KR20210049423A - Dna aptamer specifically binding to capsid protein of foot-and-mouth disease virus and using the same - Google Patents

Abstract

The present invention relates to a DNA aptamer specifically binding to a capsid protein of foot-and-mouth disease virus and to uses thereof. Specifically, the DNA aptamer according to the present invention specifically and strongly binds to the capsid protein of foot-and-mouth disease virus to be usefully used to detect the capsid protein or to diagnose the foot-and-mouth disease virus containing the same.

Description

DNA aptamer specifically binding to capsid protein of foot-and-mouth disease virus and its use {DNA APTAMER SPECIFICALLY BINDING TO CAPSID PROTEIN OF FOOT-AND-MOUTH DISEASE VIRUS AND USING THE SAME}

The present invention relates to a DNA aptamer that specifically binds to the capsid protein of foot-and-mouth disease virus, and uses thereof.

Foot-and-mouth disease (FMD) is an acute viral infectious disease that is infected with bifocal carcinoids such as cattle, pigs, and goats. Between the hooves, lips, tongue, gums, nose, and canal area within 24 hours of onset. It shows symptoms of blistering on the back. In addition, cows infected with foot-and-mouth disease virus cause reproductive disorders and decrease productivity, such as a rapid decrease in milk production, and the area where blisters are ruptured is likely to be exposed to secondary infections caused by bacteria.

Foot-and-mouth disease is a disease caused by a foot-and-mouth disease virus (FMDV) belonging to the genus picornaviridae aphthovirus. FMDV is an RNA virus and has no envelope. Foot-and-mouth disease virus has a total of 7 serotypes, A, O, C, Asia1, STA1, SAT2, and SAT3. It has a wide host area, strong invasive power, and can cause disease in susceptible individuals by a small number of viruses. And has a very short incubation period. In addition, since the virus begins to be excreted outside the host's body before clinical symptoms appear, direct or indirect transmission to other adjacent individuals may occur rapidly, and this is possible by livestock products derived from infected animals. In addition, FMDV is known to be capable of long-term survival outside of the host.

As such, foot-and-mouth disease is highly infectious and morbid and requires mass killing of affected individuals, so not only economic damage and social confusion of livestock farms, but also environmental problems such as contamination of surrounding soil and groundwater caused by burial of the killed individuals. Can be accompanied.

The world organization for animal health (OIE) classifies foot-and-mouth disease as a Class A infectious disease, and it is also designated as a type 1 leather epidemic in Korea. In Korea, foot-and-mouth disease continues to occur every 2 to 5 years since 2000, causing enormous damage to the livestock industry. After foot-and-mouth disease, which occurred in 2010-2011, a foot-and-mouth disease virus vaccine was vaccinated to all right-sided animals to prevent the outbreak of foot-and-mouth disease, and a policy to kill off-onset right-mouth disease was applied.

However, foot-and-mouth disease has a problem in that it is not easy to detect it early because clinical symptoms appear late as described above. Currently, foot-and-mouth disease is diagnosed by a method of detecting viral antigens using saliva of the right medicament. This has a problem that the detection rate is very low when there are many contaminants in the sample and there are few viruses. In this regard, Korean Patent Publication No. 10-2019-0105785 discloses a method for quickly and accurately analyzing foot-and-mouth disease virus in a real-time gene amplification device using a PNA probe represented by a specific base sequence and a primer represented by a specific base sequence. I'm doing it.

Korean Patent Publication No. 10-2019-0105785

An object of the present invention is to provide a DNA aptamer that specifically binds to the capsid protein of foot-and-mouth disease virus and is composed of a specific nucleotide sequence.

Another object of the present invention is to provide a composition and kit for detecting foot-and-mouth disease virus comprising a DNA aptamer according to the present invention, and a method for detecting foot-and-mouth disease virus using the composition.

In order to achieve the above object, the present invention provides a DNA aptamer that specifically binds to a capsid protein composed of a nucleotide sequence selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11.

In addition, the present invention provides a composition for detecting a capsid protein comprising the DNA aptamer.

In addition, the present invention provides a kit for detecting a capsid protein comprising the DNA aptamer.

In addition, the present invention provides a capsid protein detection method comprising the step of reacting the composition for detection with a sample.

In addition, the present invention provides a composition for diagnosis of foot-and-mouth disease virus comprising the DNA aptamer.

In addition, the present invention provides a kit for diagnosis of foot-and-mouth disease virus comprising the DNA aptamer.

Furthermore, the present invention provides a method for diagnosing foot-and-mouth disease virus comprising reacting the diagnostic composition with a sample.

