KR101677952B1 - Genetic Marker for Discrimination and Detection of Lactococcus Garvieae, and Method for Discrimination and Detection of Lactococcus Garvieae Using the Same - Google Patents

Abstract

The present invention relates to a genetic marker for the identification and detection of a bacterial pathogen causing streptococcal infection of fishes, and a method for the identification and detection of the bacterial pathogen using the same, and more specifically, to a method for identifying a bacterial species or detecting whether a fish is infected with the same bacterial species or not based on the melting temperature by: selecting a genetic marker containing the bacterium-specific single nucleotide polymorphism (SNP) of DNA sequences encoding 16S rDNA of Lactococcus garvieae, which is a bacterial pathogen causing streptococcal infection of fishes, and amplifying the same; hybridizing peptide nucleic acid (PNA) specifically recognizing the amplified product; obtaining a melting profile by temperature through the temperature control of the hybridized product; and analyzing the obtained melting profile. The present invention is effective in identifying a bacterial pathogen causing diseases in fishes simply, rapidly, and accurately, and detecting whether a fish is infected with the same bacterial pathogen or not by selecting a genetic marker for the identification and/or detection of Lactococcus garvieae, which is a bacterial pathogen causing diseases in fishes, amplifying fluorescence different by bacterial species using peptide nucleic acid and a primer pair specific to the genetic marker, and showing a melting profile.

Description

[Genetic Marker for Discrimination and Detection of Lactococcus Garvieae, and Method for Discrimination and Detection of Lactococcus Garvieae Using the Same}

The present invention relates to a genetic marker for discrimination and detection of the causative bacteria of fish streptococcus infection, and a method for discriminating and detecting the causative bacteria using the same, and more particularly, of Lactococcus Garvieae , the causative bacteria of fish streptococci Among the DNA sequences encoding the 16S rDNA gene, a gene marker containing bacterial-specific single nucleotide polymorphism (SNP) is selected and amplified, and then Peptide Nucleic Acid (Peptide Nucleic Acid), which specifically recognizes the amplified product, is selected and amplified. PNA) is hybridized, a melting curve for each temperature is obtained through temperature control of the hybridized product, and a method of determining bacterial species from the melting temperature through analysis of the obtained melting curve or detecting the infection of the bacterial species in fish. About.

Various methods have been developed to analyze bacterial genes, and gene sequencing (sanger sequencing), random amplified polymorphic DNA (RAPD), and restriction fragment length polymorphism (RFLP) methods have been used, but the analysis time is still long and the procedure. It has a problem of being tricky.

The detection of bacterial diseases used in the aquaculture field relies on a bacterial culture method that requires a lot of time, and such a bacterial culture method has low objectivity and there is a possibility of detection error, and the bacterial culture method using a selective medium can only test for a single bacteria. It has a disadvantage that detailed classification is impossible. Biochemical analysis (API test) is used to increase the accuracy of detection, but rapid detection is impossible due to the complicated procedure and long reaction time. In particular, in the case of aquatic disease-related bacteria, the accuracy is low because there are not many databases. Not being used. By overcoming these problems and developing a molecular detection product that can accurately detect within a few hours, the damage of bacterial diseases can be prevented early.

Fish streptococcal infection and Edwardsiella tarda (Edwardsiella), which is the causative agent of Edward infection. tarda ), Streptococcus iniae , Streptococcus parauberis And Lactococcus garvieae is infected with tilapia, yellowtail, rainbow trout, and flounder, which are widely cultivated worldwide, causing high mortality. In particular, Streptococcus inia can infect humans and cause cellulitis, and more than 20 cases of Streptococcus iniae infecting humans through fish have been reported in the United States, Canada, Hong Kong, Taiwan, and Singapore. The identification of pathogenicity is becoming important.

As described above, there is a need for a method of selecting a genotype and a genomic marker of pathogenic bacteria detected in infected fish, and using the marker to easily analyze the pathogenicity of bacteria according to the genotype. With the development of the above markers, the causative bacteria of fish streptococcus infection and Edward infection frequently occurring in fish such as farmed flounder are accurately detected and identified, and accurate identification of the causative bacteria through early detection of individuals infected with the causative bacteria and It can prevent the misuse of antibiotics in fish and the increase in the production cost of unnecessary fish.

