CN113046476A - Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus - Google Patents

Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus Download PDF

Info

Publication number
CN113046476A
CN113046476A CN202110049559.3A CN202110049559A CN113046476A CN 113046476 A CN113046476 A CN 113046476A CN 202110049559 A CN202110049559 A CN 202110049559A CN 113046476 A CN113046476 A CN 113046476A
Authority
CN
China
Prior art keywords
primer
seq
set forth
pna probe
primer composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110049559.3A
Other languages
Chinese (zh)
Inventor
曹国君
邢志芳
许笑
关明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
North Campus Huashan Hospital Affiliated To Fudan University
Original Assignee
North Campus Huashan Hospital Affiliated To Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by North Campus Huashan Hospital Affiliated To Fudan University filed Critical North Campus Huashan Hospital Affiliated To Fudan University
Priority to CN202110049559.3A priority Critical patent/CN113046476A/en
Publication of CN113046476A publication Critical patent/CN113046476A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a primer composition and a kit for rapidly detecting N501Y mutation of a novel coronavirus, wherein the primer composition comprises a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 7 is shown in the specification; the primer group comprises an F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer or an LF primer, and is selected from primers comprising sequences shown as SEQ ID NO: 2-6, comprising a polypeptide having a sequence set forth in SEQ ID NO: 3. 5 and 8-10, comprising a polypeptide having a sequence set forth in SEQ ID NO: 11-15 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 16 to 20 in one or more groups. The primer composition and the kit for rapidly detecting the N501Y mutation of the novel coronavirus are developed based on the LAMP technology, the specificity is good, the sensitivity is high, complex and expensive auxiliary equipment is not needed, the rapid detection of the nucleic acid molecular marker can be realized within 30-60min, the detection result can be directly judged by a visual method, and the application prospect is good.

