KR20190105785A - Pepetide nucleicacid probe for detecting foot-and-mouth disease virus and Uses thereof - Google Patents

Abstract

The present invention relates to a PNA probe for detecting foot-and-mouth disease virus (FMDV) and the use thereof. More specifically, the present invention relates to a method for detecting FMDV by amplifying FMDV genes using a PNA probe represented by a nucleotide sequence of SEG ID Nos: 6 to 7 and two or more primers selected from a group consisting of SEQ ID Nos: 1 to 5, and hybridizing the PNA probe. The PNA probe according to the present invention is useful for detecting FMDV by enabling simultaneous analysis of FMDV with high sensitivity and high accuracy in a single experiment in a real-time gene amplification apparatus.

Description

Peptide nucleic acid probe for detecting foot-and-mouth disease virus and Uses

The present invention relates to a PNA probe for detecting foot-and-mouth disease virus (FMDV) and its use, and more particularly, to a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 or 7, and SEQ ID NOs: 1 to 5 It relates to a method for amplifying foot-and-mouth virus virus using two or more primers selected from the group consisting of, and detecting foot-and-mouth virus through hybridization of PNA probe.

Foot-and-mouse disease (FMD) is a disease that infects hoofed animals such as cows, pigs, sheep, goats, and deer (milk cows), and is highly contagious and affects lips, tongue, gums, nose, or trunk. Blisters (bleedings) occur on the back, body temperature rises rapidly, appetite decreases, and the disease is severe. It is an important livestock epidemic designated by the World Animal Health Organization (OIE) and belongs to the first class of livestock epidemic.

The pathogens are Picornaviridae Aphthovirus and RNA virus, which are classified into seven serotypes, namely A, O, C, Asia1, SAT1, SAT2, and SAT3, and this major serotype is further divided into 80 subtypes. The survival time of the virus is greatly affected by temperature, humidity, pH and UV rays, and it is usually up to 50 days in water, 26 ~ 200 days in soil, sack, hay, etc. depending on the environment such as wood or metal contaminated with blood. Has a record of survival of up to 35 days (SM Reid et al., Molecular and Cellular Probes, Vol. 24 pp. 250-255, 2010).

Infection is generally caused by the movement of an infected animal. Infections of the infected animals such as blisters, runny nose, saliva, milk, semen, breathing and feces are the path of infection, and can also be transmitted by livestock derived from the infected animals. Radio waves also occur through people and vehicles that come into contact with infected animals or enter contaminated areas, as well as associated clothing, feed, water and equipment. In the case of airborne radio waves, there have been reports of spreading over 50 km on land and over 250 km through the sea. In particular, the axis of infection requires special attention because it can spread the disease, even before the symptoms of foot-and-mouth disease are already released.

The incubation period is generally 2 to 14 days. Symptoms include anorexia, runny nose, blisters on the tongue, nipples, around the mouth, hooves and skin. Secondary infection caused by bacteria can occur in areas where the blisters break off and the hooves are dropped. Younger individuals also have higher mortality rates, resulting in economic damage.

Diagnosis methods include vesicular fluid, vesicular epithelial tissue, nasal juice or saliva, and are included in the detection of foot-and-mouth disease and serotypes by gene detection using polymerase chain reaction (PCR), antigen ELISA or isolation of foot-and-mouth virus using animal cells. Determine. Alternatively, the antiserum ELISA for the production of antibodies to the serum foot-and-mouth virus isolated from blood samples is determined by ELISA. When vaccination is performed, an NSP ELISA is performed to distinguish between the vaccine axis and the infection axis.

Because foot-and-mouth disease is not cross-protection between serotypes, it is difficult to inoculate vaccines by serotype if necessary, and even if a vaccine contains a large number of viruses released from the infection shaft, coax can become infected and show symptoms (Jamal and Belsham). , Veterinary Research, Vol. 44: 116, pp. 1-14, 2013).

