Vac-1 are designed and obtained, the sequences of the crRNA-WT-1 and the crRNA-Vac-1 are respectively shown as SEQ ID NO.1 and SEQ ID NO.2, the crRNA-WT-1 and the crRNA-Vac-1 designed by the invention contain a partial spacer segment, and the partial segment can be specifically matched with a CTTTT region of a vaccine strain and a co-differential C-TT region of a wild strain. Thereby activating the corresponding Cas protein nuclease activity and cleaving the reporter group in the respective detection system.
The specific difference part of the methylrotonoyl-CoA carboxylase gene region, the bovine vaccine strain A19 and the wild strain is 7 base deletions, specifically DNA-WT-2 and DNA-Vac-2, the sequences of which are respectively shown in SEQ ID NO.23 and SEQ ID NO.24, wherein the vaccine strain DNA-Vac-2 contains a base G- - -A, and the base corresponding to the wild strain DNA-WT-2 is GAGATTTCA. Then, according to the gene sequences of the DNA-WT-2 and the DNA-Vac-2, the crRNA-WT-2 and the crRNA-Vac-2 are designed and obtained, the sequences of the crRNA-WT-2 and the crRNA-Vac-2 are respectively shown as SEQ ID NO.3 and SEQ ID NO.4, the crRNA-WT-2 and the crRNA-Vac-2 designed by the invention contain a partial spacer segment, and the partial segment can be specifically matched with a vaccine strain G- - - - - - - - -A region and a common difference GAGATTTCA region of a wild strain. Thereby activating the corresponding Cas protein nuclease activity and cleaving the reporter group in the respective detection system.
The specific difference part of the ABC transporter permease gene region, the bovine vaccine strain A19 and the wild strain is 68 base deletions, and the specific difference part is DNA-WT-3 and DNA-Vac-3 respectively, the sequences are respectively shown as SEQ ID NO.25 and SEQ ID NO.26, wherein the vaccine strain DNA-WT-3 contains a base GCCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCATCCTTTATTTCC, and the base corresponding to the wild strain DNA-Vac-3 is G- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -. Then designing crRNA-WT-3 and crRNA-Vac-3 according to the gene sequence of DNA-WT-3 and DNA-Vac-3, the sequences are respectively shown as SEQ ID NO.5 and SEQ ID NO.6, the crRNA-WT-3 and the crRNA-Vac-3 designed by the invention contain partial spacer fragments, the partial fragment can be specifically matched with a vaccine strain G-C region and a common difference GCCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCA TCCTTTATTTCC region of a wild strain. Thereby activating the corresponding Cas protein nuclease activity and cleaving the reporter group in the respective detection system.
The specific difference part of the MFS transporter gene region, the bovine vaccine strain A19 and the wild strain is 2 base insertions, specifically DNA-WT-4 and DNA-Vac-4, the sequences of which are respectively shown in SEQ ID NO.27 and SEQ ID NO.28, wherein the vaccine strain DNA-Vac-4 contains a base CCGC, and the base corresponding to the wild strain DNA-WT-4 is C- - -C. Then, according to the gene sequences of the DNA-WT-4 and the DNA-Vac-4, the crRNA-WT-4 and the crRNA-Vac-4 are designed and obtained, the sequences of the crRNA-WT-4 and the crRNA-Vac-4 are respectively shown as SEQ ID NO.7 and SEQ ID NO.8, the crRNA-WT-4 and the crRNA-Vac-4 designed by the invention contain a partial spacer segment, and the partial segment can be specifically matched with a vaccine strain CCGC region and a common difference C-C region of a wild strain. Thereby activating the corresponding Cas protein nuclease activity and cleaving the reporter group in the respective detection system.
The specific difference part of the ribD gene region, the cattle vaccine strain A19 and the wild strain is 2 base insertions, specifically DNA-WT-5 and DNA-Vac-5, the sequences of which are respectively shown as SEQ ID NO.29 and SEQ ID NO.30, wherein the vaccine strain DNA-Vac-5 contains a base TAAAAA, and the base corresponding to the wild strain DNA-WT-5 is T-CAA. Then, according to the gene sequences of the DNA-WT-5 and the DNA-Vac-5, the crRNA-WT-5 and the crRNA-Vac-4 are designed and obtained, the sequences of the crRNA-WT-5 and the crRNA-Vac-4 are respectively shown as SEQ ID NO.9 and SEQ ID NO.10, the crRNA-WT-5 and the crRNA-Vac-5 designed by the invention contain a partial spacer segment, and the partial segment can be specifically matched with a vaccine strain TAAAAA region and a wild strain common difference T-CAA region. Thereby activating the corresponding Cas protein nuclease activity and cleaving the reporter group in the respective detection system.