Under this technical background, the present inventors have made diligent efforts to identify the species of the fish streptococcal infection and the Ed Ward infectious disease-causing bacteria, and to develop a method for detecting an individual infected with the causative bacteria. Tarda, Streptococcus Inia, Streptococcus Parauberis And By discovering a genetic marker for discrimination and/or detection of Lactococcus gavier, and showing different fluorescence amplification and melting curves for each bacterial species using a peptide nucleic acid and primer pair specific to the genetic marker, the bacteria that cause fish disease are identified. After confirming that there is an effect of being able to easily, quickly and accurately discriminate, the present invention was completed.

It is an object of the present invention to provide a genetic marker, a primer pair, and a PNA probe for discrimination or detection of the Ed Ward infection and streptococcal infection causative bacteria.

Another object of the present invention is to provide a composition and a kit for discrimination or detection of bacteria that cause Edward infection and streptococcal infection, including the primer pair and the PNA probe.

Another object of the present invention is to hybridize the PNA probe to a gene marker region including a single nucleotide polymorphism (SNP) specific for the Ed Ward infection and streptococcal infection causative bacteria amplified using the primer pair. The object of the present invention is to provide a method for determining the type of the causative bacteria by obtaining a corresponding Tm value or detecting whether an individual is infected with the causative bacteria.

In order to achieve the above object, the present invention is the nucleotide sequence of SEQ ID NO: 8 including single nucleotide polymorphism (SNP) among the DNA nucleotide sequences encoding the 16S rDNA gene of Edwardsiella tarda Provides a genetic marker for discrimination or detection of Edwardsiella tarda represented by.

The present invention is also streptococcus streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or A chain represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11 including single nucleotide polymorphism (SNP) among the DNA sequences encoding the 16S rDNA gene of Lactococcus garvieae It provides a genetic marker for discrimination or detection of cocci.

The present invention also includes a single nucleotide polymorphism (SNP) of the DNA nucleotide sequence encoding the 16S rDNA gene of Edwardsiella tarda, a genetic marker represented by the nucleotide sequence of SEQ ID NO: 8 It provides a primer pair for discrimination or detection of Edwardsiella tarda represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 used to amplify.

The present invention is also streptococcus streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or A gene represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11 including single nucleotide polymorphism (SNP) among the DNA sequences encoding the 16S rDNA gene of Lactococcus garvieae It provides a primer pair for discrimination or detection of streptococci represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 used to amplify the marker.

The present invention also includes a single nucleotide polymorphism (SNP) and the corresponding base of SEQ ID NO: 4 contained in the 16S rDNA gene marker represented by the nucleotide sequence of SEQ ID NO: 8 of Edwardsiella tarda. It provides a PNA probe for discrimination or detection of Edwardsiella tarda represented by the sequence.

The present invention is also streptococcus streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or SEQ ID NO: 5 corresponding to the single nucleotide polymorphism (SNP) contained in the 16S rDNA gene marker represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11 of Lactococcus garvieae, It provides a PNA probe for discrimination or detection of streptococci represented by the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 7.

The present invention also includes the primer pair and the PNA probe, Edwardsiella tarda (Edwardsiella tarda ) or a composition and kit for discrimination or detection of streptococcus.

The present invention also includes the steps of: (a) extracting a target nucleic acid from a specimen; (b) Edwardsiella tarda contained in the target nucleic acid (Edwardsiella tarda ) or streptococcus gene marker nucleotide sequence amplification using the primer pair, and hybridizing the PNA probe to the amplified gene marker nucleotide sequence; (c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And (d) from the melting temperature through the analysis of the melting curve obtained in step (c), Edwardsiella tarda (Edwardsiella ed to eat and tarda), or to determine the bacterial species of Streptococcus, or a step for detecting the infection of the bacterial species of fish Ella tar is (Edwardsiella tarda ) or streptococcus.

The present invention is a fish disease causative bacteria Edwad Siella tarda, Streptococcus iniae, Streptococcus parauberis And By selecting a genetic marker for discrimination and/or detection of Lactococcus gavier, and using a pair of peptide nucleic acids and primers specific to the genetic marker, different fluorescence amplification and melting curves are displayed for each bacterial species to identify the bacteria that cause fish disease. It has the effect of being able to easily, quickly and accurately discriminate, and detect whether fish are infected with the above bacteria.