PNA stands for Peptide Nucleic Acids and is artificially synthesized as one of the gene recognition materials such as LNA (Locked Nucleic Acid) and MNA (Mopholino Nucleic Acid). In the case of PNA, it is a source material with national competitiveness as a domestic source patent, and PNA is highly degraded with affinity and selectivity, and has high stability against nucleases, so it is degraded with existing restriction enzymes. It doesn't work. In addition, the thermal and chemical properties and stability is high, there is an advantage that easy storage and not easily decomposed.

 PNA-DNA binding ability is much better than DNA-DNA binding ability, so there is a difference of 10 ~ 15 ℃ even for one nucleotide miss match. By using the difference in binding force, it is possible to detect changes in nucleotides of SNP and In / Del.

The Tm value is also changed depending on the difference between the nucleotide of the PNA probe and the nucleotide of the DNA that is complementarily bound to it, thereby facilitating the development of an application using the same. PNA probes are analyzed using a hybridization method that differs from the hydrolysis method of TaqMan probes, and molecular beacon probes and scorpion probes have similar functions.

The analysis method of hybridization methode is using FMCA (Fluorescence Melting CurveAnalysis), and FMCA analyzes the difference in binding strength between the product produced after the PCR reaction and the inserted probe by Tm. Unlike other SNP detection probes, the probe design is very simple, and is produced using 9-15 mer nucleotide sequences containing SNPs. Therefore, in order to design a probe having a desired Tm value, the Tm value may be adjusted according to the length of the PNA probe, or even a PNA probe of the same length may be changed to adjust the Tm value. PNA has higher binding force than DNA, so the basic Tm value is higher, so it can be designed with shorter length than DNA, so it can detect even neighboring SNPs. The conventional HRM method has a very small difference in Tm value of about 0.5 ℃, which makes it difficult to analyze when two or more SNPs appear due to additional analysis program or detailed temperature change, whereas PNA probes do not affect SNPs other than the probe sequence. It can be analyzed because it is not received.

For SNP analysis using a PNA probe, a probe using a base of the SNP-containing part and a forward / reverse primer set for PCR are sufficient. The PCR conditions can be used as they are, and the melting process is required after the completion of PCR, and the Tm value is obtained by measuring the intensity of fluorescence each time it is increased by 1 ℃. All real-time PCR devices have the advantage of not requiring additional program purchases or detailed temperature changes, such as high resolution melting (HRM).

In order to optimize PNA analysis results, a reporter (liquid type) is used to effectively detect the substitution of a single nucleotide sequence of a target nucleic acid and deletion or insertion of a base by a liquid type MeltingArrayTM method and a U-TOPTM (Universal Temperature of PNA) method. ) And a quencher-coupled probe to take advantage of the hybridization process and the Liquid type MeltingArrayTM method which does not require fixing the probe to the plate. In addition, the PNA probe generates a fluorescent signal by selectively binding to the complementary nucleotide sequence (hybridization), and has a feature of self-quenching when falling apart from the complementary nucleotide sequence. Therefore, the PNA probe has a unique melting temperature when the correct sequencing is present, and the intrinsic melting temperature is changed when a false positive and a similar sequence are present, which may act as a great advantage to increase the accuracy of the result.

Therefore, the present inventors have diligently tried to develop a fast and accurate method for detecting foot-and-mouth disease virus. As a result, 3D and / or IRES genes of foot-and-mouth virus in a sample were amplified by primers, and then hybridized with a gene mutation-specific probe. Analysis of the present invention confirms that the foot and mouth virus can be detected quickly and accurately to complete the present invention.

It is an object of the present invention to provide probe and primer pairs capable of detecting foot and mouth virus.

Another object of the present invention to provide a foot-and-mouth virus detection method using the probe and primer pair.

In order to achieve the above object, the present invention provides foot-and-mouth disease represented by the base sequence of PNA probe sequence number 6 or 7 for detecting foot-and-mouth disease virus (FMDV) represented by the base sequence of SEQ ID NO: 6 or 7 Provided are PNA probes for detecting foot-and-mouth disease virus (FMDV).