The specific operation method for obtaining the crRNA-WT and the crRNA-Vac is as follows: respectively carrying out annealing reaction by taking crDNA-WT and crDNA-Vac as templates to form double-stranded DNA, then carrying out agarose gel electrophoresis, recovering and purifying DNA fragments by gel, carrying out transcription to generate RNA under the action of T7 RNA polymerase, recovering and purifying crRNA (WT) and crRNA (Vac), and subpackaging and freezing the purified crRNA-WT and crRNA-Vac to-80 ℃.
Wherein the sequence of the crDNA-WT-1 is shown as SEQ ID NO. 11; crDNA-Vac-1: the sequence is shown in SEQ ID NO. 12; crDNA-WT-2: the sequence is shown as SEQ ID NO. 13; crDNA-Vac-2: the sequence is shown in SEQ ID NO. 14; crDNA-WT-3: the sequence is shown in SEQ ID NO. 15; crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16; crDNA-WT-4: the sequence is shown in SEQ ID NO. 17; crDNA-Vac-4: the sequence is shown in SEQ ID NO. 18; crDNA-WT-5: the sequence is shown in SEQ ID NO. 19; crDNA-Vac-5: the sequence is shown in SEQ ID NO. 20.
An annealing system: the DNA oligo (synthesized primer) to be annealed was prepared to 50. mu.M with sterilized enzyme-free water or redistilled water.
The Annealing Buffer for DNA oligonucleotides (5X) were dissolved and mixed well for use.
Adding various reagents in sequence according to the sequence, and uniformly mixing.
The sequence of the T7 primer is as follows:
5’-GAAATTAATACGACTCACTATAGGG-3’。
the PCR instrument was set up for annealing reactions as follows:
the transcription system is: template DNA 1. mu.g, T7 RNA polymerase mixture 2. mu.L, NTP Buffer Mix 10. mu.L, enzyme-free water make-up, total volume 30. mu.L.
The transcription conditions were: 37 ℃ and 16 h.
Example 2 kit for detecting Brucella
The kit of the embodiment comprises twist AmpRBasic kit, 5 crRNA-WT and crRNA-Vac (SEQ ID NO.1-10) or 5 crDNA-WT and crDNA-Vac (SEQ ID NO.11-20) for detecting brucella, fluorescent probe, CRISPR-Cas13 protein, RPA amplification primer, Tris-HCl (400mM), MgCl2(120mM), ssRNA fluorescent probe (2. mu.M), RNase Inhibitor, T7 Polymerase 0.5. mu. L, rNTP 0.8.8. mu.L.
Wherein the VAC fluorescent probe sequence is 5 '-FAM-UUUUUUU-3' BHQ 1; the WT fluorescent probe sequence is 5 '-ROX-UUUUUUU-3' BHQ 2.
Example 3 method for fluorescence detection of Brucella using the kit described in example 2
20 mu L of bovine blood samples with A19 vaccine strains and non-wild strain genomes, 20 mu L of bovine blood samples with A19 vaccine strains and non-wild strain genomes, and 20 mu L of bovine blood samples without A19 vaccine strains and non-wild strain genomes are taken as samples to be detected respectively, and then 20 mu L of enzyme-free water is taken as a control group to carry out fluorescence detection on the Brucella.
The method comprises the following steps:
(1) pre-inactivating a sample to be detected at 80 ℃ for 10 minutes, adding 20 mu L NP-40 lysate, shaking for 15s to mix uniformly, and heating in a thermostat at 95-99 ℃ for 10min to obtain a genome of the sample to be detected;
(2) adding the extracted genome of the sample to be detected as a template into a reaction system containing reaction liquid and RPA to perform nucleic acid amplification of a target gene;
RPA amplification reaction system: one tube of RPA basic reaction ball, 29.5 mu L of rehydration buffer solution, 2.5 mu L of magnesium acetate buffer solution, 2.5 mu L of forward primer, 2.5 mu L of reverse primer, and 8 mu L of enzyme-free water for the rest to make up to 45 mu L of total volume, then 5 equal parts are distributed, one part of each 9 mu L is added with 1 mu L of sample to be detected, the RPA reaction of five samples can be amplified simultaneously, and each reaction volume is 10 mu L.
