NL2031171B1 - Primer, Probe and Application for Identifying Brucella Vaccine Strain A 19 and Wild Strain - Google Patents

Abstract

Disclosed is a primer, probe and application for identifying Bruce/la vaccine strain A19 and wild strain, belonging to the field of gene detection. The primers include an upstream primer shown in SEQ ID NO: 1 and a downstream primer shown in SEQ ID NO: 2. The nucleotide sequence of the probe is shown in SEQ ID NO: 3. According to the invention, the primers and probes are used for fluorescence detection, so that Bruce/la A19 (S19) vaccine strain and wild strain can be distinguished rapidly, with high throughput, high sensitivity and specificity.

Description

Primer, Probe and Application for Identifying Brucella Vaccine Strain A19 and Wild Strain

TECHNICAL FIELD The invention relates to the technical field of gene detection, and relates to a primer, probe and application for identifying Brucella vaccine strain A19 and wild strain, in particular to a primer probe, kit, application and method for quickly distinguishing Brucella vaccine strain A19 and wild strain.

BACKGROUND Brucellosis is a zoonotic infectious disease caused by Brucella. According to its pathogenicity and host selectivity, it can be divided into at least 10 species, among which Brucella melitensis from sheep, Brucella abortus from cattle and Brucella suis from pig are the most infectious. This bacterium can infect human beings, cattle, sheep, pigs and other animals. In recent years, the epidemic situation of brucellosis in China is grim, which has caused serious harm to human health and the development of animal husbandry. Due to the serious harm and prevalence of brucellosis, there are serious safety hazards in meat, milk and other products, which greatly affect the foreign trade of cattle, sheep, pigs and other animal products, and seriously threaten human health. The National Medium and Long - term Animal Disease Prevention and Control Plan (2012 - 2020) and the Animal Epidemic Prevention Law of the People's Republic of China (Decree No.69 of the President of the People's Republic of China) classify it as a second - class animal disease. At present, prevention - oriented epidemic prevention measures are mainly adopted in China, and the varieties of Brucella live vaccine approved for production in China mainly include: A19 strains of Brucella bovis, S2 strains of Brucella suis, M5 strains of Brucella ovis and M5 - 90 strains, etc. The A19 vaccine strain currently used in China is S19 strain introduced from the Soviet Union in the 1950 s. Compared with A19 vaccine strain, S19 vaccine strain currently used in the world has a 702bp sequence deletion in erythritol operon, but it is sensitive to erythritol, and its genome nucleotide similarity is 99.9%. S19 vaccine strain is homologous to A19 vaccine strain used in China. (Shuyi Wang, Wenlong Wang, Ke Sun, HuheBateer, XueliangZhao. Comparative genomic analysis between newly sequenced Brucella abortus vaccine strain A19 and another Brucella abortus vaccine S19[J]. Genomics, 2020, 112 (2): 1444 - 1453.) The National Brucellosis Prevention and Control Plan (2016 - 2020) implements regional management of livestock brucellosis prevention and control, and the Ministry of Agriculture and the National Health and Family Planning Commission divide the whole country into three types of regions, with the first type of regions adopting the prevention and control strategy based on immunization, the second type of regions adopting the prevention and control strategy based on monitoring and purification, and the third type of regions adopting the prevention and control strategy based on risk prevention. In view of the interference of vaccine immunization in a class of areas (15 provinces and Xinjiang Production and Construction Corps) on the detection of wild bacterial infection, it is of great significance to establish a detection method to distinguish vaccine strains from wild bacterial strains. At present, the reported methods to differentiate and detect vaccine strain A19 and wild strain are MGB probe method aiming at single nucleotide polymorphism (SNP) locus detection. (Gopaul K K, Sells J, Bricker B J, et al. Rapid and Reliable Single Nucleotide Polymorphism - Based Differentiation of Brucella Live Vaccine Strains from Field Strains[J]. Journal of Clinical Microbiology, 2010, 48(4):1461 - 4.) and Cycling probe method (Tan Pengfei. Establishment of differential diagnosis method between Brucella vaccine strain and wild strain based on PCR [D]. Yangzhou University, 2012.). However, both of the two methods require double probes, and the cost of detection and typing is high, so it is necessary to develop typing detection methods with lower detection cost and wider application value.