1 is a conceptual diagram showing the technical characteristics of the step of obtaining an amplification curve for discriminating bacterial species and detecting bacterial infection of an individual.
2 is a schematic diagram showing a step of obtaining a melting curve according to hybridization of a peptide nucleic acid in a method for discriminating a bacterial species and a method for detecting bacterial infection in an individual.
Figure 3 shows the reaction conditions of real-time PCR (Real-Time Polymerase Chain Reaction) for discrimination of bacterial species and detection of bacterial infection of an individual.
4 is a gene position diagram for explaining the base mutation site contained in the 16S rDNA gene-specific peptide nucleic acid for discrimination and detection of Streptococcus parauberis.
Figure 5 is Lactococcus It is a gene position diagram for explaining the base mutation site contained in the 16S rDNA gene-specific peptide nucleic acid that determines the discrimination and detection of garvieae.
Figure 6 is Edwardsiella tarda And a gene position diagram for explaining the base mutation site contained in the 16S rDNA gene-specific peptide nucleic acid that determines the discrimination and detection of Streptococcus iniae.
7 is a gene location diagram for explaining the base mutation site included in the 16S rDNA gene-specific primers for PCR amplification of three types of Streptococcus iniae (Streptococcus parauberis , Lactococcus garvieae).
8 is Edwardsiella It is a gene position diagram for explaining an example of the base mutation part contained in the 16S rDNA gene-specific primer for PCR of tarda.
9 is a graph showing an amplification curve and a melting curve of Edwardsiella tarda ( E. tarda ) using a peptide nucleic acid probe and primer for discrimination and detection of bacterial species.
10 shows amplification and melting curves of Streptococcus iniae ( S. iniae ) using a peptide nucleic acid probe and primer for discrimination and detection of bacterial species.
11 is a graph showing amplification and melting curves of Streptococcus parauberis ( S. parauberis ) using a peptide nucleic acid probe and primer for discrimination and detection of bacterial species.
12 is a graph showing an amplification curve and a melting curve of Lactococcus garvieae using a peptide nucleic acid probe and a primer for discrimination and detection of bacterial species.
Figure 13 is a host (fish) at the same time four kinds of bacteria ( Streptococcus iniae , Streptococcus parauberis , Lactococcus garvieae , Edwardsiella tarda ), the amplification curve and melting curve graph for each strain are shown.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

In one aspect, the present invention is to develop a method for discriminating and detecting bacterial species with a genetic marker for discrimination and detection of the bacteria that cause fish Ed Ward infection and streptococcal infection, and to detect whether the bacterial species of fish is infected, 16S of the bacteria The nucleotide sequence of rDNA was secured, a representative sequence was prepared for each bacterial species with CLC Genomic workbench 8.0.1, and then the genes were compared and analyzed by clustal W alignment. Edwardsiella tarda selected through genetic analysis tarda ) and Streptococcus iniae , Streptococcus iniae , Streptococcus parauberis And a gene marker (site) containing a single nucleotide polymorphism (SNP) among the DNA sequences encoding the 16S rDNA gene of Lactococcus garvieae as a target, and corresponding to the gene marker Using a pair of primers for determining bacterial species and a PNA probe, it was possible to detect and discriminate the species of the bacteria that cause fish Edward infection and streptococcal infection.

In more detail, it has a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3, which is produced based on a genetic marker having a nucleotide sequence of SEQ ID NO: 8 to SEQ ID NO: 11 derived by comparative analysis of the nucleotide sequence of the bacterial 16S rDNA. Amplification and melting curves were obtained from bacterial-derived DNA through real-time PCR (Real-Time Polymerase Chain Reaction) using a primer and a PNA probe having a nucleotide sequence of SEQ ID NO: 4 to SEQ ID NO: 7, and melting from the melting curve As a result of checking the temperature (Tm), as can be seen in Examples to be described later, different fluorescence melting curve results were obtained for each bacterial species.

Therefore, in one aspect, the present invention is a nucleotide sequence of SEQ ID NO: 8 including a single nucleotide polymorphism (SNP) of the DNA nucleotide sequence encoding the 16S rDNA gene of Edwardsiella tarda. It relates to a genetic marker for discrimination or detection of Edwardsiella tarda displayed.

In another aspect, the present invention is streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or A chain represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11 including single nucleotide polymorphism (SNP) among the DNA sequences encoding the 16S rDNA gene of Lactococcus garvieae It relates to a genetic marker for discrimination or detection of cocci.

In another aspect, the present invention is represented by the nucleotide sequence of SEQ ID NO: 8, including single nucleotide polymorphism (SNP), of the DNA nucleotide sequence encoding the 16S rDNA gene of Edwardsiella tarda It relates to a primer pair for discrimination or detection of Edwardsiella tarda represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 used to amplify the genetic marker that is used.

In another aspect, the present invention is streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or A gene represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11 including single nucleotide polymorphism (SNP) among the DNA sequences encoding the 16S rDNA gene of Lactococcus garvieae It relates to a pair of primers for discrimination or detection of streptococci represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 used to amplify the marker.