The present invention also provides a nucleotide sequence of SEQ ID NO: 1 as the forward primer, SEQ ID NO: 2 as the reverse primer; The nucleotide sequence of SEQ ID NO: 3 as a forward primer and SEQ ID NO: 4 as a reverse primer; And a base sequence of SEQ ID NO: 5 as a reverse primer; provides a primer pair for foot-and-mouth disease virus (FMDV) gene amplification selected from the group consisting of.

The present invention also provides a composition for detecting foot-and-mouth disease virus (FMDV) comprising the PNA probe and primer pair, and a kit for detecting foot-and-mouth disease virus (FMDV) including the same. To provide.

The invention also comprises the steps of a) extracting gDNA from a sample sample; b) amplifying foot and mouth virus 3D or IRES genes using the primer pairs and hybridizing the amplification products with the PNA probe; And c) analyzing the melting curve of the hybridized reactant in step b) to determine genotypes of the genes. Foot-and-mouth disease virus (FMDV) detection method is provided.

The PNA probe according to the present invention is useful for detecting foot-and-mouth virus by enabling simultaneous analysis of foot-and-mouth virus with high sensitivity and high accuracy in a single experiment in a real-time gene amplification apparatus.

1 is a vector map of a standard material prepared for the optimization of foot-and-mouth disease virus diagnostic kit according to an embodiment of the present invention.
Figure 2 is a schematic diagram showing the experimental protocol for real-time polymerase chain reaction for foot and mouth virus detection.
Figure 3 shows the results of the real-time polymerase chain reaction experiment using foot-and-mouth virus standards, 60 degrees means 3D gene, 69 degrees means IRES gene was detected.
4 is a real-time polymerase chain reaction test results of detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype A.
FIG. 5 shows the results of real-time polymerase chain reaction experiment for detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus O-type virus.
6 is a result of a real-time polymerase chain reaction test for detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype Asia1.
7 is a result of a real-time polymerase chain reaction experiment in which the foot-and-mouth virus was detected using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype C.
8 is a result of a real-time polymerase chain reaction test for detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype SAT1.
9 is a result of a real-time polymerase chain reaction test for detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype SAT2.
10 is a result of a real-time polymerase chain reaction test for detecting foot-and-mouth virus using a primer pair and a probe according to an embodiment of the present invention in a clinical sample of foot-and-mouth virus serotype SAT3.
11 is a result of confirming the assay sensitivity of the primer pair and the probe according to an embodiment of the present invention in a standard sample.
12 shows the results of confirming specificity of primer pairs and probes according to an embodiment of the present invention in foot-and-mouth disease-like virus, a negative control, and no template control (NTC).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

As used herein, the term “probe” refers to a nucleic acid fragment such as RNA or DNA, which may correspond to a short base to several hundred bases, which may achieve specific binding with a gene or mRNA, and includes an oligonucleotide probe, It may be manufactured in the form of a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, and may be labeled for easier detection, but is not particularly limited thereto.

The term “hybridization” of the present invention means that the complementary single stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur when the complementarity between two nucleic acid strands is perfect or even when some mismatch base is present. The degree of complementarity required for hybridization may vary depending on the hybridization conditions, and may be particularly controlled by temperature.

In the present invention, a target nucleic acid means a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.

In the present invention, it was intended to develop a fast and accurate method for detecting foot-and-mouth disease virus (FMDV).

In the present invention, when using a PNA probe that specifically binds to the 3D gene and IRES gene known to be associated with foot-and-mouth virus detection, the foot-and-mouth virus can be detected only by analyzing the melting curve without going through a complicated process. .

That is, in one embodiment of the present invention, when designing a PNA probe that specifically binds to foot-and-mouth virus 3D and / or IRES gene, and analyzes the melting curve using the same, the analysis is performed only by analyzing the melting curve without additional analysis work. It was confirmed that the genotype of the gene can be determined (FIG. 3).