The DNA aptamer according to the present invention specifically binds strongly to the capsid protein of the foot-and-mouth disease virus, and thus can be usefully used to detect the capsid protein or to diagnose a foot-and-mouth disease virus containing the same.

1 is a diagram showing a result of confirming a PCR product obtained by amplifying a random DNA library in an embodiment of the present invention through agarose gel electrophoresis.
2 is a diagram showing the results of confirming single-stranded DNA obtained from a DNA library in an embodiment of the present invention through agarose gel electrophoresis.
3 is a graph showing the results of confirming the binding strength of the DNA aptamer and the capsid protein obtained in an embodiment of the present invention according to the number of times SELEX is performed.
4A to 4C are diagrams showing the results of confirming the structures of 11 DNA aptamers selected in an embodiment of the present invention.
5 is a graph showing results of confirming the ability of DNA aptamer to detect foot-and-mouth disease virus in an embodiment of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer that specifically binds to a capsid protein composed of a nucleotide sequence selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11.

As used herein, the term "capsid protein" refers to an envelope protein surrounding a core containing the genetic material of a virus. The capsid protein may be a capsid protein of foot-and-mouth disease virus. The capsid protein of the foot-and-mouth disease virus may include all polypeptide sequences known as the capsid protein of the foot-and-mouth disease virus in the art. In one embodiment of the present invention, the capsid protein of the foot-and-mouth disease virus is an amino acid sequence set forth in SEQ ID NO: 14. It may be a polypeptide consisting of.

The term, "foot-and-mouth disease virus (FMDV) is one of the viruses contained in the genus picornaviridae aphthovirus, and can cause foot-and-mouth disease in a right-handed type with split hoofs. The above specifics Infected with inverse virus, woojeryu may show symptoms of blistering between the hooves, lips, tongue, gums, nose, and canals.

As used herein, the term "aptamer" refers to a nucleic acid molecule capable of binding to a specific substance with high affinity and specificity. The aptamer may be prepared by a method well known in the art, and the method may be appropriately modified as necessary.

The DNA aptamer according to the present invention may be selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11. The DNA timer is 80% or more, 90% or more, 95% or more, 97% or more, or 99% or more homology with the nucleotide sequence set forth in SEQ ID NOs: 1 to 11, as long as it maintains the property of specifically binding to the capsid protein. Can have.

The DNA aptamer may be modified with a sugar residue of each nucleotide, specifically ribose or deoxyribose, in order to increase binding and stability to a target substance. The above formula may be obtained by substituting another atom for at least one oxygen atom selected from the group consisting of the 2'position, 3'position, and 4'position of the sugar moiety. Examples of the formula may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, and the like. Modification of the sugar moiety as described above can be carried out in a conventional manner.

In addition, the DNA aptamer may have a nucleotide base modified in order to increase the binding property to the target substance. The modification of the nucleotide base is a pyrimidine modification at position 5, a purine modification at position 6, a purine modification at position 8, a modification in an extra-cyclic amine, substitution with 4-thiouridine, substitution with 5-bromo. Or 5-iodine-uricyl substitution, and the like.

In addition, the DNA aptamer may have a phosphate group modified to have resistance to nucleases and hydrolytic enzymes. For example, the phosphoric acid group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, or the like. Furthermore, the DNA aptamer may include a modification of the 3'end or 5'end, and the modification is capping, but biotinyl, polyethyl glycol, amino acid, peptide, nucleic acid, nucleoside, myristoyl , Lisocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl , Lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agents, toxins, enzymes, radioactive substances, biotin, etc. may be added.

In addition, the present invention provides a composition and kit for detecting a capsid protein comprising the DNA aptamer.

The DNA aptamer included in the composition and kit for capsid protein detection according to the present invention may have the above-described characteristics. For example, the DNA aptamer may be selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11. In addition, the capsid protein may be a capsid protein of foot-and-mouth disease virus.

The DNA aptamer included in the composition for detecting a capsid protein according to the present invention may be a conjugate labeled with a detection agent such as a color developing enzyme, a fluorescent substance, a radioactive isotope, or a colloid. The coloring enzyme may be peroxidase, alkaline phosphatase or acidic phosphatase, and the fluorescent substance is thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl , 2',7'-dichlorofluorescein-5-yl, 2',7'-dichlorofluorescein-6-yl, dihydro tetramethylrosamin-4-yl, tetramethylrhodamine-5-yl , Tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl or 4,4-difluoro Rho-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), Rhoda Min-B-isothiocyanate (RITC), PE (Phycoerythrin), or rhodamine.