In another aspect, the present invention is a sequence number corresponding to a single nucleotide polymorphism (SNP) contained in the 16S rDNA gene marker represented by the nucleotide sequence of SEQ ID NO: 8 of Edwardsiella tarda. It relates to a PNA probe for discrimination or detection of Edwardsiella tarda represented by the nucleotide sequence of 4.

In another aspect, the present invention is streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or SEQ ID NO: 5 corresponding to the single nucleotide polymorphism (SNP) contained in the 16S rDNA gene marker represented by the nucleotide sequence of SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11 of Lactococcus garvieae, It relates to a PNA probe for discrimination or detection of streptococci represented by the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 7.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence may be combined at both ends. The reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl, but is not limited thereto, and preferably Dabcyl (FAM-labeled) can be used.

Peptide nucleic acid (PNA) is a similar DNA in which a nucleic acid base is linked by a peptide bond rather than a phosphate bond, and was first synthesized by Nielsen et al. in 1991. PNA is not found in nature and is artificially synthesized by chemical methods.

Peptide nucleic acid is artificially synthesized as one of gene recognition materials such as LNA (Locked Nucleic Acid) or MNA (Mopholino nucleic acid), and its basic skeleton is composed of polyamide. PNA has excellent affinity and selectivity, and has high stability against nucleases, so it is not degraded by existing restriction enzymes. In addition, thermal/chemical properties and stability are high, so storage is easy and it is not easily decomposed.

PNA forms double strands through a hybridization reaction with a natural nucleic acid having a complementary nucleotide sequence. When the length is the same, the PNA/DNA double strand is more stable than the DNA/DNA double strand, and the PNA/RNA double strand is more stable than the DNA/RNA double strand. In addition, PNA is more capable of detecting single nucleotide polymorphism (SNP) than natural nucleic acids because the degree of double-strand instability is large due to single base mismatch.

In addition, PNA-DNA binding power is very superior to DNA-DNA binding power, so even a nucleotide miss match differs by about 10 to 15°C. Using this difference in avidity, it is possible to detect changes in SNP (Single-nucleotide polymorphism) and In/Del nucleotides.

The length of the PNA nucleotide sequence according to the present invention is not particularly limited, but may be prepared in a length of 12 to 18 mer so that the SNPs of bacterial species are included. At this time, it is possible to design a PNA probe to have a desired Tm value by adjusting the length of the PNA probe, or it is also possible to adjust the Tm value by changing the base sequence even with a PNA probe of the same length. In addition, since PNA probes have better binding power than DNA and have a high basic Tm value, they can be designed to have a shorter length than DNA, so that even close neighboring SNPs can be detected. According to the existing HRM (High Resolution Melt) method, the difference in Tm value is very small, about 0.5℃, requiring additional analysis program or detailed temperature change or correction. For this reason, analysis was difficult when two or more SNPs appeared. , The PNA probe according to the present invention is not affected by the sequence and SNP of the PNA probe, and thus can be conveniently analyzed.

As in the present invention, when the PNA probe includes 14 nucleotide sequences, it is preferable to have a sequence corresponding to the bacterial SNP site at one or more of the nucleotide sequences in the middle. In addition, the PNA probe can have structural modifications by including a sequence corresponding to the bacterial SNP site in the middle of the nucleotide sequence, and through this, the difference in melting temperature (Tm) with the target nucleic acid (perfect match) that achieves complete hybridization. Can be made even larger.

In another aspect of the present invention, Edwardsiella tarda including the primer pair and the PNA probe (Edwardsiella tarda ) or to a composition and kit for discrimination or detection of streptococcus.

In the present invention, the streptococcus is Streptococcus iniae , Streptococcus parauberis , or It may be characterized in that it is Lactococcus garvieae.

The kit of the present invention may optionally include a buffer, a DNA polymerase cofactor, and reagents necessary for carrying out a target nucleic acid amplification reaction (eg, PCR reaction) such as deoxyribonucleotide-5-triphosphate. Optionally, the kits of the present invention may also include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, in the kit, the optimal amount of the reagent to be used in a specific reaction can be easily determined by a person skilled in the art who has learned the disclosure herein. Typically, the kit of the present invention can be made in a separate package or compartment containing the aforementioned components.

Using the kit, it is possible to effectively detect a single base mutation of a target nucleic acid and a mutation due to a deletion or insertion of a base through analysis of a dissolution curve by a PNA probe, and thereby it is possible to discriminate a bacterial species.

