KR102044683B1 - Pepetide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same - Google Patents

Abstract

The present invention relates to a peptide nucleic acid (PNA) probe for detecting Coxiella burnetii and a Coxiella burnetii detection method using the same. More specifically, according to the present invention, a Coxiella burnetii gene is amplified by using a PNA probe represented as a base sequence selected from groups consisting of sequence numbers 4 to 6, and a primer represented as the sequence numbers 1 and 3. The amplified gene is hybridized with the PNA probe, and Coxiella burnetii is detected through a melting curve analysis of the hybridized material. Accordingly, the PNA probe can detect Coxiella burnetii, which is a cause bacillus of Q-fever, at higher sensitivity and correctness than that of a conventional polymerase chain reaction (PCR) method, and can easily discriminate false positiveness, thereby being useful for Q-fever diagnosis.

Description

Peptide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same}

The present invention Coxiella Bernetti ( Coxiella burnetii ) The present invention relates to a PNA probe for detecting and a method for detecting Cocciella Bernetti using the same, and more specifically, to a PNA probe represented by a nucleotide sequence selected from the group consisting of SEQ ID NOs: 4 to 6 and represented by SEQ ID NOs: 1 and 3 Amplification of the Cocciella verteti gene using a primer, and hybridized with the PNA probe, and relates to a method for detecting Cocciella verteti through its melting curve analysis.

In 2015, MERS experienced enormous social and economic damages in Korea, and the public's interest in the acquired common infectious diseases that can spread from animals such as SARS and Middle East Respiratory Syndrome (MERS) has recently increased.

The cue fever, which is a common infectious disease, has also increased in humans in recent years and has been confirmed in animals. Pathogens are mediated by ticks and are accompanied by symptoms such as chills, sweat, boredom and diarrhea, and are known to cause miscarriage in animals. Meanwhile, Coxiella burnetii , a causative agent of cue fever, is released into the external environment in large quantities to spread to humans and animals. Therefore, in order to prevent the spread of cue fever, It is important to identify the discharged entity and take measures such as containment.

Coxiella burnetii is a bacterium of the Rickettsia River rickettsia, which is transmitted by ticks and is transmitted by ingesting milk from carrier animals (cows, sheep, goats, etc.) or by breathing infected dust. do. Pneumonia is a common and complication that can lead to endocarditis.

In order to diagnose the infection of Coxiella burnetii , the step of culturing is mainly required. For the cultivation, a method of using cell culture or oocytes has been used for a long time, but BL-3 which can prevent infection of the experimenter There was a problem that the above facilities are required and the incubation period also requires several weeks. In order to overcome this problem, PCR (Polymerase Chain Reaction), a genetic test method, has been developed and continuously studied. The PCR test is faster than the culture method, but the nonspecific reaction and the possibility of cross-contamination between the positive control group and the sample due to various factors are pointed out as disadvantages (Kazar J, Ann NY Acad Sci. 2005, Vol. , pp. 105-14.).

PNA is an abbreviation of peptide nucleic acids and is artificially synthesized as one of gene recognition materials such as LNA (Locked Nucleic Acid) and MNA (Morpholino Nucleic Acid), and its basic skeleton is composed of polyamide. In the case of PNA, it is a material with national competitiveness as a domestic source patent. PNA has excellent affinity and selectivity, and high stability against nuclease, so it is not decomposed by existing restriction enzyme. Does not have features. In addition, there is an advantage that the thermal properties and chemical properties are high and easy to store and not easily decomposed. PNA-DNA binding ability is much better than DNA-DNA binding force, and thus, even one nucleotide miss match differs by about 10 to 15 ° C. at the melting temperature. By using such a difference in binding force, it is possible to effectively detect nucleic acid changes of SNP and In / Del.