In addition, the DNA aptamer may include a ligand capable of specifically binding to the DNA aptamer. The ligand may be a conjugate labeled with a detection agent such as a chromogenic enzyme, a fluorescent substance, a radioactive isotope or a colloid, and a ligand treated with streptavidin or avidin. In addition to the reagents described above, the composition for detection of the present invention may further contain distilled water or a buffer solution to stably maintain their structure.

The kit comprising the composition for detection according to the present invention may be bound to a solid substrate to facilitate subsequent steps such as washing of the DNA aptamer contained therein or separation of the complex. In this case, as the solid substrate, synthetic resin, nitrocellulose, glass substrate, metal substrate, glass fiber, microspheres or fine beads may be used. In addition, polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF or nylon may be used as the synthetic resin.

In addition, the kit may be prepared by a conventional manufacturing method known to those skilled in the art, and may further include a buffer, a stabilizer, an inactive protein, and the like. The kit includes high-speed screening through a fluorescence method performed by detecting the fluorescence of a fluorescent substance attached as a detection agent in order to detect the amount of reagent, or a radiographic method performed by detecting the radiation of a radioactive isotope attached as a detection agent. A screening, HTS) system, a surface plasmon resonance (SPR) method that measures changes in plasmon resonance of a surface in real time without labeling a detection object, or a surface plasmon resonance imaging (SPRI) method that confirms by imaging an SPR system can be used.

In addition, the present invention provides a capsid protein detection method comprising the step of reacting the composition for detection with a sample.

The DNA aptamer used in the method for detecting a capsid protein according to the present invention may have the above-described characteristics. For example, the DNA aptamer may be selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11. In addition, the capsid protein may be a capsid protein of foot-and-mouth disease virus.

The sample may include any sample as long as it is a sample for which capsid protein is to be detected. In addition, the sample may be pretreated using methods such as anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, continuous extraction, centrifugation, or gel electrophoresis.

In addition, the present invention provides a composition and kit for diagnosis of foot-and-mouth disease virus comprising the DNA aptamer.

The DNA aptamer included in the composition and kit for diagnosis of foot-and-mouth disease virus according to the present invention may have the characteristics as described above. For example, the DNA aptamer may be selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11. In addition, the composition and kit for diagnosing foot-and-mouth disease virus may have the characteristics as described above.

Furthermore, the present invention provides a method for diagnosing foot-and-mouth disease virus comprising reacting the diagnostic composition with a sample.

The DNA aptamer used in the method for diagnosing foot-and-mouth disease virus according to the present invention may have the above-described characteristics. For example, the DNA aptamer may be selected from the group consisting of the nucleotide sequences described in SEQ ID NOs: 1 to 11.

The sample may include any sample as long as it is a sample for diagnosis of foot-and-mouth disease virus. As an example, the sample may be a sample derived from a mammal, and specifically, may be a sample derived from a right-wing animal. In addition, the sample may be any one or more selected from the group consisting of blood, saliva, tear fluid, urine fluid, synovial fluid, mucus, cells and tissues.

In addition, the sample may be pretreated in the same manner as described above before being used in the method according to the present invention.

Hereinafter, the present invention will be described in detail by the following examples, provided that the following examples are for illustrative purposes only, and the present invention is not limited thereto. Anything that has substantially the same configuration as the technical idea described in the claims of the present invention and achieves the same operation and effects is included in the technical scope of the present invention.

Example 1. Amplification of random DNA library

In order to select a DNA aptamer that specifically binds to the capsid protein of foot-and-mouth disease virus, a DNA library was first prepared as described below.

_{Specifically, dA:dG:dC:dT is a template DNA of 76 bp size containing 40} random nucleotide sequences (N 40) contained in a ratio of 1.5:1.15:1.25:1 and a forward primer therefor (SEQ ID NO: 12 : 5'-ATACCAGCTTATTCAATT-3'), reverse primer (SEQ ID NO: 13: 5'-AGATTGCACTTACTATCT-3'), and a reverse primer in which the 5'-end of the reverse primer is biotinylated was used by Bioneer (Korea ) Was made to order. 1 μl of template DNA, 5 μl of 10x PCR buffer, 4 μl of dNTP mixture, 2 μl of 25 μM forward primer, 2 μl of 25 μM biotinylated reverse primer, 0.25 μl of ExTaq polymerase (Takara, Japan ) (1 unit/µl) and 35.75 µl of distilled water were mixed to prepare a PCR reaction product. The prepared reaction product was subjected to PCR under the conditions as described in Table 1 below. The obtained PCR product was confirmed through 2% agarose gel electrophoresis, and the results are shown in FIG. 1.