The amplification conditions were: the reaction temperature was 40 ℃ and the incubation time was 15 min.
Wherein the RPA basic reaction ball, the rehydration buffer and the magnesium acetate buffer are all from a twist AmpRA Basic kit.
The RPA amplification primer is selected from the following primer pairs (one of five primers is selected):
forward primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；
reverse primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GACATATACACGGCATTTGATAGGGGACATA-3', respectively; corresponding to the 113 gene region.
Forward primers for crRNA-WT-2 and crRNA-Vac-2:
5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；
reverse primers for crRNA-WT-2 and crRNA-Vac-2:
5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3', respectively; corresponding to the region of the methylrotonoyl-CoA carboxylase gene.
Forward primers for crRNA-WT-3 and crRNA-Vac-3:
5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；
reverse primers for crRNA-WT-3 and crRNA-Vac-3:
5'-CAGATAAGCGATCAACACACCATTGACCGCG-3', respectively; corresponding to the ABC transporter permase gene region.
Forward primers for crRNA-WT-4 and crRNA-Vac-4:
5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；
reverse primers for crRNA-WT-4 and crRNA-Vac-4:
5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3', respectively; corresponding to the MFS transporter gene region.
Forward primers for crRNA-WT-5 and crRNA-Vac-5:
5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；
reverse primers for crRNA-WT-5 and crRNA-Vac-5:
5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3', respectively; corresponding to the ribD gene region.
RPA amplification conditions: the reaction temperature is 40 ℃, and the incubation time is 10 min;
wherein the RPA basic reaction ball, the PBS buffer solution and the magnesium acetate buffer solution are all from twist AmpRA Basic kit; RPA amplification is prior art.
(3) Respectively establishing a WT detection system and a VAC detection system by taking the RPA amplification product, and incubating for 20min at 37 ℃;
the WT detection system is the same as the VAC detection system, and specifically comprises the following steps: Tris-HCl (400mM), MgCl2(120mM), ssRNA fluorescent probe (5. mu.M), crRNA-Vac (corresponding to the gene region used for RPA amplification) 1. mu.L, RNase Inhibitor 1. mu. L, Cas13a protein 2. mu. L, T7 Polymerase 0.5. mu. L, rNTP 0.8.8. mu.L, RPA amplification product 1. mu.L, total volume 20. mu.L.
(4) And respectively putting a 20 mu L WT detection system and a 20 mu L VAC detection system under a portable LED (light emitting diode) irradiation lamp with an excitation wavelength of 360-450 nanometers, and developing according to fluorescence to obtain a detection result.
According to the principle of FIG. 1, when the fluorescence development of the detection solution is red, it indicates that the sample to be detected is a wild strain; when the fluorescence development of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when the fluorescence display is not formed, the brucella infection of the sample to be detected does not exist.
Therefore, the detection result of this embodiment is shown in fig. 7. As can be seen from FIG. 7, the detection result of the enzyme-free water was a control group in which no fluorescence was observed (negative group); the fluorescence color of the detection liquid of the bovine blood sample without the A19 vaccine strain and with the wild strain genome is red, and the detection liquid is the wild strain; the fluorescence color of the detection liquid of the bovine blood samples with the A19 vaccine strain and without wild strain genome is green, and the bovine blood samples are vaccine strains; the detection liquid of the bovine blood samples with A19 vaccine strains and wild strain genomes is red and green in fluorescence color development and is mixed infection of the wild strains and the vaccine strains.
EXAMPLE 4 sensitivity testing of fluorescent kits
The kit in the embodiment 3 is adopted to carry out fluorescence detection of the brucella fluorescence detection method by an enzyme-labeling instrument.
And (3) taking the MFS transporter gene as a Brucella detection gene to carry out sensitivity detection on the sample genome.