PNA probe hybridization method (Fluorescence Melting Curve Analysis) is mainly used as a method of analysis, and FMCA analyzes the difference in the binding force between the product produced after the PCR reaction and the inserted probe by Tm. . Unlike other SNP detection probes, the design of the probe is very simple, so it is manufactured using 9-15 mer nucleotide sequences including SNP, and in order to design a probe having a desired Tm value, the Tm value is adjusted according to the length of the PNA probe. In addition, even PNA probes of the same length can be changed by adjusting the Tm value. PNA has the advantage of being able to design with shorter length than DNA because PNA has better binding force than DNA, so it can detect even neighboring SNPs. In addition, the conventional high resolution melting (HRM) method has a very small difference in Tm value of about 0.5 ° C., which requires additional analysis programs or detailed temperature changes, making it difficult to analyze when two or more SNPs appear. It is not affected by other SNPs, so there is an advantage that accurate analysis is possible.

Therefore, the present inventors have diligently tried to develop a fast and accurate method for detecting Cocciella Bernetti. As a result, the samples were amplified with a primer for amplifying the IS1111 gene of Cocciella Bernetti, and then hybridized with a gene-specific probe to produce a melting curve. In the analysis, it was confirmed that Cocciella Bernetti can be detected quickly and accurately and the present invention was completed.

Kazar J, Ann N Y Acad Sci. 2005, Vol. 1063, pp. 105-14.

It is an object of the present invention to provide novel PNA probes, compositions and kits for detecting Cocciella Bernetti, and to provide a Cocciella Bernetti detection method using the PNA probe.

In order to achieve the above object, the invention provides any of the koksi Ella member geneticin (Coxiella burnetii) detecting PNA probe represented by a nucleotide sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 6.

The present invention also provides a PNA probe; And Coxiella Bernice ( Coxiella) comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: burnetii ) provides a composition for detection.

The present invention also provides koksi Ella member geneticin (Coxiella burnetii) detection kit comprising said composition.

The present invention also comprises the steps of (a) amplifying a target nucleic acid from a sample using a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3;

(b) hybridizing the amplification product with the PNA probe; And

(c) a Coxiella burnetii detection method comprising analyzing a melting curve of the hybridized reactant.

The PNA probe according to the present invention can detect Cocciella verteti, a causative agent of Q-fever, with high sensitivity and high accuracy, compared to the conventional PCR method, and is also useful in diagnosing false positives. Can be utilized.

1 is a schematic diagram showing the binding position in the IS1111 gene of the primer and PNA probe according to the present invention.
FIG. 2 is a schematic diagram of a standard synthesized for the detection limit test of primers and PNA probes according to the present invention and a control synthesized to determine whether false positives are determined according to contamination during the test.
Figure 3 is a graph showing the amplification conditions and melting curve analysis conditions of the specific gene of Coxiella burnetii ( Coxiella burnetii ).
4 is a graph showing the melting curve analysis results of the synthetic standard and the control according to the present invention.
5 is a graph evaluating the analytical sensitivity of the PNA probe according to the present invention using a standard.
6 is a photograph comparing a conventional PCR method and a diagnostic method using a PNA probe according to the present invention using a clinical sample.
Figure 7 is a determination table of the queue sequence diagnostic kit using the primer, PNA probe, synthetic control according to the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In the present invention, when the IS1111 gene, which is known to be closely related to cocciella verteti detection, is detected by the PNA probe, cocciella verteti can be detected only by analyzing the melting curve without going through a complicated process. That is, in one embodiment of the present invention, when designing a PNA probe that specifically binds to the Cocciella Bernetti IS1111 gene, and analyzes the melting curve using the same, the genotype of the gene is analyzed only by analyzing the melting curve without additional analysis. It was confirmed that can be determined.

Therefore, the present invention relates to an in one aspect, koksi Ella member geneticin detecting PNA probe (Coxiella burnetii) represented by any one base sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 6.

In the present invention, the PNA probe may be characterized in that it is hybridized with the IS1111 gene.

In the present invention, the PNA probe may be characterized in that a reporter and a quencher are coupled. The PNA probe including the reporter and the quencher hybridizes with the target nucleic acid and generates a fluorescence signal. As the temperature increases, the PNA probe rapidly melts with the target nucleic acid at an appropriate melting temperature of the probe to extinguish the fluorescence signal. The presence or absence of target nucleic acid can be detected through high resolution melting curve analysis obtained from the fluorescence signal.