Early stage of metamorphosis 95℃, 5 minutes 1 time Metamorphic stage 95℃, 30 seconds 4 times Annealing step 55℃, 30 seconds Elongation step 72℃, 30 seconds Late stretching stage 72℃, 5 minutes 1 time

As shown in FIG. 1, a PCR product having a size of 76 bp was identified, and it was purified using a PCR purification kit (Qiagen, USA).

Example 2. Amplification of single-stranded DNA

To prepare a DNA aptamer from the obtained 76 bp PCR product, single-strand DNA (ssDNA) was amplified by an asymmetric PCR method.

First, 1 μl of the PCR product obtained in Example 1, 10 μl of 10× PCR buffer, 8 μl of dNTP mixture, 10 μl of 25 μM forward primer (SEQ ID NO: 12), 2 μl of 25 μM biotinylation A PCR reaction product was prepared by mixing the reverse primer (SEQ ID NO: 13), 0.5 µl of ExTaq polymerase (Takara, Japan) (1 unit/µl) and 68.5 µl of distilled water. The prepared reaction was subjected to PCR under the conditions as described in Table 2 below. The obtained PCR product was confirmed through 2% agarose gel electrophoresis.

Early stage of metamorphosis 95℃, 5 minutes 1 time Metamorphic stage 95℃, 30 seconds 15 times Annealing step 55℃, 30 seconds Elongation step 72℃, 30 seconds Late stretching stage 72℃, 5 minutes 1 time

The confirmed PCR product was added with 100% ethanol corresponding to 3 times the volume and tRNA corresponding to 1/100 volume, and reacted at -70°C for 1 hour or more. After the reaction, centrifugation was performed for 15 minutes under conditions of 4° C. and 13,000 rpm, and the obtained pellet was dried at 65° C. 50 µl of distilled water was added to the dried pellet to obtain ssDNA, and the obtained ssDNA was confirmed by electrophoresis on a 2% agarose gel.

Example 3. Recovery of ssDNA

In order to remove biotin-conjugated double-stranded DNA (dsDNA) and ssDNA from the ssDNA obtained above and to secure pure forward ssDNA, a heating-cooling technique was performed as follows.

Specifically, 50 µl of distilled water was added to the ssDNA obtained in Example 2, and then reacted at 85° C. for 5 minutes to denature dsDNA into ssDNA, and then cooled to 4° C. to obtain ssDNA. The obtained ssDNA was immediately cooled to 4°C. 50 µl of streptavidin agarose resin (Pierce, USA) was added to the cooled ssDNA and reacted at room temperature for 1 hour. Thereafter, the reaction solution was centrifuged for 15 minutes under conditions of 4° C. and 13,000 rpm, and only the supernatant was taken. To the obtained supernatant, a PCI solution in which phenol:chloroform:isoamyl alcohol was mixed in a volume ratio of 25:24:1 was added in the same volume as the PCR product, and stirred vigorously. After stirring, it was centrifuged for 15 minutes under conditions of 4° C. and 13,000 rpm to obtain a supernatant. To the obtained supernatant, 1/100 volume of tRNA (Sigma aldrich, USA) and 3 volume of 100% ethanol were added and reacted at -70° C. for 1 hour or more. After the reaction, it was centrifuged for 20 minutes under conditions of 4° C. and 13,000 rpm to obtain a pellet. The obtained pellet was dried at 65° C., and then suspended in 50 μl of distilled water to obtain ssDNA. The result of confirming the obtained ssDNA through 2% agarose gel electrophoresis is shown in FIG. 2.

As shown in FIG. 2, ssDNA having a size of 76 bp was amplified by an asymmetric PCR method.

Example 4. Preparation of a DNA aptamer with a three-dimensional structure

To 25 µl of ssDNA obtained in Example 3, 25 µl of distilled water and 50 µl of 2×PBS (pH 7.2) were added. The mixture was denatured by boiling at 85° C. for 5 minutes, and then allowed to stand at room temperature for 1 hour or longer to cool slowly, thereby preparing a DNA aptamer having a three-dimensional structure from ssDNA.

Example 5. Selection of DNA aptamer specifically binding to capsid protein of foot-and-mouth disease virus

5-1. Selection of DNA aptamers that specifically bind to capsid proteins

DNA aptamer that specifically binds to the capsid protein of foot-and-mouth disease virus was selected using the SELEX technique.