In another aspect of the present invention, (a) extracting a target nucleic acid from a sample sample; (b) Edwardsiella tarda contained in the target nucleic acid (Edwardsiella tarda ) or streptococcus gene marker nucleotide sequence amplification using the primer pair, and hybridizing the PNA probe to the amplified gene marker nucleotide sequence; (c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And (d) from the melting temperature through the analysis of the melting curve obtained in step (c), Edwardsiella tarda (Edwardsiella ed to eat and tarda), or to determine the bacterial species of Streptococcus, or a step for detecting the infection of the bacterial species of fish Ella tar is (Edwardsiella tarda ) or streptococcus.

In the present invention, the streptococcus is Streptococcus iniae (Streptococcus iniae), Streptococcus parauberis (Streptococcus parauberis) or It may be characterized in that it is Lactococcus garvieae.

In the present invention, the amplification may be characterized in that it is performed by a real-time polymerase chain reaction (PCR) method.

In the present invention, two or more target nucleic acids are used, and the reporter labeled on the PNA probe is different for each target nucleic acid, and at least one Edwardsiella tarda is detected through detection of two or more target nucleic acids. tarda ) and streptococci bacterial species may be identified or detected.

In the present invention, the "sample sample" includes various samples, and preferably, a biosample is analyzed using the method of the present invention. More preferably, the Edwardsiella tarda described in the present invention (Edwardsiella tarda ) and/or a sample mixed with a bacterial species of streptococci, or a sample of an individual infected with the bacteria (e.g., fish, etc.), and biological samples from plants, animals, humans, fungi, bacteria and viruses to be analyzed. I can. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissue include connective, skin, muscle, or nervous tissue. Representative examples of organs include eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testicle, ovary, uterus, rectum, nervous system, Includes glandular and internal blood vessels. The biological sample to be analyzed includes any cells, tissues, fluids from biological sources, or any other medium that can be well analyzed by the present invention, which is human, animal, human or animal consumption. Samples obtained from foods prepared for use are included. In addition, biological samples to be analyzed include bodily fluid samples, which include blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extract (e.g., brain crush), spinal fluid, appendix, spleen. And tonsil tissue extract, but is not limited thereto.

'Target nucleic acid','synthetic DNA', or'artificial oligo' of the present invention means a nucleic acid sequence (including SNP) to be detected or not, and a'target gene' encoding a protein having physiological and biochemical functions. It contains a specific site of the nucleic acid sequence of, and is annealed or hybridized with a primer or probe under conditions of hybridization, annealing or amplification.

'Hybridization' of the present invention means that complementary single-stranded nucleic acids form double-stranded nucleic acids. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect match or even in the presence of some mismatched bases. The degree of complementarity required for hybridization may vary according to hybridization conditions, and in particular, may be controlled by temperature.

In the present invention, the melting curve analysis may be characterized by performing a fluorescence melting curve analysis (FMCA) method.

The PNA probe containing the reporter and quencher of the present invention generates a fluorescent signal after hybridization with the target nucleic acid, and as the temperature rises, the fluorescent signal is quenched by rapidly melting with the target nucleic acid at an appropriate melting temperature of the probe. The presence or absence of base denaturation (including SNP) of the target nucleic acid can be detected through high-resolution melting curve analysis obtained from the fluorescence signal according to The PNA probe shows an expected melting temperature (Tm) value when it achieves a perfect match with a target nucleic acid sequence, but a melting temperature lower than expected due to incomplete hybridization with a target nucleic acid in which a base mutation exists. It is characterized by showing the (Tm) value.

The'base mutation' of the present invention is characterized in that the mutation occurs in the base sequence of the target nucleic acid, and includes not only single nucleotide polymorphism (SNP), but also mutation caused by substitution, deletion or insertion of a base. , The PNA probe of the present invention can be analyzed through a melting curve analysis that mutation occurs due to substitution, deletion or insertion of the SNP of the target nucleic acid or the base of the target nucleic acid.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence may be combined at both ends. The reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl, but is not limited thereto, and preferably Dabcyl (FAM-labeled) can be used.

The Tm value is also changed according to the difference between the nucleotide of the PNA probe and the nucleotide of the DNA complementarily bound thereto, making it easy to develop an application using this. PNA probes are analyzed using a hybridization method different from the hydrolysis method of TaqMan probes, and probes that play a similar role include molecular beacon probes and scorpion probes. There is.