SUMMARY The purpose of the present invention is to provide primers, probes and applications for identifying Brucella vaccine strain A19 and wild strain, so as to solve the problems existing in the prior art. Through the provided primer pair and one probe, the rapid, high - throughput, high - sensitivity and specific distinction between Brucella vaccine strain A19(S19) and wild strain can be realized.

To achieve the above objective, the present invention provides the following schemes.

The invention provides a primer and probe for identifying Brucella vaccine strain A19 and wild strain, wherein the primer comprises an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2; The nucleotide sequence of the probe is shown in SEQID NO: 3.

Preferably, the 5' end of the probe nucleotide sequence is connected with a fluorescent group and the 3' end is connected with a quenching group, and the fluorescent group is selected from any one of FAM, HEX, VIC, CY5 and TET; The quenching group is selected from any one of BHQ series and TAMRA series.

The invention also provides a kit comprising the primer and the probe.

The invention also provides an application of the primer and probe or the kit in quickly distinguishing Brucella A19 vaccine strain and wild strain.

The invention also provides a method for identifying Brucella vaccine strain A19 and wild strain, which comprises the steps of amplifying the sample DNA template with the primer and probe described in 1 to obtain amplification products, and analysing the melting curve of the amplification products to determine the type of the sample bacterium.

Further, the melting curve analysis procedure is: denaturation at 95°C for 10 s; The fluorescence signals of probes were continuously collected at the rate of 0.13°C/s from 37°C to 97°C for 5 times/°C, and the melting curve was analysed.

The melting curve analysis includes the following analysis processes: A) in the detection of probe, taking pA19 standard sample as control, if the absolute value of TM value of sample melting temperature and pA19 control melting temperature is less than

1.0°C, it is judged as Brucella vaccine strain A19; B) In the detection of probes, if the melting temperature of the sample is 8.07 + 1°C higher than the TM value of the pA 19 standard sample as the control, it is determined as Brucella wild strain.

Preferably, the amplification system includes the following components: Luna Universal Probe QCPR Master Mix 5.0 pl, upstream primer 0.8 pl, downstream primer 0.4 pl, probe 0.4 ul, template 1.0 pul and DDH20 2.4 pl.

Preferably, the amplification reaction conditions are: pre - denaturation at 95°C for 1 min; Denaturing at 95°C for 15 s and annealing at 60°C for 30 s; Cycle 55 times.

In addition, according to actual needs, technicians in the field can also use other conventional methods in the field to detect based on the teachings of the present invention, such as PCR technology, fluorescence quantitative PCR technology, loop - mediated isothermal amplification technology, etc.

The invention discloses the following technical effects.

1) the invention establishes a primer and probe for quickly identifying Brucella A19(S19) vaccine strain and wild strain for the first time, and a fluorescence detection method, which can realize the identification and detection of Bruceila A19(S19) vaccine strain and wild strain with only one probe, and the operation is very simple; The whole operation process can be completed within 2 hours without pure culture of Brucella, which greatly shortens the time required for identification and detection of Brucella A19(S19) vaccine strain and wild strain, and has the characteristics of high detection speed and high throughput.

2) The primers disclosed by the invention can specifically amplify Brucella A19(S19) vaccine strain and wild strain, which is helpful to improve the amplification efficiency of PCR and reduce the detection time of Brucella, The probe can specifically hybridize with the nucleic acid locus of Brucella A19(S19) vaccine strain, and the specificity is good. The primer and probe are not combined with other common nucleic acids of porcine bacterial diseases, which is beneficial to improve the accuracy of result analysis.

3) The fluorescence detection method for quickly distinguishing Brucella A19(519) vaccine strain and wild strain disclosed by the invention has the lowest detection limit of single copy and high sensitivity.

BRIEF DESCRIPTION OF THE FIGURES

In order to more clearly explain the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention, and for ordinary technicians in the field, other drawings can be obtained according to these drawings without paying creative labour.