Specifically, 2.1 μg/15 μl (26.15 pmol) of capsid protein was added to the DNA aptamer prepared in Example 4, and 1×PBS buffer was added to adjust the total volume to 200 μl. This was prepared by reacting at 4° C. for 12 hours or longer. On the other hand, nickel-nitrotriacetic acid agarose beads (Ni-NTA agarose bead, Qiagen, USA) were activated by adding 500 μl of 1× binding buffer twice. The prepared mixture was added to the activated Ni-NTA agarose beads and reacted at 4° C. for 1 hour. After the reaction, the reactant was centrifuged for 5 minutes at 4°C and 13,000 rpm to remove the supernatant, and the remaining beads were centrifuged for 5 minutes at 4°C and 13,000 rpm by adding 500 µl of 1× washing buffer. Washed by separating. After washing, 200 µl of 1×PBS buffer was added, boiled at 85° C. for 5 minutes, and centrifuged for 10 minutes at 13,000 rpm at 4° C. to obtain a denatured DNA aptamer, which was performed twice. . Thereafter, the obtained pellet was subjected to an ethanol precipitation method as described above to finally recover the DNA aptamer suspended in 50 µl of distilled water.

5-2. Removal of non-specifically bound DNA aptamer

The following experiment was performed to remove the non-specific DNA aptamer that binds to the Ni-NTA agarose resin, not the capsid protein, and at the same time improve the specificity of the DNA aptamer that binds to the capsid protein.

First, using the DNA aptamer obtained in Example 5-1, the process of Example 2-1 was repeated 6 times to select a DNA aptamer with improved specificity. Using the selected DNA aptamer, a negative SELEX (negative SELEX) was performed to select a DNA aptamer that binds to the Ni-NTA agarose resin to which the capsid protein is not bound. The experiment was performed in the same conditions and method as in Example 5-1, except that only activated Ni-NTA agarose resin was used instead of adding the capsid protein and Ni-NTA agarose resin together. At this time, the DNA aptamer was obtained only the aptamer that does not bind to the Ni-NTA agarose resin. Using the obtained aptamer, the process of Example 5-1 was repeated five more times to perform SELEX for a total of 11 times, thereby finally obtaining an aptamer that specifically binds to the capsid protein.

Example 6. Selection of high affinity DNA aptamer pool

6-1. Confirmation of affinity using the nanodrop method

The affinity for the capsid protein of the DNA aptamer obtained in each round through 11 SELEX was confirmed by the nanodrop method.

Specifically, the concentration of the DNA aptamer sample obtained each time in Example 5 was measured using a nanodrop (Nanodrop 2000 Micro spectrophotometer, Thermo scientific) according to the manufacturer's protocol.

As a result, as shown in FIG. 3, the concentration of DNA aptamer obtained in 10 times was the highest at 809 ng/µl. Accordingly, it was found that the DNA aptamer pool obtained after performing SELEX 10 times from the above specifically binds to the capsid protein.

6-2. Affinity check using real-time PCR method

As a result of nanodrops, SELEX, which was confirmed to have high affinity with the capsid protein of foot-and-mouth disease virus, was performed 8 to 11 times, and the affinity was reconfirmed through real-time PCR using a DNA aptamer pool. The experiment was carried out in a conventional manner using iQ SYBR Green Supermix (Bio-rad, USA) on a sample in which SELEX was performed 8 to 11 times. At this time, PCR conditions are shown in Table 3 below, and the resulting C(t) values are shown in Table 4.

Early stage of metamorphosis 95℃, 5 minutes 1 time Metamorphic stage 95℃, 20 seconds 30 times Annealing step 55℃, 20 seconds Elongation step 72℃, 20 seconds Late stretching stage 72℃, 5 minutes 1 time

DNA Aptamer Pool C(t) value 8 times 17.77 9 times 16.45 10 times 14.98 11 times 16.12

As shown in Table 4, it was confirmed that the DNA aptamer pool obtained after performing SELEX 10 times showed the lowest C(t) value, thereby having the highest affinity with the capsid protein.

Example 7. Sequence confirmation of DNA aptamer

The sequence of the DNA aptamer obtained through 10 SELEX acquisitions, which was found to have the highest affinity with the capsid protein of the foot-and-mouth disease virus, was confirmed by the following method.

First, PCR was performed using the DNA aptamer obtained by performing SELEX 10 times in Example 5 as a template to obtain double-stranded DNA. The obtained dsDNA was cloned into a T-vector according to the manufacturer's protocol using a T-blunt cloning kit (SolGent, Korea).