The specific method comprises the following steps: taking a vaccine strain and a wild strain as samples to be detected, extracting the genome of the sample to be detected according to the method in the embodiment 3, and performing concentration gradient dilution on the extracted genome, wherein the dilution gradient is as follows: 180fM, 18fM, 1.8fM, 180aM, 18aM, 1.8aM, 180 ZM. The kit in example 3 is used for carrying out a brucella fluorescence detection method to establish a vaccine strain (Vac) and a wild strain (WT) detection system, the 20 μ L WT detection system and the 20 μ L Vac detection system are respectively added into a 384-hole holo-black enzyme label plate (three repeated concentration gradients), an enzyme label reader (brand Thermo, model LUX) is used for carrying out fluorescence detection, and the wild strain is excited at an excitation wavelength (excitation wavelength): 575nm, emission wavelength (emision wavelength): 602 nm; the vaccine strain uses excitation wavelength (excitation wavelength): 495nm, emission wavelength (emision wavelength): 521 nm. The results are shown in FIGS. 8 to 11.
As can be seen from FIGS. 8 and 9, the fluorescence development of the vaccine strain detection solution is green, and the detection sensitivity can reach 18 aM; as can be seen from FIGS. 10 to 11, the fluorescence development of the wild strain detection solution is red, and the detection sensitivity can reach 18 aM. Compared with the traditional detection method, the detection method provided by the invention has the advantages of strong specificity, low detection limit, high sensitivity, low price, simple and quick operation and convenience in carrying of equipment and instruments, and the detection sensitivity can reach 18 aM.
SEQUENCE LISTING
<110> university of inner Mongolia
<120> fluorescent kit and detection method for detecting brucella
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 64
<212> RNA
<213> Artificial sequence
<400> 1
gauuuagacu accccaaaaa cgaaggggac uaaaacuugu cuuuugccug cgacaaaagg 60
ggcu 64
<210> 2
<211> 64
<212> RNA
<213> Artificial sequence
<400> 2
gauuuagacu accccaaaaa cgaaggggac uaaaaccuuu ugccugcgac aaaaaagggg 60
cuug 64
<210> 3
<211> 64
<212> RNA
<213> Artificial sequence
<400> 3
gauuuagacu accccaaaaa cgaaggggac uaaaacuucu gaaaucugaa aucucgacgc 60
gcag 64
<210> 4
<211> 64
<212> RNA
<213> Artificial sequence
<400> 4
gauuuagacu accccaaaaa cgaaggggac uaaaacaugc cgguucugaa aucucgacgc 60
gcag 64
<210> 5
<211> 64
<212> RNA
<213> Artificial sequence
<400> 5
gauuuagacu accccaaaaa cgaaggggac uaaaacauga ugccgaauuc cugcaagguc 60
acgc 64
<210> 6
<211> 64
<212> RNA
<213> Artificial sequence
<400> 6
gauuuagacu accccaaaaa cgaaggggac uaaaacauga gcaccacggc ccagaccggc 60
cagc 64
<210> 7
<211> 64
<212> RNA
<213> Artificial sequence
<400> 7
gauuuagacu accccaaaaa cgaaggggac uaaaacuggu ggccgggcuu uauacggugg 60
gccu 64
<210> 8
<211> 64
<212> RNA
<213> Artificial sequence
<400> 8
gauuuagacu accccaaaaa cgaaggggac uaaaacggcc gggcuuuaua cgcggugggc 60
cuug 64
<210> 9
<211> 64
<212> RNA
<213> Artificial sequence
<400> 9
gauuuagacu accccaaaaa cgaaggggac uaaaaccaga ucauucaaug ucgcuuuuga 60
acgc 64
<210> 10
<211> 64
<212> RNA
<213> Artificial sequence
<400> 10
gauuuagacu accccaaaaa cgaaggggac uaaaacucaa ugucgcuuuu uuuaacgcgg 60