Fig. 1 is the comparison result of SNP locus in the probe region of Brucella A19(S19) vaccine strain and wild strain, and the name numbers in the figure are NCBI registration number - type - strain name in turn; Fig. 2 is a melting graph of the standardized sample fluorescence detection method of the present invention, in which pA19 and pW are used as positive standards and water is used as negative control; Fig. 3 is a melting graph of specificity test of fluorescence detection method of the present invention; Among them, Brucella vaccine A19 strain, Brucella bovis 544A strain, Brucella suis 1330 s strain, Brucella ovis 16M strain, Escherichia coli, Pasteurella suis, Streptococcus suis, Pseudomonas aeruginosa and Actinobacillus pleuropneumoniae were used as specific detection samples, pA19 and pW were positive standards, and water was negative control.

Fig. 4 is a melting graph of sensitivity test of fluorescence detection method of the present invention; Among them, pA19 and pW standard plasmids were diluted by 10 times ratio of 1.0 x 108 - 1.0 x 10° copies/pl to ensure 1.0 x 103 - 1.0 x 10° copies/reaction and analytical sensitivity.

Fig. 5 is a melting graph of clinical samples detected by fluorescence detection method of the present invention; among them, there are 9 clinical samples, including 5 bovine serum and 4 milk. PA19 and pW were used as positive standard and water as negative control.

Fig. 6 is a comparison result diagram of sequencing probe regions of positive samples of the present invention.

DESCRIPTION OF THE INVENTION The technical scheme of the present invention will now be described in detail by way of examples, but it should not be considered as a limitation of the present invention, but rather as a more detailed description of some aspects, characteristics and embodiments of the present invention.

Unless otherwise specified, the test methods used in the following examples are conventional methods. Materials and reagents used, unless otherwise specified, are commercially available reagents and materials.

Example 1 Design and screening of primers and probes After screening a large number of designed primers and probes, it is found that the fluorescence method of primer pair F, R and probe P has the best effect in distinguishing Brucella A19(S19) vaccine strain and wild strain, and its base sequence is as follows.

Primer F: 5' - CATCGATGTGCCGTTCATCATG - &' (SEQ ID NO: 1); Primer R: 5' - CACATCTTCGCCGACATAGC - 3 (SEQ ID NO: 2); probe P: 5' - ATGCGACGACGCTGACGCAAGCC -3' (SEQ ID NO: 3). The fluorescent group FAM is labelled at the 5' end of probe P, and the quenching group 5 BHQ1 is labelled at the 3' end of probe P. As shown in Figure 1, there is only one SNP locus (C18G) between Brucella A19(S19) vaccine strain and wild strain at the position of probe P. Example 2 Preparation of Standard Sample, Fluorescence PCR Amplification and Melting Curve Analysis

1. Preparation of standard samples In order to verify that feasibility and reliability of the method of the invention, a standard positive sample is prepared to provide a positive control for subsequent method establishment, sensitivity, specificity test, and the like.

Accord to that probe sequence alignment analysis in figure 1, the sequences of the brucella A19 (S19) vaccine strain corresponding to the probe p are grouped into one group, and the other wild strains are group into another.

The Brucella A19 vaccine use in that invention and the genomic nucleic acid of the wild strain representative strain 544A are donated by the China veterinary drug supervision institute.

Using nucleic acid of A19{S19) vaccine and genomic nucleic acid of wild strain 544A as templates, respectively, the following primer pairs are used: CF. 5 - GTTCTGTCGGTTGCGGTTCA - 3 (SEQ ID NO: 4), CR: 5 - GCTCGGCGTAGATGTATAGCG - 3’ (SEQ ID NO: 5) and Premix Ex - Taq amplified nucleic acid fragments with the size of 982bp respectively, and then cloned into PMD18T vector, named pA19 and pW in turn, and set them as positive reference substance of A19(S19) vaccine strain and positive reference substance of Brucella wild strain, respectively, for subsequent tests and kit assembly.

2. Operating steps of fluorescent PCR for positive standard samples Using the above two positive standard samples as DNA templates, fluorescent PCR amplification reaction and melting curve analysis were carried out respectively.

The PCR reaction system is shown in Table 1.

Table 1 PCR reaction system sample = Dose "Luna Universal Probe qPCR Master Mix 5.0ul 14M primer F 0.8 ul 10 uM primer R 0.4 ul 10 uM probe P 0.4 pl Template 1.0 ul ddH2O 2.4 Jl The PCR reaction conditions are: 95°C pre - denaturation for 1 min; Denaturing at 95°C for 15 s and annealing at 60°C for 30 s; Cycle 55 times.