Description

Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
Technical Field
The invention relates to the technical field of biological detection, in particular to a primer composition and a kit for rapidly detecting N501Y mutation of a novel coronavirus.
Background
Coronavirus (CoV), known for its encapsidation surface with a corona coronarium-like spinous process, is a respiratory virus widely found in nature, and its host includes humans, vertebrates and invertebrates. The coronavirus belongs to the order of Toxoviridae, the family of Coronaviridae, the genus of Coronaviridae, is a positive strand single-stranded RNA virus with an envelope, the diameter is 80-120 nm, the coronavirus is composed of about 3 ten thousand basic groups, and the genetic material of the coronavirus is the largest of the known RNA viruses. The international committee for the classification and nomenclature of viruses classified coronaviruses into four groups of α, β, γ, δ in 2012 according to their genetic differences and serological properties, with the β group CoV further classified into A, B, C, D four groups. The alpha and beta groups of susceptible mammals comprise 7 kinds of coronavirus which are pathogenic to human beings and are respectively HCoV-OC43, HCoV-229E, SARS-CoV, HCoV-NL63, HCoV-HKU1, MERS-CoV and SARS-CoV-2; whereas both γ and δ groups primarily infect birds. Coronavirus is a common pathogen which is easy to cause respiratory diseases, and among viruses causing pneumonia acquired in adult communities, the detection rate of coronavirus is similar to that of other respiratory viruses. SARS-CoV-2 infection not only threatens the life safety of human beings, but also causes great loss to the global social economy, and people need to be 'unhatched', actively deal with the unhappy situation, carry out deep research on epidemiology and pathogenic mechanism, actively research and develop novel specific drugs and vaccines, develop more effective detection means, kill coronavirus in 'cradle' stage, and protect the health of human beings.
The N501Y mutation is an amino acid variation in the spike protein (S protein) of the emerging new coronavirus, i.e., the amino acid residue at position 501 of the virus S protein is changed from asparagine to tyrosine. The N501Y mutation may increase the affinity of the virus for the ACE2 receptor on the surface of human cells, enhance the infectivity of new coronavirus, the virus is more likely to invade cells, and scientists speculate that the infectivity of the mutant strain appearing in the United kingdom is increased by 70%. Therefore, the rapid detection of SARS-CoV-2 and the timely understanding of the main stream mutation of the virus strain are of great significance to the prevention and control of epidemic situations, the diagnosis and treatment of diseases, the research and development of vaccines, and the like.
The reverse transcription real-time PCR technology is considered as a 'gold standard' for SARS-CoV-2 detection at present, however, the technology is complex to operate, has a slow amplification speed (2-3 hours), can be carried out in a laboratory with high requirements, requires expensive detection equipment, and needs trained professional technicians to carry out detection, so that the technology is difficult to popularize, and is particularly difficult to popularize in remote and laggard areas with weak infrastructure. The loop-mediated isothermal amplification (LAMP) technology is used for specifically, efficiently and rapidly amplifying target nucleic acid under the constant temperature condition of 60-65 ℃ by utilizing four pairs of designed special primers and Bst DNA polymerase (with strand displacement property) with continuous displacement activity. However, the LAMP technology is not adopted to detect the mutation of the novel coronavirus N501Y at present.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a primer composition and a kit for rapidly detecting the mutation of a novel coronavirus N501Y.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer composition for rapidly detecting a mutation of a novel coronavirus N501Y, which comprises a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 7 is shown in the specification;
the primer group comprises a F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer or an LF primer, and is selected from primers comprising sequences shown as SEQ ID NO: 2-6, comprising a polypeptide having a sequence set forth in SEQ ID NO: 3. 5 and 8-10, comprising a polypeptide having a sequence set forth in SEQ ID NO: 11-15 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 16 to 20 in one or more groups.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 2-6 and the sequence is shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 3. 5 and 8-10 and the sequences are shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 11-15 and the sequence of the primer is shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
Further, the primer composition comprises a primer with a sequence shown as SEQ ID NO: 16-20 primers and sequences are shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
In a second aspect, the present invention provides an amplification system for rapid detection of a mutation in the novel coronavirus N501Y, which comprises the primer composition, a template, a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
Further, in the above amplification system, the final concentration of the F3 primer and the B3 primer was 0.2. mu. mol/L; the final concentration of the FIP primer and the BIP primer is 1.6 mu mol/L; the final concentration of the LB primer and the LF primer is 0.8 mu mol/L; the final concentration of PNA probe was 0.8. mu. mol/L.
Further, the amplification system with a total volume of 25. mu.L comprised the following components: 2 × reaction buffer 12.5 μ L, F3 primer 1 μ L, B3 primer 1 μ L, FIP primer 1 μ L, BIP primer 1 μ L, LF primer or LB primer 1 μ L, PNA probe 1 μ L, 8U enzyme solution 1 μ L, neutral red dye 1 μ L, deionized water 2.5 μ L, template 2 μ L.
Further, the reaction condition of the amplification system is 58-68 ℃ and 30-60 min; the equipment used is a common PCR instrument or a constant temperature metal bath.
In a second aspect, the present invention provides a kit for rapidly detecting a mutation of the novel coronavirus N501Y, which comprises the primer composition, a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:
the primer composition and the kit for rapidly detecting the N501Y mutation of the novel coronavirus are developed based on the LAMP technology, the specificity is good, the sensitivity is high, complex and expensive auxiliary equipment is not needed, the rapid detection of the nucleic acid molecular marker can be realized within 30-60min, the detection result can be directly judged by a visual method, and the application prospect is good.
Drawings
FIG. 1 shows a result graph of the sensitivity of the detection LAMP detection system in one embodiment of the present invention; from right to left, 3 × 101copies/ml，3×102copies/ml，3×103copies/ml，3×104copies/ml， 3×105copies/ml，3×106copies/ml，3×107Positive mock samples of copies/ml;
FIG. 2 is a graph showing the results of fluorescence detection of the sensitivity of the LAMP detection system in one embodiment of the present invention;
FIG. 3 is a graph showing the results of detecting the specificity of the LAMP detection system in one embodiment of the present invention; from right to left are: influenza a virus RNA, influenza b virus RNA, rhinovirus RNA, respiratory syncytial virus RNA, non-N501Y mutant novel coronavirus RNA, very weak positive control, and weak positive control;