Specifically, 1 µl of T-vector (10 ng/µl), 4 µl of PCR product (20 ng/µl), and 1 µl of 6x T-blunt buffer were reacted at 25° C. for 5 minutes. The reaction was mixed with 100 μl of a DH5α water-soluble strain, and transformed by applying heat shock at 42° C. for 30 seconds. This was left on ice for 5 minutes, and 900 μl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO ₄ and 20 mM glucose) was added thereto. Incubated at 37° C. for 1 hour. 200 [mu]l of the culture medium was 50 [mu]g/ml ampicillin (Sigma Aldrich, USA), 50 [mu]g/ml kanamycin (Sigma Aldrich, USA), 50 [mu]g/ml X-gal (X-gal, Sigma Aldrich, USA) and It was spread on an LB culture plate containing 5 μg/ml of IPTG (Thermo Scientific, USA). After incubating this for 15 hours at 37°C, only white colonies were selected among the generated colonies to extract DNA by a conventional method, and the nucleotide sequence was requested to Solgent (Korea), and the results are shown in Table 5 below.

Clone Sequence (5'→3') Size (bp) Sequence number P1-1 CGAGTACAGGAAATCTGACGGTTTATTATCATATGACTCG 40 SEQ ID NO: 1 P1-2 GCCCGATACATTGCTTCCATCATTGATCCTCTTTTCCTCG 40 SEQ ID NO: 2 P1-3 CCGGTCTCCTAGTACTGGAAATATAGCTCTGTTTTGTTCG 40 SEQ ID NO: 3 P1-4 CGAGATAGTAAGTGACTCTCAGTTTCTCGTGACATCGCCTCCG 40 SEQ ID NO: 4 P1-5 GCGGATACGAGCATTGTCGGTGATCTTTTTTTGTTTTGTG 40 SEQ ID NO: 5 P1-6 GCAGAGTCCGCGATCTATGGTAATTATTCAATTCG 40 SEQ ID NO: 6 P1-7 GGATCCAACTACAGGACGTTAGAGTAGGTTTATGTTCTCA 40 SEQ ID NO: 7 P1-8 CCATGTTATGAACTTTCTGCCTACGACGATACTCTCTTGG 40 SEQ ID NO: 8 P1-9 GCCATGAGTTGCCTGGATCTAGTAGATAGGGCGTTCATCA 40 SEQ ID NO: 9 P1-10 CGAGACACCGATAAATATGTGAATGTCGGTAACGTTATGG 40 SEQ ID NO: 10 P1-11 CAACCACGAACGGACTTTGGGTTCAGTGTTCCATCTCAGG 40 SEQ ID NO: 11

As shown in Table 5, the sequences of 11 DNA aptamers specifically binding to the capsid protein were identified.

Experimental Example 1. Structure confirmation of DNA aptamer

In Experimental Example 1, the structure of 11 DNA aptamers that bind to the capsid protein with high affinity are imaged using a DNA mfold program (Rensselear polytechnic institute) is shown in FIG. 4.

Experimental Example 2. Confirmation of affinity of DNA aptamer for capsid protein of foot-and-mouth disease virus

2-1. Fabrication of capsid protein coated sensor chip

In order to quantitatively confirm the binding strength of the DNA aptamer selected through surface plasmon resonance (SPR) experiments, a sensor chip coated with a capsid protein was fabricated in the following manner.

First, a mixture of 0.1 M NHS (Nhydroxysuccinimide) and 0.4 M EDC (N-ethyl-N' (dimethylaminopropyl) carbodiimide) in a sensor chip CM5 (GE healthcare, UK) coated with a carboxyl group was added at 10 µl/min. It flowed for 7 minutes at a speed to activate the carboxyl group on the surface. A 10 mM sodium acetate (pH 4.5) solution containing the capsid protein of foot-and-mouth disease virus at a concentration of 60 µg/ml on the surface of the carboxyl group-activated sensor chip CM5 was treated for 10 minutes at a rate of 10 µl/min. 1 M ethanolamine hydrochloride was flowed on the sensor chip CM5 coated with the capsid protein at a rate of 10 μl/min for 10 minutes to inactivate the activated carboxyl groups on the surface. As a result, a sensor chip CM5 coated with a capsid protein on the surface was fabricated.

2-2. Confirmation of affinity of DNA aptamer

The affinity of the selected DNA aptamer to the capsid protein of the foot-and-mouth disease virus was quantitatively confirmed using the SPR method.

First, the 11 DNA aptamers selected in Example 7 were prepared by diluting each of them to a concentration of 1.000, 1,500, 2,000, or 3,000 nM in HBS-EP buffer (GE Healthcare, BR-1001-88). The experiment was performed according to the manufacturer's protocol using BIAcore 3000 (BIACORE), and the binding force of the DNA aptamer to the sensor chip CM5 coated with the capsid protein produced in Experimental Example 2-1 and the sensor chip CM5 without any coating The difference in the binding power of the DNA aptamer was confirmed. At this time, the rate variable was obtained and quantified using the BIA evaluation program (BIACORE), and after each experiment, the sensor chip was regenerated using 50 mM NaOH buffer.