PNA (Peptide Nucleic Acid) is one of gene recognition materials like Locked Nucleic Acid (LNA) and Mopholino Nucleic Acid (MNA). It is artificially synthesized and the basic skeleton is composed of polyamide. PNA has very high affinity and selectivity, and has high stability against nucleases, so that it is not degraded by existing restriction enzymes. In addition, the thermal and chemical properties and stability is high, there is an advantage that easy storage and not easily decomposed. In addition, PNA-DNA binding ability is much better than DNA-DNA binding force, so that the melting temperature (Tm) of about 10-15 ° C. is different even in one nucleic acid mismatch. The difference in binding force enables detection of single nucleotide polymorphism (SNP) and insertion / deletion (InDel) nucleic acid changes.

As used herein, the term “probe” refers to a nucleic acid fragment such as RNA or DNA, which may correspond to a short base to several hundred bases, which may achieve specific binding with a gene or mRNA, and includes an oligonucleotide probe, It may be manufactured in the form of a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, and may be labeled for easier detection, but is not particularly limited thereto.

The term “hybridization” of the present invention means that the complementary single stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur when the complementarity between two nucleic acid strands is perfect or even when some mismatch base is present. The degree of complementarity required for hybridization may vary depending on the hybridization conditions, and may be particularly controlled by temperature.

In the present invention, a target nucleic acid means a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.

The Tm value is also changed depending on the difference between the nucleic acid of the PNA probe and the DNA that binds to the DNA. PNA probes are analyzed using a hybridization reaction that is different from the hydrolysis reaction of TaqMan probes. Probes that play a similar role include molecular beacon probes and scorpion probes.

As an analysis method of hybridization reaction, Fluorescence Melting Curve Analysis (FMCA) is used.Fluorescence Melting Curve Analysis analyzes the difference in binding strength between the produced product and the injected probe after melting by the melting temperature. . Unlike other SNP detection probes, the probe design is very simple, using 11-18 mer nucleotide sequences containing SNPs. Therefore, in order to design a probe having a desired melting temperature, the Tm value can be adjusted according to the length of the PNA probe, and even a PNA probe of the same length can be adjusted by changing the probe. Since PNA has better binding force than DNA and has a high basic Tm value, it can be designed to have a shorter length than DNA so that even neighboring SNPs can be detected. Existing HRM method has a very small difference in Tm value of about 0.5 ° C, which requires additional analysis program or detailed temperature change and makes it difficult to analyze when two or more SNPs appear, whereas PNA probes affect SNPs other than the probe sequence. Fast and accurate analysis is possible without receiving.

In the present invention, "PNA probe (probe)" shows the expected melting temperature (Tm) value preferentially binds to the target nucleic acid in the presence of the target nucleic acid, and lower than the expected melting temperature by binding to the internal control in the absence of the target nucleic acid It can be characterized by showing the (Tm) value, using the difference between the internal control and the target nucleic acid melting curve can distinguish false positive and false negative signals. The PNA probe is analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe, and similar probes include a molecular beacon probe and a scorpion probe. (scorpion probe).

The probe of the present invention may combine the fluorescent material of the reporter and the quencher capable of quenching the reporter fluorescence at both ends, and may include an intercalating fluorescent material. The reporter may be at least one selected from the group consisting of FAM (6-carboxyfluorescein), HEX, Texas red, JOE, TAMRA, CY5, CY3, Alexa680, the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 And Dabcyl may be one or more selected from the group consisting of, but is not limited thereto.

The intercalating fluorescent materials include acridine homodimer and derivatives thereof, acridine orange and derivatives thereof, 7-aminoactinomycin D (7-AAD) and Derivatives thereof, Actinomycin D and derivatives thereof, ACMA (9-amino-6-chloro-2-methoxyacridine) and derivatives thereof, DAPI and derivatives thereof, dihydroethidium (Dihydroethidium) and its derivatives, Ethidium bromide and its derivatives, Ethidium homodimer-1 (EthD-1) and its derivatives, Ethidium homodimer-2 (EthD-2) and its derivatives, ethidium Ethidium monoazide and derivatives thereof, Hexidium iodide and derivatives thereof, bisbenzimide (Hoechst 33258) and derivatives thereof, Hoechst 33342 and derivatives thereof, arc Hoechst 345 80) and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 and derivatives thereof, Propidium Iodide (PI) and its derivatives and cydyes ) Derivatives.