FIG. 4 is a diagram showing the result of specific fluorescence detection of the LAMP detection system in one embodiment of the present invention.
Detailed Description
The sequence of the N501Y type mutation of the novel coronavirus is shown as follows, wherein the 201 st base is subjected to A-T mutation:
TAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATA ATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAG ATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTG AAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTTA TGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCT ACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTA AAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTT CTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGAC ATT(SEQ ID NO:1)。
aiming at the target gene fragment, the invention provides a primer composition for rapid detection by LAMP technology, which comprises a PNA probe, a F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer or an LF primer, wherein the PNA probe is adopted to seal a non-specific template (wild nucleic acid) in an amplification system so as to improve the specificity of the LAMP detection system; specific sequence information is shown in table 1 below:
TABLE 1 sequence information of primer composition for rapid detection of mutations in N501Y of novel coronavirus
Figure RE-GDA0003070882600000041
Figure RE-GDA0003070882600000051
Figure RE-GDA0003070882600000061
The present invention will be described in detail and specifically with reference to the following examples and drawings so as to provide a better understanding of the invention, but the following examples do not limit the scope of the invention.
In the examples, the conventional methods were used unless otherwise specified, and reagents used were those conventionally commercially available or formulated according to the conventional methods without specifically specified.
Example 1
The present example provides a kit for rapidly detecting the mutation of the novel coronavirus N501Y, which contains the primer composition, and further comprises a template, a reaction buffer, an enzyme solution, a neutral red dye and deionized water.
The total volume of the LAMP amplification system prepared by the kit in use is 25 muL, and the kit comprises the following components in volume: 2 Xreaction buffer (RM) 12.5. mu.L, F3 primer (final concentration 0.2. mu. mol/L) 1. mu.L, B3 primer (final concentration 0.2. mu. mol/L) 1. mu.L, FIP primer (final concentration 1.6. mu. mol/L) 1. mu.L, BIP primer (final concentration 1.6. mu. mol/L) 1. mu.L, LF primer or LB primer (final concentration 0.8. mu. mol/L) 1. mu.L, PNA probe (final concentration 0.8. mu. mol/L) 1. mu.L, enzyme solution (8U) 1. mu.L, neutral red dye 1. mu.L, deionized water 2.5. mu.L, template 2. mu.L.
The LAMP reaction conditions of the LAMP amplification system are as follows: at 58-68 ℃ for 30-60 min; the used equipment is equipment which can stably provide constant temperature of 65 ℃ such as a common PCR instrument or a constant temperature metal bath.
Judging the result of detecting the mutation of the novel coronavirus N501Y by using the kit: after the reaction, the reaction solution was judged to be positive when the color of the reaction solution changed from pale yellow to red.
Verification examples
This example examined the sensitivity and specificity of the amplification system (wherein the primer composition was the first primer set of Table 1 above) and the kit provided in example 1, and the specific steps and experimental results are as follows:
1. sensitivity: constructing TA cloning plasmid containing target segment, mixing the recombinant plasmid with throat swab sample of healthy person to make simulation sample with gradient concentration of 3 × 101copies/ml，3×102copies/ml， 3×103copies/ml，3×104copies/ml，3×105copies/ml，3×106copies/ml，3×107The results of detection of copies/ml using the LAMP amplification system are shown in FIG. 1.
In addition, SYBR was added to the amplification system of the above-mentioned mock samples of different concentrations at the same time, and real-time fluorescence detection was performed on an AB 7300PCR instrument, and the results are shown in fig. 2.
As can be seen from FIGS. 1 to 2, the detection sensitivity can reach 3X 102copies/ml。
2. Specificity: the established LAMP amplification system is adopted to treat common clinical respiratory tract pathogens: influenza a virus RNA, influenza b virus RNA, rhinovirus RNA, respiratory syncytial virus RNA, and novel coronavirus RNA that is not mutated at N501Y were amplified, and the results are shown in fig. 3.
SYBR was added to the amplification system for each viral RNA and the positive control simultaneously, and real-time fluorescence detection was performed on an AB 7300PCR instrument, the results of which are shown in FIG. 4.
As can be seen from FIGS. 3 to 4, none of the viral RNAs undergoes non-specific amplification, indicating that the established LAMP detection system has good specificity.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
Sequence listing
<110> North yard of Huashan Hospital affiliated to Fudan university
<120> primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 407
<212> DNA
<213> sequence of novel coronavirus N501Y type mutation
<400> 1
tagcttggaa ttctaacaat cttgattcta aggttggtgg taattataat tacctgtata 60
gattgtttag gaagtctaat ctcaaacctt ttgagagaga tatttcaact gaaatctatc 120
aggccggtag cacaccttgt aatggtgttg aaggttttaa ttgttacttt cctttacaat 180
catatggttt ccaacccact tatggtgttg gttaccaacc atacagagta gtagtacttt 240
cttttgaact tctacatgca ccagcaactg tttgtggacc taaaaagtct actaatttgg 300
ttaaaaacaa atgtgtcaat ttcaacttca atggtttaac aggcacaggt gttcttactg 360
agtctaacaa aaagtttctg cctttccaac aatttggcag agacatt 407
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<400> 2
acaatcttga ttctaaggtt gg 22
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
actactactc tgtatggttg g 21
<210> 4
<211> 50
<212> DNA
<213> Artificial sequence
<400> 4
cggcctgata gatttcagtt gaaatttacc tgtatagatt gtttaggaag 50
<210> 5
<211> 43
<212> DNA
<213> Artificial sequence
<400> 5
gtagcacacc ttgtaatggt gttgcaacac cataagtggg ttg 43
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<400> 6
tctctctcaa aaggtttgag attag 25
<210> 7
<211> 11
<212> DNA
<213> Artificial sequence
<400> 7
gtgattacca c 11
<210> 8
<211> 25
<212> DNA
<213> Artificial sequence
<400> 8
gttggtggta attataatta cctgt 25
<210> 9
<211> 50
<212> DNA
<213> Artificial sequence
<400> 9
cggcctgata gatttcagtt gaaatagatt gtttaggaag tctaatctca 50
<210> 10
<211> 26
<212> DNA
<213> Artificial sequence
<400> 10
tgttactttc ctttacaatc atatgg 26
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence
<400> 11
cctgtataga ttgtttagga agt 23
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
tggtgcatgt agaagttcaa 20
<210> 13
<211> 44
<212> DNA
<213> Artificial sequence
<400> 13
gtgtgctacc ggcctgatag ctaatctcaa accttttgag agag 44
<210> 14
<211> 48
<212> DNA
<213> Artificial sequence
<400> 14
tacaatcata tggtttccaa cccaagaaag tactactact ctgtatgg 48
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence
<400> 15
cttatggtgt tggttacca 19
<210> 16
<211> 18
<212> DNA
<213> Artificial sequence
<400> 16
atggtttcca acccactt 18
<210> 17
<211> 19
<212> DNA
<213> Artificial sequence
<400> 17
gccaaattgt tggaaaggc 19
<210> 18
<211> 42
<212> DNA
<213> Artificial sequence
<400> 18
gttgctggtg catgtagaag tttggttacc aaccatacag ag 42
<210> 19
<211> 48
<212> DNA
<213> Artificial sequence
<400> 19
tgtgtcaatt tcaacttcaa tggttagaaa ctttttgtta gactcagt 48
<210> 20
<211> 15
<212> DNA
<213> Artificial sequence
<400> 20
taacaggcac aggtg 15