Therefore, in one aspect, the present invention relates to a PNA probe for detecting foot-and-mouth disease virus (FMDV) represented by the nucleotide sequence of SEQ ID NO: 6 or 7.

PNA (Peptide Nucleic Acid) is one of gene recognition materials such as LNA (Locked Nucleic Acid) and MNA (Mopholino Nucleic Acid). It is artificially synthesized and the basic skeleton is composed of polyamide. PNA has very high affinity and selectivity, and has high stability against nucleases, so that it is not degraded by existing restriction enzymes. In addition, the thermal and chemical properties and stability is high, there is an advantage that easy storage and not easily decomposed. In addition, PNA-DNA binding ability is much better than DNA-DNA binding force, so that the melting temperature (Tm) of about 10-15 ° C. is different even in one nucleic acid mismatch. The difference in binding force enables detection of single nucleotide polymorphism (SNP) and insertion / deletion (InDel) nucleic acid changes.

The Tm value is also changed depending on the difference between the nucleic acid of the PNA probe and the DNA that binds to the DNA. PNA probes are analyzed using a hybridization reaction that is different from the hydrolysis reaction of TaqMan probes. Probes that play a similar role include molecular beacon probes and scorpion probes.

As an analysis method of hybridization reaction, Fluorescence Melting Curve Analysis (FMCA) is used, and fluorescence melting curve analysis analyzes the difference in binding strength between the generated product and the injected probe after melting by the melting temperature. Unlike other SNP detection probes, the probe design is very simple, using 11-18 mer nucleotide sequences containing SNPs. Therefore, in order to design a probe having a desired melting temperature, the Tm value can be adjusted according to the length of the PNA probe, and even a PNA probe of the same length can be adjusted by changing the probe. Since PNA has better binding force than DNA and has a high basic Tm value, it can be designed to have a shorter length than DNA so that even neighboring SNPs can be detected. Existing HRM method has a very small difference in Tm value of about 0.5 ° C, which requires additional analysis program or detailed temperature change and makes it difficult to analyze when two or more SNPs appear, whereas PNA probes affect SNPs other than the probe sequence. Fast and accurate analysis is possible without receiving.

In the present invention, the PNA probe is not limited, but may be characterized as hybridizing with the 3D gene or the IRES gene.

In the present invention, the PNA probe is not limited but may be characterized in that a reporter or quencher is coupled. The PNA probe including the reporter and quencher of the present invention hybridizes with the target nucleic acid and generates a fluorescent signal. As the temperature increases, the PNA probe rapidly melts with the target nucleic acid at an appropriate melting temperature of the probe, thereby extinguishing the fluorescent signal. It is possible to detect the presence or absence of the target nucleic acid through the high-resolution melting curve analysis obtained from the fluorescence signal according to.

In the present invention, "PNA probe (probe)" shows the expected melting temperature (Tm) value preferentially binds to the target nucleic acid in the presence of the target nucleic acid, and lower than the expected melting temperature by binding to the internal control in the absence of the target nucleic acid It can be characterized by showing the (Tm) value, using the difference between the internal control and the target nucleic acid melting curve can distinguish false positive and false negative signals. The PNA probe is analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe, and similar probes include a molecular beacon probe and a scorpion probe. (scorpion probe).