Melting curve analysis program: denaturation at 95°C for 10 s; From 37°C to 97°C, FAM fluorescence signals were continuously collected at the rate of 0.13°C/s for 5 times/°C, and the melting curve was analysed.

3. Analysis results of melting curve of positive standard samples PCR products were analysed by Light Cycler 96 analyser. The melting curve analysis results of two Brucella positive standard samples are shown in Figure 2.

It is easy to know from Figure 2 that the melting curves of pA19 and pW standard samples are separated from each other, and the melting temperatures (Tm) of the two positive standard samples are different, that is, pA19 is 74.58 + 0.26°C and pW is 66.51 + 0.5°C, which indicates that the designed primers F, R and probe P are suitable for melting curve analysis of Brucella A19 vaccine strain and wild strain.

Example 3 Specific experiment Genomic nucleic acids of Brucella vaccine A19, Brucella bovis 544A, Brucella suis 1330 s and Brucella ovis 16M donated by China Veterinary and Drug Administration were selected respectively. And other common pathogens of pig bacterial diseases isolated and preserved in our laboratory: Escherichia coli, Pasteurella, Streptococcus suis, Pseudomonas aeruginosa, Actinobacillus pleuropneumoniae.

The above bacterial nucleic acid was extracted by DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the extracted nucleic acid and water (negative control) were used as PCR templates, and analysed by PCR amplification reaction and melting curve analysis method in Example 2, and compared with positive standard samples pA19 and pW. The melting curve peaking diagram is shown in Figure 3.

It can be seen from fig. 3 that the detection method provided by the invention can only specifically amplify Brucella positive standard samples and form a melting peak, while other swine disease - related bacteria, such as Escherichia coli, Pasteurella multocida, Streptococcus suis, Pseudomonas aeruginosa and Actinobacillus pleuropneumoniae, have not amplified specific melting peaks. The results show that the primers F, R and probe P have good specificity, and can be used for fluorescent detection of typing of Brucella A19 vaccine strain and wild strain.

Example 4 Sensitivity experiment The standard pA19 and pW prepared in Example 2 were diluted 10 times gradient to form

1.0x 108 1.0 x 107, 1.0 x 108, 1.0 x 105, 1.0 x 10%, 1.0 x 103, 1.0 x 102, 1.0 x 10%, 1.0 x 10° copies/pl with 9 gradients, analysed according to the fluorescence PCR amplification reaction and melting curve analysis method in Example 2 above, and the melting curve peak type diagram is shown in Figure 4.

It is easy to know from fig. 4 that by analysing the melting curve of sensitivity test of fluorescence detection method of positive plasmids pA19 and pW, it can be seen that the fluorescence signal of this detection method decreased obviously with the decrease of nucleic acid concentration, and the number of plasmids was as low as 1.0 copy/ul, and the corresponding fluorescence signal could also be detected in FAM channel. The above results fully show that the detection method of the present invention has high sensitivity.

Example 5 fluorescent PCR amplification and melting curve analysis of clinical samples 1) Extraction of viral nucleic acid from samples: take 5 samples of bovine serum and 4 samples of milk collected clinically, and extract genomic DNA with DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

2) Using the extracted sample genomic nucleic acid as template, the method is the same as that of fluorescence PCR amplification reaction and melting curve analysis in Example 2 above; At the same time, the positive standards pA19 and pW described in Example 2 were used as positive controls.

3) Analysis results of melting curve of clinical samples The amplified products of fluorescent PCR were analysed by Light Cycler 96 analyser. The invention has detected 9 clinical samples, and the analysis result of melting curve is shown in Figure 5.

It can be seen from the melting curve chart of the fluorescence detection method of clinical samples in fig. 5 that when the melting curve of pA19 standard sample is used as a control, when the absolute value of TM value of the melting peak between the sample to be detected and the positive control pA19 is less than 1.0°C, it is judged as Brucella A19(S19) vaccine strain; If the absolute value of TM of the melting temperature of the sample to be detected and the positive control pA19 is 8.07 + 1°C, it is judged as Brucella wild strain. Therefore, 9 clinical samples were all negative for Brucella.