For single-nucleotide polymorphism (SNP) analysis using a PNA probe, it is sufficient to first need only a probe using the base of the part containing the SNP and a forward/reverse primer set for PCR. For the PCR conditions, an existing method can be used, and a melting process is required after PCR is completed, and the Tm value is obtained by measuring the fluorescence intensity every 0.5°C increment. In particular, general real-time PCR (real-time PCR) devices are widely used and have the advantage of not requiring additional program purchases or detailed temperature changes such as HRM (high resolution melting).

The melting curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed of a target nucleic acid, DNA or RNA, and a probe. Since such a method is performed by, for example, Tm analysis or analysis of the melting curve of the double chain, it is called a melting curve analysis. A hybrid (double-stranded DNA) between the target single-stranded DNA of the detection sample and the probe is formed by using a probe complementary to the detection target sequence containing the mutation for detection (including SNP). Subsequently, the hybrid formed body is subjected to a heat treatment, and dissociation (melting) of the hybrid according to the temperature increase is detected by fluctuations in signals such as absorbance. Then, by determining the Tm value based on the detection result, it is a method of determining the presence or absence of a point mutation (including SNP). The Tm value is higher as the homology of the hybrid-formed body is higher, and lower as the homology is lower. For this reason, a Tm value (evaluation reference value) is obtained in advance for a hybrid formed body of a detection target sequence containing a point mutation and a probe complementary thereto, and a Tm value (measurement) between the target single-stranded DNA of the detection sample and the probe Value), and if the measured value is the same degree as the evaluation reference value, it can be determined that there is a match, that is, a mutation (including SNP) in the target DNA, and if the measured value is lower than the evaluation reference value, a mismatch, that is, the target DNA It can be determined that there is no mutation in the.

The fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent material, and more specifically, the melting curve may be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In the real-time PCR (Real-Time Polymerase Chain Reaction) method of the present invention, a fluorescent substance is interchelated to a double-stranded DNA chain in the PCR process, and the temperature is raised along with the amplification of the PCR product. The base between the normal control and the mutation (including SNP) is analyzed by analyzing the pattern of the melting curve, in which the amount of fluorescent substance present between the double strands of DNA is reduced by unwinding the double strands, especially the temperature (Tm) at which the DNA is melted (denatured). The presence or absence of a sequence mutation can be analyzed.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1: Gene for discrimination and detection of bacteria that cause Edward infection and streptococcal infection in fish Marker , And specific to the bacterium primer And PNA Probe making

In order to differentiate the genotype of the bacterial 16S rDNA gene from 461 isolates isolated from fish, such as halibut, among the bacteria that cause fish infectious diseases, the nucleotide sequence of 16S rDNA was obtained through Sanger sequencing, and CLC Genomic workbench 8.0. Using 1, a representative sequence corresponding to each bacterial species was prepared and compared and analyzed using clustal W alignment. Three types of streptococcus ( Streptococcus iniae , Streptococcus parauberis , Lactococcus garviae ) and Edwardsiella A base site specific to tarda (SEQ ID NO: 8 to SEQ ID NO: 11) was selected as a genetic marker for discrimination and detection of bacterial species.

In more detail, in the DNA sequence encoding the 16S rDNA gene, a genetic marker containing single nucleotide polymorphism (SNP) is, and in the case of the Streptococcus iniae 16S rDNA gene, the genotypic marker site is 5'-CATGTGTACTCTAG-3. In the case of the'sequence (Streptococcus iniae 16S rDNA marker: SEQ ID NO: 8), and in the case of the Streptococcus parauberis 16S rDNA gene, the genotyping marker site includes 5'-CAAGCACCAGTCTT-3' sequence ( Streptococcus parauberis 16S rDNA marker: SEQ ID NO: 9), and , Lactococcus In the case of garvieae 16S rDNA gene, the genotyping marker site is 5'-CTACTCGGCAGATT-3' sequence ( Lactococcus garvieae 16S rDNA marker: SEQ ID NO: 10), Edwardsiella In the case of the tarda 16S rDNA gene, the genotyping marker site is 5'-TGGTCTTGCGACGT-3' sequence ( Edwardsiella tarda 16S rDNA marker: SEQ ID NO: 11) was prepared to be included.

In addition, three kinds of streptococcus ( Streptococcus iniae , Streptococcus parauberis , Lactococcus garviae ) or Edwardsiella To check the presence of tarda and use it for detection, a primer capable of amplifying a specific region of 16S rDNA was used by Edwardsiella. Tarda -specific reverse primer (SEQ ID NO: 2) and Streptococcus iniae , Streptococcus parauberis , Lactococcus garvieae -specific universal reverse primer (SEQ ID NO: 3) was prepared.