The probe of the present invention may combine the fluorescent material of the reporter and the quencher capable of quenching the reporter fluorescence at both ends, and may include an intercalating fluorescent material. The reporter may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), HEX, Texas red, JOE, TAMRA, CY5, CY3, Alexa680, the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, Preference is given to using BHQ2 or Dabcyl, but not limited thereto. The intercalating fluorescent materials include acridine homodimer and derivatives thereof, acridine orange and derivatives thereof, 7-aminoactinomycin D (7-AAD) and Derivatives thereof, Actinomycin D and derivatives thereof, ACMA (9-amino-6-chloro-2-methoxyacridine) and derivatives thereof, DAPI and derivatives thereof, dihydroethidium (Dihydroethidium) and its derivatives, Ethidium bromide and its derivatives, Ethidium homodimer-1 (EthD-1) and its derivatives, Ethidium homodimer-2 (EthD-2) and its derivatives, ethidium Ethidium monoazide and its derivatives, Hexidium iodide and its derivatives, bisbenzimide (Hoechst 33258) and its derivatives, Hoechst 33342 and its derivatives, arc Hoechst 345 80) and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 and derivatives thereof, Propidium Iodide (PI) and derivatives thereof and cydyes ) Derivatives.

In the present invention, the PNA probe may be characterized in that when the target gene is 3D, the melting temperature (melting temperature) is 68 to 72 ℃, IRES, 65 to 69 ℃, but is not limited thereto. .

In another aspect, the present invention provides a nucleotide sequence of SEQ ID NO: 2 as SEQ ID NO: 1, a reverse primer; The nucleotide sequence of SEQ ID NO: 3 as a forward primer and SEQ ID NO: 4 as a reverse primer; It relates to a primer pair for foot-and-mouth disease virus (FMDV) gene amplification selected from the group consisting of;

In another aspect, the present invention relates to a composition for detecting foot-and-mouth virus containing the PNA probe and the primer pair.

In another aspect, the present invention relates to a foot-and-mouth disease virus (FMDV) detection kit comprising the composition.

In the present invention, the kit may further include DNA synthase, dNTPs, buffers, and the like, and may further include a user manual describing the conditions for performing the optimal reaction.

In still another aspect, the present invention provides a method for preparing a sample, comprising: a) extracting gDNA from a sample sample; b) amplifying foot-and-mouth disease virus (FMDV) 3D or IRES genes using the primer pairs and hybridizing the amplification products with the PNA probe; And c) analyzing the melting curve of the hybridized reactant in step b) to determine the genotype of the gene. 2. The method relates to a foot-and-mouth disease virus (FMDV) detection method.

In the present invention, the sample sample is a DNA or RNA molecule, the molecule may be a double stranded or single stranded form. If the nucleic acid is double stranded as a starting material, it is preferred to make the two strands single or stranded. Methods known to separate strands include, but are not limited to, heat, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg, helicase action) and binding proteins. For example, strand separation can be accomplished by heat treatment at a temperature of 80-105 ° C.

In the present invention, the sample sample is not limited but may be a DNA sample derived from hair, runny nose, blister, saliva, blood, milk, semen, feces or nasal juice.

In the present invention, the 'sample sample' includes various samples, and preferably, a bio-sample is analyzed using the method of the present invention. Biosamples of plant, animal, human, fungus, bacterial and viral origin can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissues include connective, skin, muscle or nerve tissue. Representative examples of organs include eyes, brain, lungs, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testes, ovaries, uterus, rectum, nervous system, Glands and internal vessels are included. The biosample to be analyzed includes any cell, tissue, fluid from a biological source, or any other medium that can be well analyzed by the present invention, which is the consumption of humans, animals, humans or animals. Samples obtained from food prepared for use are included. In addition, the biological sample to be analyzed includes a bodily fluid sample, which includes blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain grinds), spinal fluid, appendix, spleen And tonsil tissue extracts, but is not limited thereto.

In the present invention, the melting curve analysis method is not limited thereto, but may be characterized in that it is performed by a Fluorescence Melting Curve Analysis (FMCA) method.

Fusion curve analysis of the present invention is a method for analyzing the melting temperature of the double-stranded nucleic acid formed of the target DNA or RNA and the probe. Such a method is called melting curve analysis because it is performed by, for example, Tm analysis or analysis of the melting curve of the double chain. A hybrid (double-stranded DNA) of the target single-stranded DNA of the detection sample and the probe is formed by using a probe complementary to the sequence to be detected containing the mutation for detection, and then the hybridization is subjected to heat treatment. It is a method of determining the presence or absence of a point mutation by detecting the dissociation (fusion) of a hybrid according to a temperature rise by a change in a signal such as absorbance and then determining a Tm value based on the detection result. .