aaau 64
<210> 11
<211> 89
<212> DNA
<213> Artificial sequence
<400> 11
agcccctttt gtcgcaggca aaagacaagt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 12
<211> 89
<212> DNA
<213> Artificial sequence
<400> 12
caagcccctt ttttgtcgca ggcaaaaggt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 13
<211> 89
<212> DNA
<213> Artificial sequence
<400> 13
ctgcgcgtcg agatttcaga tttcagaagt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 14
<211> 89
<212> DNA
<213> Artificial sequence
<400> 14
ctgcgcgtcg agatttcaga accggcatgt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 15
<211> 89
<212> DNA
<213> Artificial sequence
<400> 15
gcgtgacctt gcaggaattc ggcatcatgt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 16
<211> 89
<212> DNA
<213> Artificial sequence
<400> 16
gctggccggt ctgggccgtg gtgctcatgt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 17
<211> 89
<212> DNA
<213> Artificial sequence
<400> 17
aggcccaccg tataaagccc ggccaccagt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 18
<211> 89
<212> DNA
<213> Artificial sequence
<400> 18
caaggcccac cgcgtataaa gcccggccgt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 19
<211> 89
<212> DNA
<213> Artificial sequence
<400> 19
gcgttcaaaa gcgacattga atgatctggt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 20
<211> 89
<212> DNA
<213> Artificial sequence
<400> 20
atttccgcgt taaaaaaagc gacattgagt tttagtcccc ttcgtttttg gggtagtcta 60
aatcccctat agtgagtcgt attaatttc 89
<210> 21
<211> 160
<212> DNA
<213> Brucella melitensis
<400> 21
ttgccgcatc ttcttgcgta cggcttcatt ttattcccgg tccatttaca cctaacggct 60
gtatagagga atgcaagccc cttttgtcgc aggcaaaaga caaagtctct cattccgtca 120
caaactagtt atgtccccta tcaaatgccg tgtatatgtc 160
<210> 22
<211> 162
<212> DNA
<213> Brucella melitensis
<400> 22
ttgccgcatc ttcttgcgta cggcttcatt ttattcccgg tccatttaca cctaacggct 60
gtatagagga atgcaagccc cttttttgtc gcaggcaaaa gacaaagtct ctcattccgt 120
cacaaactag ttatgtcccc tatcaaatgc cgtgtatatg tc 162
<210> 23
<211> 139
<212> DNA
<213> Brucella melitensis
<400> 23
cgtcgattgc cgccagcatg gccttgcggt tggcctcgaa gcttgcgctg cgcgtcgaga 60
tttcagattt cagaaccggc atcaacgggt ctcctgaaag agttcccgtc cgatcagcat 120
acgccggatt tccgacgtg 139
<210> 24
<211> 132
<212> DNA
<213> Brucella melitensis
<400> 24
cgtcgattgc cgccagcatg gccttgcggt tggcctcgaa gcttgcgctg cgcgtcgaga 60
tttcagaacc ggcatcaacg ggtctcctga aagagttccc gtccgatcag catacgccgg 120
atttccgacg tg 132
<210> 25
<211> 205
<212> DNA
<213> Brucella melitensis
<400> 25
gctcgtcatc ctcaatggcg gcatcgacct ttcggtcggc tccacgctgg ggctggccgg 60
tgtggtcgcg ggcttcctga tgcagggcgt gaccttgcag gaattcggca tcatccttta 120
tttcccggtc tgggccgtgg tgctcatcac ctgcgcgctc ggcgccttcg tcggcgcggt 180
caatggtgtg ttgatcgctt atctg 205
<210> 26
<211> 137
<212> DNA
<213> Brucella melitensis
<400> 26
gctcgtcatc ctcaatggcg gcatcgacct ttcggtcggc tccacgctgg ggctggccgg 60
tctgggccgt ggtgctcatc acctgcgcgc tcggcgcctt cgtcggcgcg gtcaatggtg 120
tgttgatcgc ttatctg 137
<210> 27
<211> 167
<212> DNA
<213> Brucella melitensis
<400> 27
aatgaaggct gcattggcgg aggcaagttc gcgtcccgtc agctcagacc ccagatgcgc 60
aaggcccacc gtataaagcc cggccaccac gccgccccac aggaacagaa tgcctgccat 120
gaaataccag tgctgcatga ggtagggcag cgccatcatg ccgatga 167
<210> 28
<211> 169
<212> DNA
<213> Brucella melitensis