Where, Edwardsiella tarda The amplifiable primer (SEQ ID NO: 2) of the 16S rDNA gene has complementarity to the "5'-ATGCCATCAGATGAACCC-3'" sequence, and has three kinds of Streptococcus iniae , Streptococcus parauberis and Lactococcus. garvieae ) 16S rDNA specific site amplified universal reverse primer (SEQ ID NO: 3) was constructed to be complementary to the "5'-ACCAGAAAGGGACGGCTA-3'" sequence.

In addition, as a forward primer, a universal forward primer (27F) (SEQ ID NO: 1) of bacterial 16S rDNA was used (Lane et al. , 1991).

The PNA probe used in the present invention was designed using a PNA probe designer (Applied Biosystems, USA), and was prepared by including a bacterial-specific nucleotide sequence, a reporter, and a quencher in the PNA probe. At this time, the PNA probe was prepared by combining FAM, HEX, TexasRed, and Cy5, respectively, so as not to contain the same fluorescence.

All PNA probes (FAM-labeled, Dabcyl) used in the present invention were synthesized in Panagene (Panagene, Korea) by HPLC purification method, and the purity of all synthesized probes was confirmed by mass spectrometry (for effective binding to target nucleic acids. The unnecessary secondary structure of the probe was avoided).

4 to 6 are the four kinds of bacteria according to the present invention ( Streptococcus iniae , Streptococcus parauberis , Lactococcus garvieae , Edwardsiella tarda ) is a nucleotide sequence diagram showing an example of a nucleotide sequence of a part of the 16S rDNA gene of SNP and a peptide nucleic acid (PNA) derived therefrom, and FIGS. 7 to 8 are primers on the bacterial 16S rDNA gene according to the present invention. It is a gene position diagram for explaining an example of a site|part containing a position. In FIGS. 4 to 8, the nucleotide sequence according to each PNA probe is indicated in green, and the specific nucleotide sequence for each bacterium is indicated in black.

As a result, the PNA and primer sequences according to the present invention were determined, and are shown in Table 1.

division name Sequence number Sequence (5'-> 3') transform target primer Universal forward
Primer(27F) SEQ ID NO: 1 AGAGTTTGATCCTGGCTCAG - Bacterial 16S rDNA Reverse primer SEQ ID NO:2 GGGTTCATCTGATGGCAT - Edwardsiella tarda Universal reverse primer SEQ ID NO:3 TAGCCGTCCCTTTCTGGT - Streptococcus iniae ,
Streptococcus parauberis ,
Lactococcus garvieae
PNA
Probe PNA 1 SEQ ID NO:4 ACGTCGCAAGACCA Dabsyl, FAM Edwardsiella tarda PNA 2 SEQ ID NO: 5 CTAGAGTACACATG Dabsyl, TexasRed Streptococcus iniae PNA 3 SEQ ID NO: 6 AAGACTGGTGCTTG Dabsyl, HEX Streptococcus parauberis PNA 4 SEQ ID NO: 7 AATCTGCCGAGTAG Dabsyl, Cy5 Lactococcus garvieae 16S rDNA marker Edwardsiella tarda_ 16S rDNA marker SEQ ID NO: 8 TGGTCTTGCGACGT - Edwardsiella tarda Streptococcus iniae_ 16S rDNA marker SEQ ID NO: 9 CATGTGTACTCTAG - Streptococcus iniae Streptococcus parauberis_ 16S rDNA marker SEQ ID NO: 10 CAAGCACCAGTCTT - Streptococcus parauberis Lactococcus garvieae_ 16S rDNA marker SEQ ID NO: 11 CTACTCGGCAGATT - Lactococcus garvieae

Example 2: Real time PCR (Real-Time Polymerase Chain Reaction) and a method of discriminating 4 kinds of bacterial genes through analysis of the melting curve

Using the bacterial-specific gene marker, PNA probe and primer of Example 1, four kinds of bacteria ( Streptococcus iniae , Streptococcus parauberis , Lactococcus garvieae , Edwardsiella tarda ) DNA samples were derived from amplification curves and dissolution curves, and analyzed to determine bacterial species.

PCR was performed using a CFX96™ Real-Time system (BIO-RAD, USA), and all experimental conditions used asymmetric PCR to generate a single-stranded target nucleic acid. Conditions for asymmetric PCR are as follows; 2X PNA qPCR PCR MasterMix (Sisun Biomaterials, Korea), 0.1 μM forward primer and 1 μM reverse primer, 4 kinds of PNA probe mixture 1 μM, 10 ng bacterial-derived DNA so that the total volume is 20 μl. After addition, real-time PCR was performed.