Comparative example 1 clinical sample validation analysis 1) The samples tested in Examples 4 and 5 were tested by ordinary PCR, in which the primers were: CF. 5 - GTTCTGTCGGTTGCGGTTCA - 3 (SEQ ID NO: 4); CR: 5" - GCTCGGCGTAGATGTATAGCG -3' (SEQ ID NO: 5). The PCR reaction system is shown in Table 2. Table 2 PCR reaction system Sample Dose ddH0 6.4 pl Premix Ex - Taq 10.0 ul uM primer ASwaiF 0.8 HI 10 uM primer ASwaiR 0.8 HI Template 2.0 ul Total volume 20 ul 10 ss PCR amplification reaction conditions are: 95°C pre - denaturation for 3 min; Denaturation at 95°C for 40 s, annealing at 53°C for 1min and extension at 72°C for 7min; Cycle 35 times. The amplified PCR product is 982bp in size, and then electrophoresis gel is recovered and sent to sequencing company for sequencing.

Sequencing results showed that the positive samples were genomic nucleic acids of Brucella vaccine A19 strain, Brucella bovis 544A strain, Brucella suis 1330 s strain and Brucella ovis 16M strain. Five serum samples and four milk samples collected clinically are all negative for Brucella. The sequencing results show that the probe region of Brucella vaccine A19 strain is consistent with the probe, and other positive samples have SNP locus C18G (as shown in Figure 8). The results are consistent with the typing results of the detection method established by the present invention. However, compared with the two methods, the sequencing method takes longer time, the detection procedure is more complicated, and high throughput cannot be achieved; and the invention is simple and feasible to operate, and can realize rapid and high throughput detection.

The above - mentioned embodiments only describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, all kinds of modifications and improvements made by ordinary technicians in the field to the technical scheme of the present invention should fall within the protection scope determined by the claims of the present invention.

Sequence list <110> Institute of Animal Health, Guangdong Academy of Agricultural Sciences <110> Maoming Branch Center of Guangdong Laboratory for LingNan Modern Agricultural Science and Technology <120> Primer, Probe and Application for Identifying Brucella Vaccine Strain A19 and Wild Strain <130> SHX-Brucella A19 NL <150> CN202110295989.3 <151> 2021-03-19 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <400> 1 catcgatgtg ccgttcatca tg 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequenc <400> 2 cacatcttcg ccgacatagc

<210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 atgcgacgac gctgacgcaa gcc 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gttctgtcgg ttgcggttca 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 gctcggcgta gatgtatagc g 21

Claims (7)

CONCLUSIONS A set of primers and a probe for distinguishing between a Brucella vaccine strain A19 and a wild strain, the primers being an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO. : 2 include; and the probe has a nucleotide sequence as shown in SEQ ID NO: 3. The set of primers and a probe for distinguishing between a Brucella vaccine strain A19 and a wild strain according to claim 1, wherein the 5' end of the nucleotide sequence of the probe is linked to a fluorescent group and the 3'- terminal is attached to a quencher group, and the fluorescent one is selected from FAM, HEX, VIC, CY5 and TET; and the extinguishing group is selected from one of the BHQ and the TAMRA series. A composite set comprising the set of primers and the probe of claim 1 or claim 2. Use of the set of primers and a probe according to claim 1 or claim 2 or the composite set according to claim 3 for rapidly distinguishing between a Brucella A19 vaccine strain and a wild strain. A method for distinguishing between a Brucella vaccine strain A19 and a wild strain, which method comprises the steps of amplifying the DNA template from the sample with set of primers and the probe as described in claim 1 to obtain amplification products and analyzing the melting curve of the amplification products to determine the type of the bacteria in the sample. 6. The method of claim 5, wherein the amplification system comprises the following components: Luna Universal Probe QCPR Master Mix 5.0 µl Upstream Primer 0.8 µl Downstream Primer 0.4 µl, Probe 0.4 µl, Template 10 µl DDHz0 2, 4 yl. The method of claim 5, wherein the conditions for amplification are: predenaturation at 95°C for 1 min; denaturation at 95°C for 15 s and annealing of the strands at 60°C for 30 s; wherein this cycle is performed 55 times.