<400> 28
aatgaaggct gcattggcgg aggcaagttc gcgtcccgtc agctcagacc ccagatgcgc 60
aaggcccacc gcgtataaag cccggccacc acgccgcccc acaggaacag aatgcctgcc 120
atgaaatacc agtgctgcat gaggtagggc agcgccatca tgccgatga 169
<210> 29
<211> 134
<212> DNA
<213> Brucella melitensis
<400> 29
atgagctgac ggtttccgag accggcgata atctggaaac gtagaatggg cgccagcgaa 60
tttccgcgtt caaaagcgac attgaatgat ctgcgcttca tggaagcgac gatccgttat 120
gcgcgccgtc acaa 134
<210> 30
<211> 136
<212> DNA
<213> Brucella melitensis
<400> 30
atgagctgac ggtttccgag accggcgata atctggaaac gtagaatggg cgccagcgaa 60
tttccgcgtt aaaaaaagcg acattgaatg atctgcgctt catggaagcg acgatccgtt 120
atgcgcgccg tcacaa 136
Claims (10)
1. A crRNA for detecting brucella, wherein the crRNA is selected from the group consisting of:
crRNA-WT-1: the sequence is shown as SEQ ID NO. 1;
crRNA-Vac-1: the sequence is shown in SEQ ID NO. 2;
crRNA-WT-2: the sequence is shown in SEQ ID NO. 3;
crRNA-Vac-2: the sequence is shown in SEQ ID NO. 4;
crRNA-WT-3: the sequence is shown as SEQ ID NO. 5;
crRNA-Vac-3: the sequence is shown in SEQ ID NO. 6;
crRNA-WT-4: the sequence is shown as SEQ ID NO. 7;
crRNA-Vac-4: the sequence is shown in SEQ ID NO. 8;
crRNA-WT-5: the sequence is shown as SEQ ID NO. 9;
crRNA-Vac-5: the sequence is shown in SEQ ID NO. 10.
2. A crDNA for detecting brucella, wherein the crDNA is selected from the group consisting of:
crDNA-WT-1: the sequence is shown in SEQ ID NO. 11;
crDNA-Vac-1: the sequence is shown in SEQ ID NO. 12;
crDNA-WT-2: the sequence is shown as SEQ ID NO. 13;
crDNA-Vac-2: the sequence is shown in SEQ ID NO. 14;
crDNA-WT-3: the sequence is shown in SEQ ID NO. 15;
crDNA-Vac-3: the sequence is shown as SEQ ID NO. 16;
crDNA-WT-4: the sequence is shown in SEQ ID NO. 17;
crDNA-Vac-4: the sequence is shown in SEQ ID NO. 18;
crDNA-WT-5: the sequence is shown in SEQ ID NO. 19;
crDNA-Vac-5: the sequence is shown in SEQ ID NO. 20.
3. A DNA for detecting Brucella, wherein the DNA is selected from the group consisting of:
DNA-WT-1: the sequence is shown as SEQ ID NO. 21;
DNA-Vac-1: the sequence is shown in SEQ ID NO. 22;
DNA-WT-2: the sequence is shown in SEQ ID NO. 23;
DNA-Vac-2: the sequence is shown as SEQ ID NO. 24;
DNA-WT-3: the sequence is shown in SEQ ID NO. 25;
DNA-Vac-3: the sequence is shown as SEQ ID NO. 26;
DNA-WT-4: the sequence is shown as SEQ ID NO. 27;
DNA-Vac-4: the sequence is shown in SEQ ID NO. 28;
DNA-WT-5: the sequence is shown as SEQ ID NO. 29;
DNA-Vac-5: the sequence is shown in SEQ ID NO. 30.
4. A fluorescent kit for detecting brucella, comprising the crRNA of claim 1 or the crDNA of claim 2.
5. The fluorescent kit for detecting brucella as recited in claim 4, wherein the kit comprises a Cas protein and a fluorescent probe; the Cas protein is a CRISPR-Cas13 protein.
6. The fluorescence kit for detecting brucella abortus as claimed in claim 4, wherein 5 terminal of the fluorescence probe sequence is labeled with a fluorescent group, and 3 terminal is labeled with a quenching group;
the fluorophore is FAM or ROX; the quenching group is BHQ1 or BHQ 2;
further preferably, the fluorescent probe ssRNA fluorescent probe and VAC fluorescent probe have the sequence of 5 '-FAM-UUUUUUU-3' BHQ 1; the WT fluorescent probe sequence is 5 '-ROX-UUUUUUU-3' BHQ 2.