3 is a graph showing the reaction conditions of real-time PCR for discrimination and detection of bacterial species, amplifying and hybridizing gene marker sites of bacterial-derived DNA, and increasing the temperature of the hybridized product. Here, the real-time PCR process was denatured at 95°C for 10 minutes, then reacted at 95°C for 30 seconds, 58°C for 45 seconds, and 74°C for 45 seconds, and this was repeated 40 cycles, and fluorescence was measured in real time. . The melting curve analysis was performed by performing a denaturation step at 95° C. for 5 minutes, then increasing the fluorescence at 80° C. for 30 seconds, 60° C. for 30 seconds, and 45° C. to 80° C. by 1° C. and measuring fluorescence.

As a result, as shown in FIGS. 9 to 12, each of the peptide nucleic acids selected from SEQ ID NOs: 4 to 7 was used in bacterial DNA samples ( Streptococcus iniae , Streptococcus parauberis , Lactococcus. garvieae , Edwardsiella tarda ), the amplification curve for each bacteria and the melting curve for each fluorescence could be obtained. In addition, as shown in Figure 13, by simultaneously performing real-time PCR in one tube Four kinds of bacteria ( Streptococcus iniae , Streptococcus parauberis, Lactococcus garvieae , Edwardsiella tarda ) was possible for multi-detection.

In summary, it was possible to individually detect bacteria or to discriminate bacterial species from samples in which different bacterial species were mixed.

Example 3: Fusion fluorescence And method for discriminating and detecting bacterial species according to temperature-specific scores

In the case of discriminating or detecting bacterial species for a DNA sample derived from an unknown bacteria using the PNA probe according to the present invention, a score table for each melting temperature as shown in Table 2 may be made in advance and used.

After performing the melting curve analysis as in Example 2, the derived fluorescence signal and Tm value were digitized according to the temperature when the complementarity was perfect (perfect match). That is, a range of ±2° C. of the perfect match temperature is made, and if the Tm value for an unknown bacterial DNA sample falls within the above range, the species can be identified and identified.

Neon PM(℃) Type of bacteria FAM 67 Edwardsiella tarda HEX 63 Streptococcus parauberis TexasRed 63 Streptococcus iniae Cy5 63 Lactococcus garvieae

As described above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> Republic of Korea (National Fisheries Research and Development Institute) <120> Genetic Marker for Discrimination and Detection of Lactococcus Garvieae, and Method for Discrimination and Detection of Lactococcus Garvieae Using the Same <130> P16-B121 <160> 11 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Universal forward Primer(27F) <400> 1 agagtttgat cctggctcag 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 gggttcatct gatggcat 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Universal reverse primer <400> 3 tagccgtccc tttctggt 18 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA 1 <400> 4 acgtcgcaag acca 14 <210> 5 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA 2 <400> 5 ctagagtaca catg 14 <210> 6 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA 3 <400> 6 aagactggtg cttg 14 <210> 7 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA 4 <400> 7 aatctgccga gtag 14 <210> 8 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Edwardsiella tarda_16S rDNA marker <400> 8 tggtcttgcg acgt 14 <210> 9 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus iniae_16S rDNA marker <400> 9 catgtgtact ctag 14 <210> 10 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Streptococcus parauberis_16S rDNA marker <400> 10 caagcaccag tctt 14 <210> 11 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Lactococcus garvieae_16S rDNA marker <400> 11 ctactcggca gatt 14

Claims (7)

delete delete A PNA probe for discrimination or detection of Lactococcus garvieae represented by the nucleotide sequence of SEQ ID NO:
The PNA probe according to claim 3, wherein at least one of a reporter and a photon is bonded.
A composition for discriminating or detecting Lactococcus garvieae comprising a pair of primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3, and the PNA probe of claim 3.
A kit for discriminating or detecting Lactococcus garvieae comprising a pair of primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3, and the PNA probe of claim 3.
A method of detecting or identifying Lactococcus garvieae comprising the steps of:
(a) extracting a target nucleic acid from a specimen sample;
(b) amplifying the gene marker base sequence of Lactococcus garvieae contained in the target nucleic acid using a primer pair represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3, Hybridizing the PNA probe of claim 3 to the sequence;
(c) obtaining a temperature-dependent melting curve by increasing the temperature of the product hybridized with the PNA probe in the step (b); And
(d) detecting Lactococcus garvieae from the melting temperature by analysis of the melting curve obtained in the step (c), or determining whether the fish is infected with the bacterium species.

Images