In the present invention, the PNA probe may be characterized in that the melting temperature of the target nucleic acid (melting temperature) is 68 to 73 ℃, but is not limited thereto.

In another aspect, the present invention relates to a primer pair for cocciella vernetti detection represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3.

In the present invention, the primer pair may be characterized in that it specifically amplifies the IS1111 gene of Cocciella Bernetti.

In another aspect, the present invention, the PNA probe; And to a SEQ ID NO: 1 and koksi Ella member geneticin (Coxiella burnetii) detecting composition containing a pair of primers represented by the nucleotide sequence of SEQ ID NO: 3.

In the present invention, the composition is a primer pair represented by the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8; And it may be characterized in that it further comprises a PNA probe of SEQ ID NO: 9. At this time, primer pairs represented by the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 amplify the internal control material, and the PNA probe of SEQ ID NO: 9 hybridizes with the internal control material, and correlated with the presence or absence of Cocciella Bernetti It is possible to determine the success or absence of real-time PCR. Accordingly, the internal control material refers to a gene (for example, a housekeeping gene) generally included in a sample, and preferably, a region (psbA gene of Cymbidium sinense) that is not present in Cocciella. It may be characterized by. In this context, primer pairs capable of amplifying the genes and probes hybridized to the genes may be easily selected and applied by those skilled in the art, in addition to the primer pairs and PNA probes proposed in the present invention.

In still another aspect, the present invention relates to a kit for detecting Coxiella burnetii comprising the composition.

In the present invention, the kit may further include DNA synthase, dNTPs, buffers, and the like, and may further include a user manual describing the conditions for performing the optimal reaction.

In another aspect, the present invention,

(a) amplifying the target nucleic acid from the sample using a primer pair represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3;

(b) hybridizing the amplification product with the PNA probe; And

(c) analyzing the melting curve of the hybridized reactant; and a method for detecting Coxiella burnetii , including.

In the present invention, the sample is derived from a sample to detect Coxiella burnetii , comprising a DNA or RNA molecule, the molecule may be a double stranded or single stranded form. If the nucleic acid is double stranded as a starting material, it is preferred to make the two strands single or stranded. Methods known to separate strands include, but are not limited to, heat, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg, helicase action) and binding proteins. For example, strand separation can be accomplished by heat treatment at a temperature of 80-105 ° C.

In the present invention, the sample may be selected from the group consisting of hair, sputum, blood, saliva, cells (eg, oral epithelial cells, etc.) and urine derived from the object to be tested, but are not limited thereto. Does not.

Bio-samples can be analyzed using the methods of the invention, and biosamples of plant, animal, human, fungus, bacterial and viral origin can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissues include connective, skin, muscle or nerve tissue. Representative examples of organs include eyes, brain, lungs, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testes, ovaries, uterus, rectum, nervous system, Glands and internal vessels are included. The biosample to be analyzed includes any cell, tissue, fluid from a biological source, or any other medium that can be well analyzed by the present invention, which is the consumption of humans, animals, humans or animals. Samples obtained from food prepared for use are included. In addition, the biological sample to be analyzed includes a bodily fluid sample, which includes blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain grinds), spinal fluid, appendix, spleen And tonsil tissue extracts, but is not limited thereto.

In the present invention, the target nucleic acid may be characterized in that part of the IS1111 gene.

The detection method of the present invention may further comprise the step of discriminating with a sample comprising Coxiella burnetii (melting temperature) when the melting temperature (melting temperature) of the hybridized reactant (68) 73 ℃ 73 Can be.

In the present invention, the amplification of step (a) may be performed by a real-time PCR method, but is not limited thereto. In the real-time polymerase chain reaction method of the present invention, the fluorescent material is interchelating the double strand DNA chain (PC) during the PCR process (PCR), and amplification of the PCR product, by raising the temperature to release the DNA double strand DNA By analyzing the pattern of the melting curve that reduces the amount of fluorescent material present between the double strands, in particular, the temperature (Tm) at which the DNA is fused (denatured) can be analyzed whether there is a variation in the sequence between the normal control and the mutation.