7. A method for detecting Brucella by using the kit of claim 4, which comprises the following steps:
(1) extracting a genome of a sample to be detected;
(2) adding the extracted genome of the sample to be detected as a template into a reaction system containing reaction liquid and polymerase to carry out RPA amplification;
(3) respectively establishing a WT detection system and a VAC detection system for RPA amplification products, and incubating for 5-30min at 37 ℃;
(4) respectively placing the WT detection system and the VAC detection system under an LED (light-emitting diode) irradiation lamp, and when the fluorescence development of the detection liquid is red, indicating that the sample to be detected is a wild strain; when the fluorescence development of the detection liquid is green, the sample to be detected is an A19 vaccine strain; when the fluorescence display is not formed, the brucella infection of the sample to be detected does not exist.
8. The detection method according to claim 7, wherein in the step (1), the sample to be detected is bovine whole blood, bovine urine or bovine saliva which has been subjected to a pre-inactivation treatment at 65 to 80 ℃ for 10 minutes.
9. The detection method according to claim 7, wherein in the step (2), the primers for RPA amplification are:
forward primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GAAATTAATACGACTCACTATAGGGTTGCCGCATCTTCTTGCGTACGGCTTCATTT-3'；
reverse primers for crRNA-WT-1 and crRNA-Vac-1:
5'-GACATATACACGGCATTTGATAGGGGACATA-3'；
forward primers for crRNA-WT-2 and crRNA-Vac-2:
5'-GAAATTAATACGACTCACTATAGGGCGTCGATTGCCGCCAGCATGGCCTTGCGGTT-3'；
reverse primers for crRNA-WT-2 and crRNA-Vac-2:
5'-CACGTCGGAAATCCGGCGTATGCTGATCGGA-3'；
forward primers for crRNA-WT-3 and crRNA-Vac-3:
5'-GAAATTAATACGACTCACTATAGGGGCTCGTCATCCTCAATGGCGGCATCGACCTT-3'；
reverse primers for crRNA-WT-3 and crRNA-Vac-3:
5'-CAGATAAGCGATCAACACACCATTGACCGCG-3'；
forward primers for crRNA-WT-4 and crRNA-Vac-4:
5'-GAAATTAATACGACTCACTATAGGGAATGAAGGCTGCATTGGCGGAGGCAAGTTCG-3'；
reverse primers for crRNA-WT-4 and crRNA-Vac-4:
5'-TCATCGGCATGATGGCGCTGCCCTACCTCAT-3'；
forward primers for crRNA-WT-5 and crRNA-Vac-5:
5'-GAAATTAATACGACTCACTATAGGGATGAGCTGACGGTTTCCGAGACCGGCGATAA-3'；
reverse primers for crRNA-WT-5 and crRNA-Vac-5:
5'-TTGTGACGGCGCGCATAACGGATCGTCGCTT-3'；
the RPA amplification system is as follows: RPA basic reaction ball, rehydrating buffer solution 29.5 μ L, magnesium acetate buffer solution 2.5 μ L, forward primer 2.5 μ L, reverse primer 2.5 μ L, and supplementing the rest with non-enzyme water 8 μ L, then distributing 5 equal parts, adding sample to be tested 1 μ L each 9 μ L, and total volume 10 μ L;
the amplification conditions were: the reaction temperature is 39-42 ℃, and the incubation time is 5-20 min;
wherein the RPA-based reaction ball, the rehydration buffer, and the magnesium acetate buffer are from a twist AmpRIn the Basic kit, the RPA Basic reaction ball is a spherical solid and contains components such as recombinase, polymerase and the like.