The Tm value is higher as the homology of the hybrid body is higher, and lower as the homology is lower. For this reason, Tm value (evaluation reference value) is calculated | required previously about the hybrid body of the detection object sequence containing a point mutation, and the probe complementary to it, and Tm value (target measurement) of the target single-stranded DNA of a detection sample is measured Value, and if the measured value is about the same as the evaluation reference value, it can be determined that a mutation exists in the match, that is, the target DNA, and if the measurement value is lower than the evaluation reference value, a mismatch, that is, a mutation in the target DNA It can be determined that it does not exist.

Fluorescence melting curve analysis of the present invention is a method of analyzing the melting curve using a fluorescent material, more specifically, the melting curve can be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In the present invention, the amplification is not limited, but may be performed by a real-time PCR method.

In the real-time PCR method of the present invention, the fluorescent material is interchelating the double-stranded DNA chain in the PCR process, and the amplification of the PCR product, the temperature is increased by releasing the DNA double-strand between DNA double strands By analyzing the pattern of the melting curve that reduces the amount of the fluorescent material present, in particular, the temperature (Tm) at which the DNA is fused (denatured), it is possible to analyze the variation of the sequence between the normal control and the mutation.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for the understanding of the present invention, and the scope of the present invention is not limited to these examples in any sense.

Example 1: Preparation of primer and probe for detecting foot and mouth virus

For detection of foot and mouth virus, a fryer according to the OIE reference and a newly designed probe were used, and the sequence information of the corresponding primers and probes is shown in Table 1.

To analyze and compare sequences of 3D and IRES sites of 7 serotypes of foot-and-mouth virus, a probe was made by finding a site confined only to foot-and-mouth virus for detection of foot-and-mouth virus using a database of the National Institute of Biological Information (NCBI). It was.

In the case of the primer was produced through cosmogenetech (cosmogenetech, Korea), all PNA probes used in the present invention were synthesized by HPLC purification method in Panagene (Panagene, Korea), the purity of all synthesized probes using mass spectrometry The unnecessary secondary structure of the probe was avoided for more effective binding with the target nucleic acid. The melting temperature of the PNA probe was not exceeded 75 ° C. so as not to affect the polymerase chain reaction.

Primer and PNA Probe Sequences for Foot and Mouth Virus division No. Sequence (5` to 3`) Direction Fluorescence Target primer SEQ ID NO: 1 ACTGGGTTTTACAAACCTGTGA Forward 3D SEQ ID NO: 2 GCGAGTCCTGCCACGGA Reverse 3D SEQ ID NO: 3 CACYTYAAGRTGACAYTGRTACTGGTAC Forward IRES SEQ ID NO: 4 CAGATYCCRAGTGWCICITGTTA Reverse IRES SEQ ID NO: 5 GACACTCGGGATCTGAGAAGGG Reverse IRES PNA
Probe SEQ ID NO: 6 CAGGAGAAGTTG TxR 3D SEQ ID NO: 7 CTAAGGATGCCCT HEX IRES

Example 2: Preparation and Verification of Reference Material for Detection of Foot and Mouth Virus

In order to detect foot-and-mouth virus using the PNA probe, the optimal primer and PNA probe positions are selected within the 3D and IRES site sequences of the foot-and-mouth virus, and one SNP is given to the PNA probe site among the base sequences of the 3D site of the foot-and-mouth virus. The base sequence of the IRES region was prepared by artificially using a plasmid of a standard material with the same sequence as the foot-and-mouth virus (FIG. 1). The base sequence is shown in Table 2.