In the present invention, the step (c) may be characterized in that it is performed by a Fluorescence Melting Curve Analysis (FMCA) method, but is not limited thereto.

Fusion curve analysis of the present invention is a method for analyzing the melting temperature of the double-stranded nucleic acid formed of the target DNA or RNA and the probe. Such a method is called melting curve analysis because it is performed by, for example, Tm analysis or analysis of the melting curve of the double chain. A hybrid (double-stranded DNA) of the target single-stranded DNA of the detection sample and the probe is formed by using a probe complementary to the detection target sequence containing the nucleic acid for detection, and then the hybridization is subjected to heat treatment. Then, the dissociation (fusion) of the hybrid according to the temperature rise is detected by a change in a signal such as absorbance, and then the Tm value is determined based on the detection result, thereby determining the presence or absence of the target nucleic acid.

The Tm value is higher as the homology of the hybrid body is higher, and lower as the homology is lower. For this reason, the Tm value (evaluation reference value) is calculated | required previously about the hybrid body of the detection object sequence containing a target nucleic acid, and the probe complementary to it, and the Tm value (target measurement) of the target single-stranded DNA of a detection sample is measured Value, and if the measured value is about the same as the evaluation reference value, it can be judged that there is a match, that is, the target DNA, and if the measured value is lower than the evaluation reference value, it is determined that there is no mismatch, i.e., no target DNA. can do.

Fluorescence melting curve analysis of the present invention is a method of analyzing the melting curve using a fluorescent material, more specifically, the melting curve can be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

The detection method of the present invention may further include an internal control material.

In this case, step (a) further amplifies the internal control (internal control) from the sample using a primer pair represented by the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, step (b) The amplification product of the substance may be characterized by further hybridizing with the probe of SEQ ID NO.

Coxiella burnetii to be detected in the present invention ( Coxiella burnetii ) is known as a causative agent of cue fever, the present invention is the PNA probe; And Q fever diagnostic composition comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3, and the PNA probe; And primer pairs represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 may be utilized as a kit for diagnosing a Q fever.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for the understanding of the present invention, and the scope of the present invention is not limited to these examples in any sense.

Example  One: Queue  Diagnostic primer  And Of probe  Produce

In order to confirm the infection of the cue fever, the primers indicated by IS1111 (NCBI accession no .: M80806) base sequence analysis indicated in the Animal Disease Standards Test (Agriculture and Livestock Quarantine Headquarters) for Cocciella Bernetti detection probes Was used to mix the newly prepared primer, and prepared a PNA probe in the amplification product using the primer (Fig. 1, Table 1).

Primer and Probe Sequences Used for Queue Diagnostics name Sequence (5`-3`) Remarks SEQ ID NO: 1 TATGTATCCACCGTAGCCAGTC Explicit forward primer SEQ ID NO: 2 CCCAACAACACCTCCTTATTC Explicit reverse primer SEQ ID NO: 3 GCATCGTTACWATCATTCTTGTTAC newly designed reverse primer SEQ ID NO: 4 TGGTATCGGACGTT PNA probe SEQ ID NO: 5 CAACGCAGTTGATCAG SEQ ID NO: 6 ATCGGACGTTTATGGG SEQ ID NO: 7 ACTGGGTTTTACAAACCTGTGA Internal control material forward primer SEQ ID NO: 8 GCGAGTCCTGCCACGGA Internal control reverse primer SEQ ID NO: 9 CGTGGGACCAT Internal Control PNA probe

The primers specified in the standard standard for animal diseases and newly prepared primers were synthesized at cosmogenetech (Korea). All PNA probes (FAM-labeled, Dabcyl) used in the present invention were synthesized at Panagene (Panagene, Korea). Synthesis via HPLC purification method. The purity of all synthesized probes was confirmed by mass spectrometry, and unnecessary secondary structures of the probes were avoided for more effective binding with the target nucleic acid. PNA probe for cue fever diagnosis was prepared so as not to affect the polymerase chain reaction so that the melting temperature does not exceed 75 ℃.