Aptamer Coupling force K _D value (M) P1-1 3.436×10 ^-10 P1-4 6.675×10 ^-14 P1-9 9.284×10 ^-11

As a result, as shown in Table 6, it was confirmed that the P1-1, P1-4 and P1-9 DNA aptamers have the best affinity for binding to the capsid protein of the foot-and-mouth disease virus.

Experimental Example 3. Confirmation of foot-and-mouth disease virus detection using DNA aptamer

In Experimental Example 2, the ability to detect foot-and-mouth disease virus of the three DNA aptamers, which were found to have excellent binding power with the capsid protein, was confirmed by ELISA. The experiment was performed using the PrioCHECK FMDV Type O Antibody ELISA kit (ThermoFisher SCIENTIFIC, USA), and instead of the antibody included in the kit, P1-1, P1-4 or P1-9 DNA aptamer was labeled with Cy5. In addition, before measuring the fluorescence value using a SpectraMax M2 instrument, it was washed several times with 1×PBS to remove the aptamer that did not bind to the virus. The ELISA results are shown in FIG. 5.

As shown in FIG. 5, it was confirmed that the DNA aptamer according to the present invention can be usefully used for detection of foot-and-mouth disease virus by binding with high binding force to foot-and-mouth disease virus.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> DNA APTAMER SPECIFICALLY BINDING TO CAPSID PROTEIN OF FOOT-AND-MOUTH DISEASE VIRUS AND USING THE SAME <130> DP-2019-0269-KR <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-1 <400> 1 cgagtacagg aaatctgacg gtttattatc atatgactcg 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-2 <400> 2 gcccgataca ttgcttccat cattgatcct cttttcctcg 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-3 <400> 3 ccggtctcct agtactggaa atatagctct gttttgttcg 40 <210> 4 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> P1-4 <400> 4 cgagatagta agtgactctc agtttctcgt gacatcgcct ccg 43 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-5 <400> 5 gcggatacga gcattgtcgg tgatcttttt ttgttttgtg 40 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P1-6 <400> 6 gcagagtccg cgatctatgg taattattca attcg 35 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-7 <400> 7 ggatccaact acaggacgtt agagtaggtt tatgttctca 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-8 <400> 8 ccatgttatg aactttctgc ctacgacgat actctcttgg 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-9 <400> 9 gccatgagtt gcctggatct agtagatagg gcgttcatca 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-10 <400> 10 cgagacaccg ataaatatgt gaatgtcggt aacgttatgg 40 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> P1-11 <400> 11 caaccacgaa cggactttgg gttcagtgtt ccatctcagg 40 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 12 ataccagctt attcaatt 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 13 agattgcact tactatct 18 <210> 14 <211> 651 <212> PRT <213> Foot-and-mouth disease virus <400> 14 Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu Glu Asp Arg Ile Leu Thr 1 5 10 15 Thr Arg Asn Gly His Thr Thr Ser Thr Thr Gln Ser Ser Val Gly Val 20 25 30 Thr Tyr Gly Tyr Ala Thr Ala Glu Asp Phe Val Ser Gly Pro Asn Thr 35 40 45 Ser Gly Leu Glu Thr Arg Val Ala Gln Ala Glu Arg Phe Phe Lys Thr 50 55 60 His Leu Phe Asp Trp Val Thr Ser Asp Pro Phe Gly Arg Cys His Leu 65 70 75 80 Leu Glu Leu Pro Thr Asp His Lys Gly Val Tyr Gly Ser Leu Thr Asp 85 90 95 Ser Tyr Ala Tyr Met Arg Asn Gly Trp Asp Val Glu Val Thr Ala Val 100 105 110 Gly Asn Gln Phe Asn Gly Gly Cys Leu Leu Val Ala Met Val Pro Glu 115 120 125 Leu Cys Ser Ile Gln Lys Arg Glu