Target Nucleic Acid Sequence Information Target nucleic acid No. Sequence (5` to 3`) Foot-and-mouth virus variant SEQ ID NO: 8 ACTCCGCCTGGTCTTTCCAGGTCTAGAGGGGTCTTTTGGATTATGGAACTGGGTTTTACAAACCTGTGATGGCCTCAAAGACCCTTGAGGCTATCCTCTCCTTTGCACGCCGTGGGACCATACAGAAGAAGTTGATCCCCGTAACATGACTCGCCGTAATCACCTTAAGGTGACGAGAACT

The synthesized standard was used to optimize real-time PCR using a PNA probe.

CFX96TM (Bio-Rad, USA) was used as the equipment for conducting the experiment. For the experimental composition, 50 pg / μl of standard material, and SEQ ID Nos. 1 to 5 primers 4, 25, 4, 21.75, 3.25 pmole, SEQ ID Nos. 6 to 7 probes were added to 10 μl of 3.75, 3.75 pmole, 2 × one-step qRT-PCR PreMix (Eye Biomaterials, Korea), and TE buffer was added so that the final volume was 20 μl. Real time polymerase chain reaction test conditions are as shown in FIG.

As a result of the melting curve analysis, as shown in FIG. 3, the Tm of the probe capable of detecting the 3D site of foot-and-mouth virus was 60 ° C., and the Tm of the probe capable of detecting the IRES site showed a melting curve at 69 ° C. It was confirmed that there was no.

Example 3: Analysis of the melting curve according to the nucleotide sequence of the 3D, IRES site for detecting all 7 serotypes

In order to detect foot-and-mouth virus using a PNA probe, an experiment was performed using the standard material prepared in Example 2 and 41 clinical samples. The composition is as follows; 5 μl of RNA sample, 10 μl of 2X one-step qRT-PCR PreMix (Eye Biomaterials, Korea) and primers (SEQ ID NOS: 1-5) at 4, 25, 4, 21.75, 3.25 pmole, and probe (SEQ ID NO: 6). ~ 7) add TE buffer to 3.75 and 3.75 pmole and 20 µl total volume. The conditions of the equipment for analysis are shown in FIG.

In the case of the determination table, the nucleotide sequence of the selected probe sequence position and the intrinsic temperature of the melting curve of the real-time PCR using the PNA probe were confirmed. When the melting curve temperature was shown within the range of the presented determination table, it was produced to determine that foot-and-mouth virus was infected (Table 3).

Judgment table Region Fluorescence Cutoff Ct value
(Threshold 700) Melt peak Tm
threshold 50 3D TxR 35 68 ~ 72 ℃ IRES HEX 38 65 ~ 69 ℃

As a result, as shown in Figures 4 to 10, in the case of using the primer pair and probe of the present invention for each serotype, it can be determined whether or not, according to the determination table, whether it is a serotype O, Jeongeupju, conventional It was confirmed that detection was quicker and easier than PCR.

Example 4: Analytical Sensitivity Using PNA Probes and Standards

Analytical sensitivity experiments were performed on a standard using primers (SEQ ID NOs: 1-5) and PNA probes (SEQ ID NOs: 6-7). The experiment was carried out by diluting the standard by concentration. Real-time PCR reaction conditions were carried out in the same manner as in Figure 2, the reaction solution composition was performed in the same manner as in Example 3.

 As a result, it was confirmed that the melting curve threshold value can be detected up to 100 fg / μl based on RFU 50 (FIG. 11).

Example 5: Clinical Specificity Using PNA Probes

 Since all 7 serotypes of foot-and-mouth virus developed by the present invention should be detectable, a total of 41 strains and negatives, including 39 strains of 7- and foot-and-mouth virus and 2 strains of swine disease showing symptoms similar to foot-and-mouth disease virus, were detected. Clinical specificity test was performed by repeating the control and No template control twice. Strain information used in the specificity test is shown in Table 4.

Serotype O Discrimination Kit Clinical Specificity Test Strain List Category / Serotype Strain info. Seneca valley virus SVV Swine bullous virus P1C77

As a result, as shown in FIG. 12, it was confirmed that the virus was not out of the foot-and-mouth virus, out of the temperature range of the melting curve shown in the determination table, or the melting curve appeared below the threshold or the melting curve did not appear.