Example  2: Queue  Diagnostic Standards and Controls

For the diagnosis of cue sequence using the PNA probe, the optimal primer and PNA probe positions were selected within the IS1111 nucleotide sequence of the causative agent, Cocciella BERNETTI, and the standard containing the PNA binding site was artificially synthesized. In addition, in order to determine whether false positives due to contamination during the experiment, a control was artificially prepared by substituting a part of the nucleotide sequence of the PNA probe binding site artificially (FIG. 2).

CFX96 ^TM as experimental equipment (Bio-Rad, USA) was used, and for the experimental composition 3 ul of standard and control (4 × 10 ⁵ copies), 1 ul of SEQ ID NO: 1 and 3 primers (6 pmole, 40 pmole, respectively), 0.5 ul of SEQ ID NO: 6 probe ( 3.75 pmole), 2 × qPCR PreMix 10 ul (Digital Biomaterials, Korea), DW was added so that the final volume was 20 ul. Real time polymerase chain reaction test conditions were performed as shown in FIG.

 As a result of the melting curve analysis, as shown in FIG. 4, the Tm value of the standard material showed a melting curve peaking at 71 ± 2 ° C. and 43 ± 2 ° C. for the control group. It was confirmed that the reference material could be clearly identified.

Example  3: PNA Probe  Analytical and clinical sensitivity

3-1. Analytical Sensitivity Check

Analytical sensitivity experiments were performed on standards using selected primers (SEQ ID NOs: 1, 3) and PNA probes (SEQ ID NO: 6). The standard was diluted by concentration (10 pg / ul, 100 fg / ul, 1 fg / ul, 500 ag / ul, 2450 ag / ul), and the remaining components were prepared in the same composition as in Example 2, under the same conditions as in FIG. 3. Proceeded.

As a result, it was confirmed that the amplification curve and the melting curve threshold value can be detected up to 250 ag / μl (100 copies) based on the RFU 200 and the RFU 50 (FIG. 5).

3-2. Clinical Sensitivity Check

To determine the clinical sensitivity based on the analytical sensitivity using the standard. For positive samples, the positive control group (6x10 ~ 6x10 ⁶ copies) used in the disease diagnosis and bacterial disease diagnosis room of the Agriculture, Forestry and Livestock Quarantine Headquarters was used. Real-time polymerase chain reaction using probes was comparatively analyzed. The experiment was conducted under the same conditions as those in FIG. 3 with the same composition as in Example 2.

As a result, the clinical sensitivity was 6x10 ³ copies for the PCR standard test, and the 6x10 ¹ copies for the PNA probe test. This was about 100 times better sensitivity than the conventional test method, it was confirmed that the same as the analytical sensitivity using the standard sample can be reproduced in the clinical sample (Fig. 6).

Example  4: PNA Probe  Used new Queue  Production of diagnostic kit

In order to detect Coxiella burnetii , the causative agent of cue fever, a product was selected using selected fryer and PNA probes. In the case of general detection kit using real-time PCR equipment, IPC (Internal Positive Control) is mixed to confirm that there is no problem in the reaction of polymerase chain reaction of reaction solution. . Therefore, when IPC was added in the actual product, the analytical sensitivity and specificity were examined. In the case of IPC, the fluorescence was produced by varying the fluorescence so that the melting curve temperature was 67 ° C.

In the case of the experimental method, the conditions were performed in the same manner as in FIG. 3, and in the case of the composition, 3 ul of standard material (1x10 ^{2 to} 4x10 ⁶ copies), IPC 2 ul (4x10 ⁶ copies), SEQ ID NO: 1 and 3 primer 1 ul (each 6 pmol , 40 pmol), SEQ ID NO: 6 probe 0.5 ul (3.75 pmole), IPC probe 0.5 ul (5 pmole), IPC forward, reverse primer 0.5 ul each (5 pmole, 20 pmole), 2X qPCR PreMix 10 ul , Korea) was added so that the final volume was 20 ul added DW was analyzed.

As a result, it was possible to detect analytical sensitivity by adding IPC in the queue sequence kit, and it was possible to detect up to 250 ag / μl (1 x 10 ² copies) as a standard sample, which is the same as the analytical sensitivity without adding IPC. (Fig. 5)

In addition, in the case of the standard disease test method using the clinical sample, as well as the causative bacteria, and the tissue DNA of the specimen to be mixed during the DNA extraction process, non-specific reactions frequently occur and can result in false positives. On the other hand, since the melting curve using the PNA probe has only a specific specific temperature corresponding to the causative bacteria, it was confirmed that accurate diagnosis is possible with a very high specificity in the clinical sample (FIG. 7).

When the above results are combined to produce a queue sequence diagnostic kit including the IPC, the queue sequence diagnosis decision table shown in Table 2 may be determined.

FAM TxR Positive sample 68 ~ 73 ℃ 65 ~ 69 ℃ Voice sample None 65 ~ 69 ℃ Control 41 ~ 45 ℃ 65 ~ 69 ℃

As described above in detail specific parts of the present invention, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Pepetide nucleic acid probe for identifying Coxiella burnetii and          Method for identifying Coxiella burnetii using the same <130> P18-B137 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 tatgtatcca ccgtagccag tc 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 cccaacaaca cctccttatt c 21 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> newly designed reverse primer <400> 3 gcatcgttac watcattctt gttac 25 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> P223 probe <400> 4 tggtatcgga cgtt 14 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> P223 probe <400> 5 caacgcagtt gatcag 16 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> P223 probe <400> 6 atcggacgtt tatggg 16 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer for internal control <400> 7 actgggtttt acaaacctgt ga 22 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for internal control <400> 8 gcgagtcctg ccacgga 17 <210> 9 <211> 11 <212> DNA <213> Artificial Sequence <220> P223 probe for internal control <400> 9 cgtgggacca t 11

Claims (16)

Coxiella burnetii detection composition comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6. A composition for detecting Coxiella burnetii comprising a PNA probe complex in which a reporter and a quencher are coupled to a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6. According to claim 2, wherein the reporter is composed of FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein) and Cy5 Coxiella burnetii detection composition, characterized in that at least one selected from the group. The composition for detecting Coxiella burnetii according to claim 2, wherein the quencher is at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, and Dabcyl. According to claim 1, wherein the composition is Coxiella burnetii ( Coxiella burnetii ) detection composition characterized in that it further comprises a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3. According to claim 5, wherein the composition is a primer pair represented by the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8; And Coxiella burnetii ( Coxiella burnetii ) detection composition characterized in that it further comprises a PNA probe of SEQ ID NO: 9. A kit for detecting Coxiella burnetii , comprising the composition of any one of claims 1 to 6. Coxiella burnetii detection method comprising the following steps:
(a) amplifying the target nucleic acid from the sample using a primer pair represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3;
(b) hybridizing an amplification product with a PNA probe complex having a reporter and a quencher coupled to a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 or a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 step; And
(c) analyzing the melting curve of the hybridized reactants. The method of claim 8, wherein the sample is selected from the group consisting of hair, sputum, blood, saliva, cells, and urine. The method of claim 8, wherein the target nucleic acid is part of an IS1111 gene. The method of claim 8, further comprising the following steps:
(d) discriminating a sample comprising Coxiella burnetii when the melting temperature of the hybridized reactant is 68-73 ° C. The method of claim 8, wherein step (a) is performed by a real-time PCR method. The method of claim 8,
Step (a) further amplifies the internal control (internal control) from the sample using a primer pair represented by the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8,
The step (b) is characterized in that the hybridization of the amplification product of the internal control further with the probe of SEQ ID NO: 9. The method of claim 8, wherein step (c) is performed by a Fluorescence Melting Curve Analysis (FMCA) method. A PNA probe complex in which a reporter and a quencher are coupled to a PNA probe represented by a nucleotide sequence of SEQ ID NO: 6 or a PNA probe represented by a nucleotide sequence of SEQ ID NO: 6; And a primer pair represented by a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3. Q fever diagnostic composition. A PNA probe complex in which a reporter and a quencher are coupled to a PNA probe represented by a nucleotide sequence of SEQ ID NO: 6 or a PNA probe represented by a nucleotide sequence of SEQ ID NO: 6; And Q fever diagnostic kit comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3.

Images