Leu Tyr Gln Leu Thr Leu Phe Pro 130 135 140 His Gln Phe Ile Asn Pro Arg Thr Asn Met Thr Ala His Ile Thr Val 145 150 155 160 Pro Phe Val Gly Val Asn Arg Tyr Asp Gln Tyr Lys Val His Lys Pro 165 170 175 Trp Thr Leu Val Val Met Val Val Ala Pro Leu Thr Val Asn Ser Glu 180 185 190 Gly Ala Pro Gln Ile Lys Val Tyr Ala Asn Ile Ala Pro Thr Asn Val 195 200 205 His Val Ala Gly Glu Phe Pro Ser Lys Glu Gly Ile Phe Pro Val Ala 210 215 220 Cys Ser Asp Gly Tyr Gly Gly Leu Val Thr Thr Asp Pro Lys Thr Ala 225 230 235 240 Asp Pro Ala Tyr Gly Lys Val Phe Asn Pro Pro Arg Asn Met Leu Pro 245 250 255 Gly Arg Phe Thr Asn Phe Leu Asp Val Ala Glu Ala Cys Pro Thr Phe 260 265 270 Leu Arg Phe Glu Gly Gly Val Pro Tyr Val Thr Thr Lys Thr Asp Ser 275 280 285 Asp Arg Val Leu Ala Gln Phe Asp Leu Ser Leu Ala Ala Lys His Met 290 295 300 Ser Asn Thr Phe Leu Ala Gly Leu Ala Gln Tyr Tyr Thr Gln Tyr Ser 305 310 315 320 Gly Thr Ile Asn Leu His Phe Met Phe Thr Gly Pro Thr Asp Ala Lys 325 330 335 Ala Arg Tyr Met Ile Ala Tyr Ala Pro Pro Gly Met Glu Pro Pro Lys 340 345 350 Thr Pro Glu Ala Ala Ala His Cys Ile His Ala Glu Trp Asp Thr Gly 355 360 365 Leu Asn Ser Lys Phe Thr Phe Ser Ile Pro Tyr Leu Ser Ala Ala Asp 370 375 380 Tyr Ala Tyr Thr Ala Ser Asp Thr Ala Glu Thr Thr Asn Val Gln Gly 385 390 395 400 Trp Val Cys Leu Phe Gln Ile Thr His Gly Lys Ala Asp Gly Asp Ala 405 410 415 Leu Val Val Phe Ala Ser Ala Gly Lys Asp Phe Glu Leu Arg Leu Pro 420 425 430 Val Asp Ala Arg Thr Gln Thr Thr Ser Ala Gly Glu Ser Ala Asp Pro 435 440 445 Val Thr Ala Thr Val Glu Asn Tyr Gly Gly Glu Thr Gln Val Gln Arg 450 455 460 Arg Gln His Thr Asp Val Ser Phe Ile Leu Asp Arg Phe Val Lys Val 465 470 475 480 Thr Pro Lys Asp Gln Ile Asn Val Leu Asp Leu Met Gln Thr Pro Ala 485 490 495 His Thr Leu Val Gly Ala Leu Leu Arg Thr Ala Thr Tyr Tyr Phe Ala 500 505 510 Asp Leu Glu Val Ala Val Lys His Glu Gly Asn Leu Thr Trp Val Pro 515 520 525 Asn Gly Ala Pro Glu Ala Ala Leu Asp Asn Thr Thr Asn Pro Thr Ala 530 535 540 Tyr His Lys Ala Pro Leu Thr Arg Leu Ala Leu Pro Tyr Thr Ala Pro 545 550 555 560 His Arg Val Leu Ala Thr Val Tyr Asn Gly Asn Cys Lys Tyr Gly Asp 565 570 575 Gly Thr Val Ala Asn Val Arg Gly Asp Leu Gln Val Leu Ala Gln Lys 580 585 590 Ala Ala Arg Ala Leu Pro Thr Ser Phe Asn Tyr Gly Ala Ile Lys Ala 595 600 605 Thr Arg Val Thr Glu Leu Leu Tyr Arg Met Lys Arg Ala Glu Thr Tyr 610 615 620 Cys Pro Arg Pro Leu Leu Ala Ile His Pro Asp Gln Ala Arg His Lys 625 630 635 640 Gln Lys Ile Val Ala Pro Val Lys Gln Leu Leu 645 650

Claims (9)

A DNA aptamer that specifically binds to a capsid protein composed of a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 11.
The DNA aptamer of claim 1, wherein the capsid protein is a capsid protein of foot-and-mouth disease virus.
The DNA aptamer according to claim 2, wherein the capsid protein of the foot-and-mouth disease virus is a polypeptide composed of the amino acid sequence set forth in SEQ ID NO: 14.
A composition for detecting a capsid protein comprising the DNA aptamer of claim 1.
A kit for detecting a capsid protein comprising the DNA aptamer of claim 1.
Capsid protein detection method comprising the step of reacting the composition for detection of claim 4 with a sample.
A composition for diagnosis of foot-and-mouth disease virus comprising the DNA aptamer of claim 1.
A kit for diagnosis of foot-and-mouth disease virus comprising the DNA aptamer of claim 1.
A method for diagnosing foot-and-mouth disease virus comprising the step of reacting the diagnostic composition of claim 7 with a sample.

Images