Claims (10)

1. A primer composition for rapidly detecting N501Y mutation of a novel coronavirus is characterized by comprising a primer group and a PNA probe; the sequence of the PNA probe is shown as SEQ ID NO: 7 is shown in the specification;
the primer group comprises an F3 primer, a B3 primer, a FIP primer, a BIP primer and an LB primer or an LF primer, and is selected from primers comprising sequences shown as SEQ ID NO: 2-6, comprising a polypeptide having a sequence set forth in SEQ ID NO: 3. 5 and 8-10, comprising a polypeptide having a sequence set forth in SEQ ID NO: 11-15 and compositions comprising a polypeptide having a sequence set forth in SEQ ID NO: 16 to 20 in one or more groups.
2. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 2-6 and the sequence is shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
3. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 3. 5 and 8-10 and the sequences are shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
4. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 11-15 and the sequence of the primer is shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
5. The primer composition of claim 1, wherein the primer composition comprises the sequence set forth in SEQ ID NO: 16-20 primers and sequences are shown as SEQ ID NO: 7, or a PNA probe as shown in figure 7.
6. An amplification system for rapid detection of N501Y mutation in a novel coronavirus comprising the primer composition as defined in any one of claims 1 to 5, further comprising a template, a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
7. The amplification system of claim 6, wherein the final concentration of the F3 primer and the B3 primer in the amplification system is 0.2 μmol/L; the final concentration of the FIP primer and the BIP primer is 1.6 mu mol/L; the final concentration of the LB primer and the LF primer is 0.8 mu mol/L; the final concentration of PNA probe was 0.8. mu. mol/L.
8. The amplification system of claim 7, wherein the amplification system comprises the following components in a total volume of 25 μ L: 2 × reaction buffer 12.5 μ L, F3 primer 1 μ L, B3 primer 1 μ L, FIP primer 1 μ L, BIP primer 1 μ L, LF primer or LB primer 1 μ L, PNA probe 1 μ L, 8U enzyme solution 1 μ L, neutral red dye 1 μ L, deionized water 2.5 μ L, template 2 μ L.
9. The amplification system of claim 6, wherein the reaction conditions of the amplification system are 58-68 ℃ for 30-60 min; the equipment used is a common PCR instrument or a constant temperature metal bath.
10. An amplification system kit for rapidly detecting the mutation of the novel coronavirus N501Y, comprising the primer composition as defined in any one of claims 1 to 5, wherein the kit further comprises a reaction buffer, an enzyme solution, a neutral red dye and/or a fluorescent dye, and deionized water.
CN202110049559.3A 2021-01-14 2021-01-14 Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus Pending CN113046476A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110049559.3A CN113046476A (en) 2021-01-14 2021-01-14 Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110049559.3A CN113046476A (en) 2021-01-14 2021-01-14 Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus

Publications (1)

Publication Number Publication Date
CN113046476A true CN113046476A (en) 2021-06-29

Family

ID=76508306

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110049559.3A Pending CN113046476A (en) 2021-01-14 2021-01-14 Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus

Country Status (1)

Country Link
CN (1) CN113046476A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114410840A (en) * 2022-01-10 2022-04-29 广州达安基因股份有限公司 Kit for detecting novel coronavirus and N501Y mutation site thereof and detection method
CN114561493A (en) * 2022-03-08 2022-05-31 武汉兰丁云医学检验实验室有限公司 Method for detecting N501Y mutant variants of new coronavirus rapidly

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164473A (en) * 2017-05-22 2017-09-15 复旦大学附属华山医院 The Primer composition and kit of a kind of type of detection CALR genes 1 mutation
CN111057798A (en) * 2020-01-20 2020-04-24 复旦大学附属华山医院 LAMP primer combination and kit for detecting novel coronavirus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164473A (en) * 2017-05-22 2017-09-15 复旦大学附属华山医院 The Primer composition and kit of a kind of type of detection CALR genes 1 mutation
CN111057798A (en) * 2020-01-20 2020-04-24 复旦大学附属华山医院 LAMP primer combination and kit for detecting novel coronavirus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GUOJUN CAO等: "Rapid detection of CALR type 1 and type 2 mutations using PNA-LNA clamping loop-mediated isothermal amplification on a CD-like microfluidic chip", 《ANALYTICA CHIMICA ACTA》 *
KATHY LEUNG等: ""Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom", 《EURO SURVEIL》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114410840A (en) * 2022-01-10 2022-04-29 广州达安基因股份有限公司 Kit for detecting novel coronavirus and N501Y mutation site thereof and detection method
CN114561493A (en) * 2022-03-08 2022-05-31 武汉兰丁云医学检验实验室有限公司 Method for detecting N501Y mutant variants of new coronavirus rapidly

Similar Documents

Publication Publication Date Title
CN110551853B (en) Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain
CN106947838B (en) African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method
CN113046475B (en) Primer composition and kit for rapidly detecting mutant novel coronavirus
CN111187856A (en) Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof
CN112322764B (en) Detection kit and detection method for brucella
CN111057783B (en) Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme constant-temperature rapid amplification technology and application thereof
CN108676920B (en) Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof
CN113025748A (en) Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus
CN111979303A (en) Nucleic acid detection kit, method and application thereof
WO2022257663A1 (en) Method and kit for detecting and screening n501y mutation in covid-19
NL2031171B1 (en) Primer, Probe and Application for Identifying Brucella Vaccine Strain A 19 and Wild Strain
CN113249499B (en) Salmonella typhi detection kit, and preparation method and application thereof
CN113046476A (en) Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
CN111748651B (en) Kit for detecting nucleic acid of respiratory tract pathogen, detection method and application
CN110724769A (en) PCR primer group, kit and detection method for detecting African swine fever virus MGF360-505R gene
EP2597162A1 (en) Nucleic acid detection
CN113846185A (en) Primer composition and kit for rapid detection of new coronavirus E484K/Q, K417N/T variation
NL2031160B1 (en) Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
CN114134218B (en) Fluorescent detection method based on CRISPR-Cas12a
CN116042878A (en) Kit and detection method for detecting and distinguishing Brucella
CN115896316A (en) Tuberculosis detection method
CN115029345A (en) Nucleic acid detection kit based on CRISPR and application thereof
CN112708658B (en) Liquid chip primer group for detecting multiple drug-resistant genes and application thereof
CN111500774B (en) Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit
CN109762941B (en) Liquid chip for detecting poultry death pathogen

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20210629