As described above in detail specific parts of the present invention, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> SeasunBio Materials <120> Pepetide nucleic acid probe for detecting foot-and-mouth disease          virus and Uses <130> P18-B043 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 3D_F <400> 1 actgggtttt acaaacctgt ga 22 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 3D_R <400> 2 gcgagtcctg ccacgga 17 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> IRES_F <400> 3 cacytyaagr tgacaytgrt actggtac 28 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IRES_R <400> 4 cagatyccra gtgwcctgtt a 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IRES_R2 <400> 5 gacactcggg atctgagaag gg 22 <210> 6 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> 3D_PNA <400> 6 caggagaagt tg 12 <210> 7 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> IRES_PNA <400> 7 ctaaggatgc cct 13 <210> 8 <211> 273 <212> DNA <213> Artificial Sequence <220> <223> Mutant_FMDV <400> 8 actccgcctg gtctttccag gtctagaggg gtcttttgga ttatggaact gggttttaca 60 aacctgtgat ggcctcaaag acccttgagg ctatcctctc ctttgcacgc cgtgggacca 120 tacagaagaa gttgatctcc gtggcaggac tcgccgtaat caccttaagg tgacactgat 180 actggtactc agacactggt gatagactaa ggatgccctt caggtacccc gaggtaacac 240 gcgacactcg ggatctgaga aggggactgg ggc 273

Claims (12)

PNA probe for detecting foot-and-mouth disease virus (FMDV) represented by the nucleotide sequence of SEQ ID NO: 6 or 7.
The PNA probe of claim 1, wherein the PNA probe hybridizes with the 3D or IRES gene of foot-and-mouth disease virus (foot-and-mouth disease virus, FMDV).
The method of claim 1, wherein the PNA probe is a PNA probe for detecting foot-and-mouth disease virus (FMDV), characterized in that the reporter and quencher is coupled.
The foot-and-mouth virus of claim 1, wherein the PNA probe has a melting temperature of 68 to 72 ° C. and an IRES of 65 to 69 ° C. when the target gene is 3D. PNA probe for detecting mouth disease virus (FMDV).
The method of claim 1, wherein the reporter (reporter) is FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein) and PNA probe for detecting foot-and-mouth disease virus (FMDV), characterized in that at least one selected from the group consisting of Cy5.
The foot-and-mouth disease of claim 1, wherein the quencher is at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, and Dabcyl. virus, FMDV) detection PNA probe.
The base sequence of SEQ ID NO: 1 as a forward primer and SEQ ID NO: 2 as a reverse primer; The nucleotide sequence of SEQ ID NO: 3 as a forward primer and SEQ ID NO: 4 as a reverse primer; And primer pairs for foot-and-mouth disease virus (FMDV) gene amplification selected from the group consisting of SEQ ID NO: 5 as a reverse primer.
A composition for detecting foot-and-mouth disease virus (FMDV) comprising the PNA probe of any one of claims 1 to 6 and the primer pair of claim 7.
a) extracting gDNA from a sample sample;
b) Amplifying foot-and-mouth disease virus (FMDV) 3D or IRES gene using the primer pair of claim 7 and hybridizing the amplification product with the PNA probe of any one of claims 1 to 6. Making a step; And
c) analyzing the melting curve of the hybridized reactant in step b) to determine the presence or absence of the gene;
Foot-and-mouth disease virus (FMDV) detection method comprising a.
The detection method according to claim 9, wherein the sample sample is a DNA sample derived from hair, runny nose, blister, saliva, blood, milk, semen, feces or nasal juice.
The method of claim 9, wherein the melting curve analysis is performed by a Fluorescence Melting Curve Analysis (FMCA) method.
The detection method according to claim 9, wherein the amplification is performed by a real-time PCR method.

Images