10. The method according to claim 7, wherein in step (3), the WT detection scheme and the VAC detection scheme are the same, specifically: Tris-HCl (400mM), MgCl2(120mM), ssRNA fluorescent probe (5. mu.M), crRNA 1. mu.L, RNase Inhibitor 1. mu. L, Cas13a protein 2. mu. L, T7 Polymerase 0.5. mu. L, rNTP 0.8.8. mu.L, RPA amplification product 1. mu.L, total volume 20. mu.L; in the step (4), the LED irradiation lamp is a portable LED irradiation lamp, and the excitation wavelength is 360-450 nanometers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111327518.2A CN114015792B (en) | 2021-11-10 | 2021-11-10 | Fluorescent kit for detecting Brucella and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111327518.2A CN114015792B (en) | 2021-11-10 | 2021-11-10 | Fluorescent kit for detecting Brucella and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114015792A true CN114015792A (en) | 2022-02-08 |
| CN114015792B CN114015792B (en) | 2023-07-07 |
Family
ID=80063139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111327518.2A Active CN114015792B (en) | 2021-11-10 | 2021-11-10 | Fluorescent kit for detecting Brucella and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114015792B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116004870A (en) * | 2023-01-30 | 2023-04-25 | 内蒙古大学 | Kit and detection method for detecting and identifying Brucella |
| CN116042878A (en) * | 2023-01-30 | 2023-05-02 | 内蒙古大学 | Kit and detection method for detecting and distinguishing Brucella |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018489A (en) * | 2015-08-07 | 2015-11-04 | 山东省农业科学院奶牛研究中心 | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 |
| CN111778342A (en) * | 2020-08-14 | 2020-10-16 | 新疆畜牧科学院兽医研究所（新疆畜牧科学院动物临床医学研究中心） | Primers, probe and kit for identifying Brucella vaccine strain and wild strain |
| CN112322764A (en) * | 2020-12-11 | 2021-02-05 | 武汉博杰生物医学科技有限公司 | Detection kit and detection method for brucella |
| CN113025734A (en) * | 2021-03-19 | 2021-06-25 | 广东省农业科学院动物卫生研究所 | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application |
-
2021
- 2021-11-10 CN CN202111327518.2A patent/CN114015792B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018489A (en) * | 2015-08-07 | 2015-11-04 | 山东省农业科学院奶牛研究中心 | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 |
| CN111778342A (en) * | 2020-08-14 | 2020-10-16 | 新疆畜牧科学院兽医研究所（新疆畜牧科学院动物临床医学研究中心） | Primers, probe and kit for identifying Brucella vaccine strain and wild strain |
| CN112322764A (en) * | 2020-12-11 | 2021-02-05 | 武汉博杰生物医学科技有限公司 | Detection kit and detection method for brucella |
| CN113025734A (en) * | 2021-03-19 | 2021-06-25 | 广东省农业科学院动物卫生研究所 | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116004870A (en) * | 2023-01-30 | 2023-04-25 | 内蒙古大学 | Kit and detection method for detecting and identifying Brucella |
| CN116042878A (en) * | 2023-01-30 | 2023-05-02 | 内蒙古大学 | Kit and detection method for detecting and distinguishing Brucella |
| CN116004870B (en) * | 2023-01-30 | 2024-07-19 | 内蒙古大学 | Kit and detection method for detecting and identifying Brucella |
| CN116042878B (en) * | 2023-01-30 | 2024-07-23 | 内蒙古大学 | Kit and detection method for detecting and distinguishing Brucella |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114015792B (en) | 2023-07-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111187856B (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| WO2016188144A1 (en) | Str locus fluorescent labeling multiplex amplification kit having enhanced identification capability and use thereof | |
| CN109468384B (en) | Composite amplification detection kit for simultaneously detecting 45Y loci | |
| CN113637778B (en) | Kit and method for detecting brucella | |
| CN112322764B (en) | Detection kit and detection method for brucella | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| CN110551853A (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN114015792B (en) | Fluorescent kit for detecting Brucella and detection method | |
| CN110373502B (en) | Complete set of nucleic acid, kit and detection method for detecting Hantaan virus by RPA | |
| CN111394515B (en) | LAMP primer group, fluorescence visualization rapid kit and method for detecting canine parvovirus | |
| CN103952497B (en) | A kind of hepatitis B virus detecting method based on DNAzyme probes | |
| CN116144803A (en) | Rapid detection method for salmonella based on LAMP-CRISPR/Cas12a system | |
| CN116042878B (en) | Kit and detection method for detecting and distinguishing Brucella | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN113046476A (en) | Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus | |
| CN116042879A (en) | Kit and detection method for detecting brucella wild strain and vaccine strain | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN116004870B (en) | Kit and detection method for detecting and identifying Brucella | |
| CN114250311A (en) | CDA primer group and kit for detecting spotted fever group rickettsia and application of CDA primer group and kit | |
| CN115181803A (en) | Taqman probe qPCR detection primer group for detecting chaulmoogra and application | |
| CN111778343A (en) | Primer pair and kit for detecting Brucella S2 vaccine strain and application of primer pair and kit | |
| CN108913790B (en) | Recombinase polymerase isothermal amplification method for detecting coxiella burnetii, special primer and probe and application | |
| CN111270015A (en) | Primer composition, kit and method for detecting CSFV and PRRSV | |
| KR20200092653A (en) | Universal Primer Sets for Detecting Flavivirus and Use Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |