KR102127949B1 - Dna aptamer specifically binding to erg11 protein and using the same - Google Patents

Dna aptamer specifically binding to erg11 protein and using the same Download PDF

Info

Publication number
KR102127949B1
KR102127949B1 KR1020180141866A KR20180141866A KR102127949B1 KR 102127949 B1 KR102127949 B1 KR 102127949B1 KR 1020180141866 A KR1020180141866 A KR 1020180141866A KR 20180141866 A KR20180141866 A KR 20180141866A KR 102127949 B1 KR102127949 B1 KR 102127949B1
Authority
KR
South Korea
Prior art keywords
dna aptamer
dna
protein
erg11
present
Prior art date
Application number
KR1020180141866A
Other languages
Korean (ko)
Other versions
KR20200057444A (en
Inventor
김양훈
신우리
오인환
이진표
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020180141866A priority Critical patent/KR102127949B1/en
Publication of KR20200057444A publication Critical patent/KR20200057444A/en
Application granted granted Critical
Publication of KR102127949B1 publication Critical patent/KR102127949B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/205—Aptamer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Birds (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 ERG11 단백질에 특이적으로 결합하는 DNA 앱타머 및 이의 용도에 관한 것이다. 구체적으로, 본 발명에 따른 DNA 앱타머는 피부사상균에서 균주의 막투과성을 결정짓는 효소인 ERG11 단백질에 특이적으로 강하게 결합하여 상기 균주의 성장을 억제시킴으로써, 피부사상균의 감염에 의한 질환의 치료, 개선 등의 용도뿐만 아니라, 피부사상균의 검출이나 피부사상균의 감염에 의한 질환의 진단에도 유용하게 사용될 수 있다.The present invention relates to a DNA aptamer that specifically binds ERG11 protein and its use. Specifically, the DNA aptamer according to the present invention specifically binds strongly to the ERG11 protein, an enzyme that determines the membrane permeability of the strain from dermatophytes, thereby inhibiting the growth of the strain, thereby treating and improving the disease caused by infection of dermatophytes It can be useful not only for the purpose of the use, but also for the detection of dermatophytes and the diagnosis of diseases caused by infection of dermatophytes.

Figure R1020180141866
Figure R1020180141866

Description

ERG11 단백질에 특이적으로 결합하는 DNA 앱타머 및 이의 용도{DNA APTAMER SPECIFICALLY BINDING TO ERG11 PROTEIN AND USING THE SAME}DNA aptamer specifically binding to ERG11 protein and use thereof{DNA APTAMER SPECIFICALLY BINDING TO ERG11 PROTEIN AND USING THE SAME}

본 발명은 ERG11 단백질에 특이적으로 결합하는 DNA 앱타머 및 이의 용도에 관한 것이다.The present invention relates to a DNA aptamer that specifically binds ERG11 protein and its use.

피부사상균(dermatophyte)은 사람을 포함하는 대부분의 동물의 피부, 손발톱, 털, 수염 등 비교적 표층부에 기생하는 진균의 총칭으로 우리나라에서는 피부 진균 또는 피부사상균이라 부른다. 피부사상균은 백선, 무좀, 기계충 등 다양한 증상의 원인균으로서, 서식지에 따라 인간 친화성, 동물 친화성 또는 토양 친화성으로 분류된다. 이중 인간 친화성 사상균은 숙주가 인간으로만 제한되고 가볍고 만성적인 염증을 유발한다. 한편, 동물 친화성 사상균은 주로 동물에서만 발견되며, 동물과 접촉한 사람들에게서 강한 면역반응을 일으킨다. 또한, 토양 친화성 사상균은 보통 토양에서 발견되지만 종종 사람과 동물을 감염시킨다.Dermatophyte is a generic term for fungi that are parasitic on relatively superficial areas such as skin, nails, hair, and whiskers of most animals, including humans. In Korea, it is called skin fungus or dermatophyte. Dermatophyte is a causative agent of various symptoms such as ringworm, athlete's foot, and mechanical insects, and is classified into human affinity, animal affinity, or soil affinity depending on the habitat. Of these, human-friendly filamentous fungi limit the host to humans only and cause mild, chronic inflammation. On the other hand, animal-friendly filamentous fungi are mainly found only in animals, and cause strong immune responses in people who come into contact with animals. In addition, soil-friendly filamentous fungi are usually found in soil, but often infect humans and animals.

이들 피부사상균은 뚜렷한 면역반응을 야기시키지만 감염이 퍼지는 정도가 제한되어 있고, 자발적으로 치료될 수 있다. 불완전균아문(moniliaceae)과의 소포자균(microsporum), 백선균(trichophyton) 및 표피균(epidermophyton)의 3가지 속이 피부사상균에 포함되며, 세계적으로 42종이 상기 3가지 속에 포함되어 있다고 알려져 있다.These dermatophytes cause a pronounced immune response, but the extent to which infection spreads is limited and can be treated spontaneously. It is known that three genus of microsporum, trichophyton, and epidermophyton of the incomplete family of monoiliaceae are included in dermatophytes, and 42 are included in the three genus worldwide.

피부사상균은 친 케라틴성 진균이라고도 불리는데, 모발, 손발톱 및 표피 각질층 내에 국한하여 침입 및 발육하기 때문이다. 이들 균은 케라틴으로 구성된 부위에서 주로 기생하며, 자신들이 가지고있는 케라틴 분해효소의 작용으로 케라틴을 분해하여 영양원으로 이용한다.Dermatophytes are also called pro-keratinic fungi because they are confined and develop in the hair, nails and epidermal stratum corneum. These bacteria are mainly parasitic in the area composed of keratin, and they decompose keratin under the action of their keratinase and use it as a nutrient.

피부사상균이 표피의 각질층, 피부, 손발톱, 털, 수염 등에 기생해서 발생하는 피부질환은, 곰팡이에 의해 발생하는 모든 피부질환을 의미하며 크게 표재성과 심재성으로 나눌 수 있다. 그 종류로는 두부 백선, 안면 백선, 체부 백선, 완선수족부 백선, 손발톱 백선 등이 있다. 수족부 백선은 공중목욕탕이나 수영장 등 사람이 많은 장소에서 환자로부터 떨어져 나온 각질을 통해 감염되고, 완선은 고온다습한 환경과 발한, 비만증, 밀착한 내의와의 기계적 마찰 등이 주요 원인이다.Skin diseases caused by dermatophytes parasitic on the stratum corneum of the epidermis, skin, nails, hair, beards, etc., mean all skin diseases caused by fungi and can be largely divided into superficiality and heartwood. The types include ringworm, facial ringworm, ringworm, ringworm, and nail ringworm. The ringworm of the limb is infected through keratin from the patient in places where there are many people, such as public baths or swimming pools, and the complete disease is mainly caused by high temperature and high humidity environment, sweating, obesity, and mechanical friction with a tight undergarment.

피부사상균에 의한 감염의 치료는 국소 도포제를 바르는 것이 원칙인데, 손발톱 백선 및 두부 백선 감염부위가 너무 광범위하거나 국소 도포제로 치료가 안되는 경우 항진균제를 복용한다. 현재 톨나프테이트(tolnaftate), 마이코나졸(miconazole), 클로트리마졸(clotrimazole), 테르비나파인(terbinafine) 등이 화합물이 포함된 액제나 크림제가 국소 도포제로서 사용되고 있다. 이와 관련하여, 대한민국 특허등록 제10-0771192호는 티트리 오일의 일종인 렙토스퍼뭄 피터소니 오일(leptospermum petersonii oil)이 피부사상균에 대한 항진균 활성을 나타냄을 개시하고 있다.It is a principle to apply a topical coating agent to treat infections caused by dermatophytes. If the area of infection of the nail ringworm and the head ringworm is too wide or cannot be treated with a topical coating agent, take an antifungal agent. Currently, liquid solutions or creams containing compounds such as tolnafate, miconazole, clotrimazole, and terbinafine are used as topical coating agents. In this regard, Korean Patent Registration No. 10-0771192 discloses that leptospermum petersonii oil, a type of tea tree oil, exhibits antifungal activity against dermatophytes.

한편, 앱타머(aptamer)는 약 1012 내지 1014개 정도의 다양성을 갖는 랜덤 핵산 라이브러리로부터 얻어지는, 특정 표적에 대해 높은 특이성과 친화도를 갖는 단일가닥의 RNA 또는 DNA 분자 구조체를 의미한다. 앱타머는 종래 감지물질로서 사용되는 항체와 달리 열 안정성이 우수하고, 시험관 내(in vitro)에서 합성되어 경제적이며, 표적 물질에 제약이 없어 다양한 표적에 대한 앱타머의 생산이 가능하다는 점에서 유용하다. 따라서, 현재 다양한 표적 물질에 대한 앱타머가 연구 및 제조되고 있으며, 표적 물질과 특이적으로 강한 친화도로 결합하는 앱타머의 특성으로 인해, 신약개발, 약물전달 시스템 및 바이오센서 등에 응용되고 있다.On the other hand, aptamer (aptamer) refers to a single-stranded RNA or DNA molecular structure having high specificity and affinity for a specific target, obtained from a random nucleic acid library having a diversity of about 10 12 to 10 14 . Unlike antibodies used as sensing materials, aptamers have excellent thermal stability, are economically synthesized in vitro , and are useful in that they can produce aptamers for various targets because there are no restrictions on target materials. . Accordingly, aptamers for various target substances are currently being researched and manufactured, and are applied to new drug development, drug delivery systems, biosensors, etc. due to the properties of aptamers that specifically bind to target substances with strong affinity.

대한민국 특허등록 제10-0771192호Republic of Korea Patent Registration No. 10-0771192

본 발명의 목적은 ERG11 단백질에 특이적으로 결합하는 특정 염기서열로 구성되는 DNA 앱타머 및 이의 용도를 제공하는 것이다.An object of the present invention is to provide a DNA aptamer composed of a specific nucleotide sequence that specifically binds to ERG11 protein and its use.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 7로 기재된 염기서열로 구성되는 ERG11(lanosterol 14-α-demethylase) 단백질에 특이적으로 결합하는 DNA 앱타머를 제공한다.In order to achieve the above object, the present invention provides a DNA aptamer that specifically binds to the ERG11 (lanosterol 14-α-demethylase) protein composed of the nucleotide sequence of SEQ ID NOs: 1 to 7.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 포함하는 약학적 조성물, 피부외용제 및 항균용 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition comprising a DNA aptamer according to the present invention, a composition for external application for skin and antibacterial.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 포함하는 피부사상균의 검출용 조성물 및 키트, 및 상기 조성물을 이용한 피부사상균의 검출방법을 제공한다.In addition, the present invention provides a composition and kit for the detection of dermatophytes comprising the DNA aptamer according to the present invention, and a method for detecting dermatophytes using the composition.

나아가, 본 발명은 본 발명에 따른 DNA 앱타머를 포함하는 피부사상균의 감염에 의한 질환의 진단용 조성물 및 키트, 및 상기 조성물을 이용한 피부사상균의 감염에 의한 질환의 진단에 필요한 정보를 제공하는 방법을 제공한다.Furthermore, the present invention provides a composition and kit for diagnosing a disease caused by infection of dermatophytes comprising the DNA aptamer according to the present invention, and a method for providing information necessary for diagnosis of a disease caused by infection of dermatophytes using the composition to provide.

본 발명에 따른 DNA 앱타머는 피부사상균에서 균주의 막투과성을 결정짓는 효소인 ERG11 단백질에 특이적으로 강하게 결합하여 상기 균주의 성장을 억제시킴으로써, 피부사상균의 감염에 의한 질환의 치료, 개선 등의 용도뿐만 아니라, 피부사상균의 검출이나 피부사상균의 감염에 의한 질환의 진단에도 유용하게 사용될 수 있다.The DNA aptamer according to the present invention specifically binds to the ERG11 protein, an enzyme that determines the membrane permeability of a strain in dermatophytes, and inhibits the growth of the strain, thereby treating, improving, etc. the disease caused by infection of dermatophytes In addition, it can be useful for the detection of dermatophytes or the diagnosis of diseases caused by infection of dermatophytes.

도 1은 본 발명의 일 실시예에서 정제된 ERG11 단백질을 SDS-PAGE 방법으로 확인한 결과 도면이다(M: 사이즈 마커, 1: ERG11 단백질을 발현하는 BL21(DE3) 균주의 배양 상층액, 2: ERG11 단백질을 발현하는 BL21(DE3) 균주의 배양 하층액, 3: ERG11 단백질을 발현하는 BL21(DE3) 균주에 0.1 mM의 IPTG를 첨가한 뒤 배양한 배양 상층액, 4: ERG11 단백질을 발현하는 BL21(DE3) 균주에 0.1 mM의 IPTG를 첨가한 뒤 배양한 배양 하층액, 5: ERG11 단백질을 발현하는 BL21(DE3) 균주에 0.5 mM의 IPTG를 첨가한 뒤 배양한 배양 상층액, 6: ERG11 단백질을 발현하는 BL21(DE3) 균주에 0.5 mM의 IPTG를 첨가한 뒤 배양한 배양 하층액, 7: ERG11 단백질을 발현하는 BL21(DE3) 균주에 1 mM의 IPTG를 첨가한 뒤 배양한 배양 상층액, 8: ERG11 단백질을 발현하는 BL21(DE3) 균주에 1 mM의 IPTG를 첨가한 뒤 배양한 배양 하층액).
도 2는 본 발명의 일 실시예에서 증폭 및 정제된 DNA 라이브러리를 아가로스 겔 전기영동으로 확인한 결과 도면이다(M: 사이즈 마커, 1 및 2: PCR 산물, 3 및 4: 정제된 PCR 산물).
도 3은 본 발명의 일 실시예에서 수득된 DNA 앱타머와 ERG11 단백질의 결합력을 SELEX 수행 횟수에 따라 나노드랍 방법으로 확인한 결과 그래프이다.
도 4는 본 발명의 일 실시예에서 선별된 27개의 DNA 앱타머를 이용하여 SELEX를 재수행하고, 수득된 DNA 앱타머와 ERG11 단백질의 결합력을 나노드랍 방법으로 확인한 결과 그래프이다.
도 5는 본 발명의 일 실시예에서 선별된 7개의 DNA 앱타머 구조를 이미지화한 결과 도면이다.
도 6은 본 발명의 일 실시예에서 ERG11 단백질이 코팅된 센서칩 CM5을 이용하여 SPR을 수행하는 과정을 나타내는 모식도이다.1 is a result of confirming the purified ERG11 protein in one embodiment of the present invention by SDS-PAGE method (M: size marker, 1: culture supernatant of BL21(DE3) strain expressing ERG11 protein, 2: ERG11 Culture supernatant of BL21(DE3) strain expressing protein, 3: Culture supernatant after adding 0.1 mM IPTG to BL21(DE3) strain expressing ERG11 protein, 4: BL21 expressing ERG11 protein DE3) Culture supernatant cultured after adding 0.1 mM IPTG to the strain, 5: Culture supernatant cultured after adding 0.5 mM IPTG to BL21 (DE3) strain expressing ERG11 protein, 6: ERG11 protein Culture supernatant cultured after adding 0.5 mM IPTG to expressing BL21 (DE3) strain, 7: Culture supernatant cultured after adding 1 mM IPTG to BL21 (DE3) strain expressing ERG11 protein, 8 : Incubated culture medium after adding 1 mM of IPTG to BL21 (DE3) strain expressing ERG11 protein).
Figure 2 is a result of confirming the amplified and purified DNA library in one embodiment of the present invention by agarose gel electrophoresis (M: size markers, 1 and 2: PCR products, 3 and 4: purified PCR products).
Figure 3 is a graph showing the results of confirming the binding force of the DNA aptamer and ERG11 protein obtained in one embodiment of the present invention according to the number of times SELEX is performed.
4 is a graph showing the results of confirming the binding strength of the obtained DNA aptamer and ERG11 protein by nanodrop method by performing SELEX again using 27 DNA aptamers selected in one embodiment of the present invention.
5 is a diagram showing the results of imaging the structure of seven DNA aptamers selected in one embodiment of the present invention.
6 is a schematic diagram showing a process of performing SPR using sensor chip CM5 coated with ERG11 protein in one embodiment of the present invention.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 서열번호 1 내지 7로 기재된 염기서열로 구성되는 ERG11(lanosterol 14-α-demethylase) 단백질에 특이적으로 결합하는 DNA 앱타머를 제공한다.The present invention provides a DNA aptamer that specifically binds to the ERG11 (lanosterol 14-α-demethylase) protein composed of the nucleotide sequence of SEQ ID NOs: 1 to 7.

본 명세서에 사용된 용어, "ERG11(lanosterol 14-α-demethylase) 단백질"은 진균의 막투과성을 결정하는데 중요한 역할을 하는 단백질을 의미한다. 상기 ERG11 단백질은 통상의 기술분야에 ERG11 단백질이라고 알려진 모든 서열을 포함할 수 있고, 본 발명의 일 실시예에서, 상기 ERG11 단백질을 암호화하는 폴리뉴클레오티드는 서열번호 8로 기재된 염기서열로 서열로 구성되는 폴리뉴클레오티드일 수 있다. ERG11 단백질은 이의 활성이 억제되면 진균에 존재하는 란노스테롤(lanosterol)이 에르고스테롤(ergosterol)로 전환되는 것을 막음으로써, 진균의 세포막을 파괴시켜 항진균 활성을 나타낼 수 있다.As used herein, the term "ERG11 (lanosterol 14-α-demethylase) protein" means a protein that plays an important role in determining the membrane permeability of fungi. The ERG11 protein may include all sequences known in the art as ERG11 protein, and in one embodiment of the present invention, the polynucleotide encoding the ERG11 protein consists of a sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 8. It may be a polynucleotide. When the ERG11 protein is inhibited, it prevents the conversion of lanosterol present in the fungus into ergosterol, thereby destroying the cell membrane of the fungus and exhibiting antifungal activity.

상기 ERG11 단백질은 피부사상균 유래의 단백질일 수 있고, 구체적으로, 소포자균(microsporum), 백선균(trichophyton) 또는 표피균(epidermophyton) 속의 균주로부터 유래된 단백질일 수 있다. 일례로, 상기 소포자균은 마이크로스포럼 카니스(microsporum canis), 마이크로스포럼 집세움(microsporum gypseum) 및 마이크로스포럼 오두앵(microsporum audouinii) 등을 포함할 수 있다. 또한, 상기 백선균은 트리코피톤 루브럼(trichophyton rubrum), 트리코피톤 멘타그로파이트(trichophyton mentagrophytes), 트리코피톤 인터디지탈리스(trichophyton interdigitalis) 등을 포함할 수 있다. 나아가, 상기 표피균은 에피더모파이톤 플로코섬(epidermophyton floccosum) 등을 포함할 수 있다. 본 발명의 일 실시예에서, 상기 피부사상균은 트리코피톤 루브럼일 수 있다.The ERG11 protein may be a protein derived from dermatophyte, and specifically, may be a protein derived from a strain of the genus Microsporum, Trichophyton, or Epidermophyton. For example, the endoplasmic reticulum may include microsporum canis, microsporum gypseum, microsporum audouinii, and the like. In addition, the ringworm may include trichophyton rubrum, trichophyton mentagrophytes, trichophyton interdigitalis, and the like. Furthermore, the epidermis may include epidermophyton floccosum and the like. In one embodiment of the present invention, the dermatophyte may be tricopitone rubrum.

본 명세서에서 사용된 용어, "앱타머(aptamer)"는 특정 물질에 고친화성 및 특이성으로 결합할 수 있는 DNA 핵산분자를 의미한다. 상기 앱타머는 통상의 기술분야에 잘 알려진 방법으로 제조될 수 있고, 상기 방법은 필요에 따라 적절히 변형될 수 있다.As used herein, the term "aptamer" means a DNA nucleic acid molecule capable of binding to a specific substance with high affinity and specificity. The aptamer can be prepared by a method well known in the art, and the method can be appropriately modified as necessary.

본 발명에 따른 DNA 앱타머는 서열번호 1 내지 7로 기재된 염기서열로 구성될 수 있다. 상기 DNA 앱타머는 ERG11 단백질에 특이적으로 결합하는 특성을 유지하는 한, 상기 서열번호 1 내지 7로 기재된 염기서열과 80% 이상, 90% 이상, 95% 이상, 97% 이상 또는 99% 이상 상동성을 가질 수 있다.DNA aptamer according to the present invention may be composed of the nucleotide sequence of SEQ ID NO: 1 to 7. The DNA aptamer is 80% or more, 90% or more, 95% or more, 97% or more, or 99% or more homology to the nucleotide sequences set forth in SEQ ID NOs: 1 to 7 as long as it maintains the property of specifically binding to ERG11 protein. Can have

상기 DNA 앱타머는 표적 물질에 대한 결합성 및 안정성을 높이기 위해, 각 뉴클레오티드의 당 잔기, 구체적으로 리보오스 또는 디옥시리보스가 수식될 수 있다. 상기 수식은 당 잔기의 2'위치, 3'위치 및 4'위치로 구성된 군으로부터 선택되는 어느 하나 이상의 산소 원자를 다른 원자로 치환한 것일 수 있다. 수식의 예로는 플루오로화, O-알킬화, O-알릴화, S-알킬화, S-알릴화, 아미노화 등이 포함될 수 있다. 상기와 같은 당 잔기의 변형은 통상적인 방법으로 수행될 수 있다.The DNA aptamer may be modified with a sugar residue of each nucleotide, specifically ribose or deoxyribose, in order to increase binding and stability to the target substance. The formula may be one or more oxygen atoms selected from the group consisting of 2', 3', and 4'positions of the sugar residue. Examples of the modification may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, and the like. Modification of the sugar residue as described above may be performed in a conventional manner.

또한, 상기 DNA 앱타머는 표적 물질에 대한 결합성을 높이기 위해, 핵산염기가 변형될 수 있다. 상기 핵산염기의 변형은 5위치의 피리미딘 변형, 6위치의 푸린 변형, 8위치의 푸린 변형, 환외(環外) 아민에서의 변형, 4-티오우리딘으로의 치환, 5-브로모로의 치환 또는 5-요오드-우리실로의 치환 등을 포함할 수 있다.In addition, the nucleic acid base may be modified in order to increase the binding of the DNA aptamer to a target substance. The modification of the nucleic acid base is a pyrimidine modification at the 5 position, a purine modification at the 6 position, a purine modification at the 8 position, a modification at an extraneous amine, substitution with 4-thiouridine, substitution with 5-bromo. Or 5-iodine-urisyl substitution.

또한, 상기 DNA 앱타머는 뉴클레아제 및 가수분해효소 등에 대해 내성을 갖도록 인산기가 변형될 수 있다. 예를 들면, 상기 인산기는 티오에이트, 디티오에이트, 아미데이트, 포름아세탈, 3'-아민 등으로 치환될 수 있다. 나아가, 상기 DNA 앱타머는 3' 말단 또는 5' 말단의 변형을 포함할 수 있고, 상기 변형은 캡핑이나, 바이오티닐, 폴리에틸글리콜, 아미노산, 펩티드, 핵산, 뉴클레오시드, 미리스토일(myristoyl), 리소콜릭-올레일(lithocolic-oleyl), 도코사닐(docosanyl), 라우로일(lauroyl), 스테아로일(stearoyl), 팔미토일(palmitoyl), 올레오일(oleoyl), 리놀레오일(linoleoyl), 지질, 스테로이드, 콜레스테롤, 카페인, 비타민, 색소, 형광물질, 항암제, 독소, 효소, 방사성 물질, 비오틴 등이 부가된 것일 수 있다.In addition, the DNA aptamer may be modified with a phosphate group to be resistant to nuclease and hydrolase. For example, the phosphoric acid group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, or the like. Furthermore, the DNA aptamer may include modifications at the 3'end or the 5'end, wherein the modification is capping, biotinyl, polyethylglycol, amino acid, peptide, nucleic acid, nucleoside, myristoyl , Lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl , Lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agents, toxins, enzymes, radioactive substances, biotin, and the like may be added.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 유효성분으로 함유하는 피부사상균 감염에 의한 질환의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of diseases caused by dermatophyte infection containing the DNA aptamer according to the present invention as an active ingredient.

본 발명에 따른 약학적 조성물에 유효성분으로 함유되는 DNA 앱타머는 상술한 바와 같은 특징을 가질 수 있다.The DNA aptamer contained as an active ingredient in the pharmaceutical composition according to the present invention may have the characteristics as described above.

상기 피부사상균 감염에 의한 질환은 두부백선(tinea capitis), 무좀, 손톱진균증 또는 발톱진균증일 수 있고, 본 발명의 일 실시예에서, 상기 질환은 무좀일 수 있다.The disease caused by the dermatophyte infection may be tinea capitis, athlete's foot, nail mycosis, or toenail fungus, and in one embodiment of the present invention, the disease may be athlete's foot.

상기 약학적 조성물은 약학적 조성물 전체 중량에 대하여 유효성분인 본 발명에 따른 DNA 앱타머를 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 약학적 조성물은 상기 유효성분 외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 함유할 수 있다.The pharmaceutical composition may include 10 to 95% by weight of the DNA aptamer according to the present invention as an active ingredient relative to the total weight of the pharmaceutical composition. In addition, the pharmaceutical composition of the present invention may further contain one or more active ingredients exhibiting the same or similar function in addition to the active ingredients.

본 발명의 조성물은 또한 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 둘 이상의 이들의 조합을 포함할 수 있다. 약제학적으로 허용 가능한 담체는 조성물을 생체 내에 전달하는데 적합한 것이면 특별히 제한되지 않으며, 예로서, Merck Index, 13th ed., Merck & Co. Inc. 에 기재된 화합물, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 또는 이들 성분 중 1 성분 이상을 혼합한 것일 수 있다. 이때, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. The compositions of the present invention may also include carriers, diluents, excipients, or combinations of two or more of those commonly used in biological agents. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivering the composition in vivo, for example, Merck Index, 13th ed., Merck & Co. Inc. The compound, saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or one or more of these components may be mixed. At this time, other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary.

상기 조성물을 제제화할 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 제조될 수 있다.When formulating the composition, it may be prepared by using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are usually used.

본 발명의 조성물은 경구제제 또는 비경구제제로 제형화 될 수 있다. 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제, 트로키제 등이 포함되며, 이러한 고형 제제는 하나 이상의 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스, 락토오스 및 젤라틴 등을 섞어 조제될 수 있다. 또한, 마그네슘 스티레이트, 탈크 같은 윤활제들도 첨가될 수 있다. 한편, 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데, 여기에는 습윤제, 감미제, 방향제, 보존제 등과 같은 부형제가 포함될 수 있다.The composition of the present invention may be formulated as oral preparations or parenteral preparations. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, troches, etc. These solid preparations include at least one excipient in one or more compositions, such as starch, calcium carbonate, sucrose, It can be prepared by mixing lactose and gelatin. Also, lubricants such as magnesium stearate and talc may be added. On the other hand, the liquid formulation includes a suspension, an intravenous solution, an emulsion or a syrup, etc., which may include excipients such as wetting agents, sweeteners, fragrances, preservatives, and the like.

비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제 등의 주사제가 포함될 수 있다. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, injections such as emulsions.

비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. As the non-aqueous solvent and suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.

본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여될수 있으며, 비경구 투여는 피부 외용 또는 복강내 주사, 직장내 주사, 피하주사, 정맥주사, 근육내 주사 또는 흉부내 주사 주입방식중 선택될 수 있다.The composition of the present invention may be administered orally or parenterally depending on the desired method, and parenteral administration may be applied for external application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection. Can be selected.

본 발명에 따른 조성물은 약제학적으로 유효한 양으로 투여된다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물 등에 따라 달라질 수 있다. 본 발명의 조성물은 단독 또는 다른 치료제와 병용하여 투여될 수 있다. 병용 투여시, 투여는 순차적 또는 동시일 수 있다. The composition according to the invention is administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, drug activity, sensitivity to the drug, administration time, administration route and discharge rate, treatment duration, and drugs used simultaneously. The composition of the present invention may be administered alone or in combination with other therapeutic agents. In combination administration, administration may be sequential or simultaneous.

그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학적 조성물에 포함되는 유효성분의 양은 0.001 ~ 10,000 mg/㎏, 구체적으로는 0.1 g ~ 5 g/kg 일 수 있다. 상기 투여는 하루에 1회일 수 있고, 수회로 나뉠 수도 있다.However, for a desired effect, the amount of active ingredient contained in the pharmaceutical composition according to the present invention may be 0.001 to 10,000 mg/kg, specifically 0.1 g to 5 g/kg. The administration may be once a day or divided into several times.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 유효성분으로 함유하는 피부사상균 감염에 의한 질환의 예방 또는 개선용 피부외용제를 제공한다.In addition, the present invention provides a skin external preparation for the prevention or improvement of diseases caused by dermatophyte infection, which contains the DNA aptamer according to the present invention as an active ingredient.

본 발명에 따른 피부외용제에 유효성분으로 함유되는 DNA 앱타머는 상술한 바와 같은 특징을 가질 수 있다. 상기 피부사상균 감염에 의한 질환은 두부백선(tinea capitis), 무좀, 손톱진균증 또는 발톱진균증일 수 있고, 본 발명의 일 실시예에서, 상기 질환은 무좀일 수 있다.The DNA aptamer contained as an active ingredient in the external preparation for skin according to the present invention may have the characteristics as described above. The disease caused by the dermatophyte infection may be tinea capitis, athlete's foot, nail mycosis, or toenail fungus, and in one embodiment of the present invention, the disease may be athlete's foot.

본 발명의 피부외용제는 약학적으로 허용가능한 담체 및 부형제를 포함할 수 있다. 상기 담체 및 부형제는 방부제, 안정화제, 수화제, 유화 촉진제 및 완충제 등을 포함할 수 있다. 구체적으로, 상기 부형제는 유당, 덱스트린, 전분, 만니톨, 소르비톨, 글루코스, 사카로스, 미세결정 셀룰로스, 젤라틴, 폴리비닐피롤리돈 또는 이의 혼합물일 수 있다. 상기 피부외용제는 당업계에 잘 알려진 방법에 따라 적절히 제조될 수 있다. 상기 피부외용제는 파우더, 젤, 연고, 크림, 액체 및 에어로졸의 형태로 제조될 수 있다.The external preparation for skin of the present invention may include a pharmaceutically acceptable carrier and excipient. The carrier and excipient may include preservatives, stabilizers, hydrating agents, emulsifying accelerators and buffers. Specifically, the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone or a mixture thereof. The external preparation for skin may be appropriately prepared according to methods well known in the art. The external preparation for skin may be prepared in the form of powder, gel, ointment, cream, liquid and aerosol.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 유효성분으로 함유하는 피부사상균에 대한 항균용 조성물을 제공한다.In addition, the present invention provides an antimicrobial composition for dermatophytes containing the DNA aptamer according to the present invention as an active ingredient.

본 발명에 따른 항균용 조성물에 유효성분으로 함유되는 DNA 앱타머는 상술한 바와 같은 특징을 가질 수 있다. 상기 피부사상균 감염에 의한 질환은 두부백선(tinea capitis), 무좀, 손톱진균증 또는 발톱진균증일 수 있고, 본 발명의 일 실시예에서, 상기 질환은 무좀일 수 있다.The DNA aptamer contained as an active ingredient in the antimicrobial composition according to the present invention may have the characteristics as described above. The disease caused by the dermatophyte infection may be tinea capitis, athlete's foot, nail mycosis, or toenail fungus, and in one embodiment of the present invention, the disease may be athlete's foot.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 포함하는 피부사상균의 검출용 조성물 및 상기 검출용 조성물을 포함하는 키트를 제공한다.In addition, the present invention provides a composition for detecting dermatophytes comprising the DNA aptamer according to the present invention and a kit comprising the composition for detection.

상기 DNA 앱타머 및 피부사상균은 상술한 바와 같은 특징을 가질 수 있다.The DNA aptamer and dermatophyte may have the characteristics as described above.

본 발명에 따른 피부사상균의 검출용 조성물에 포함되는 DNA 앱타머는 발색효소, 형광물질, 방사성 동위원소 또는 콜로이드 등의 검출체로 표지된 접합체일 수 있다. 발색효소는 퍼록시다제, 알칼라인 포스파타제 또는 산성 포스파타제일 수 있고, 형광물질은 티오우레아(FTH), 7-아세톡시쿠마린-3-일, 플루오레신-5-일, 플루오레신-6-일, 2',7'-디클로로플루오레신-5-일, 2',7'-디클로로플루오레신-6-일, 디하이드로 테트라메틸로사민-4-일, 테트라메틸로다민-5-일, 테트라메틸로다민-6-일, 4,4-디플루오로-5,7-디메틸-4-보라-3a,4a-디아자-s-인다센-3-에틸 또는 4,4-디플루오로-5,7-디페닐-4-보라-3a,4a-디아자-s-인다센-3-에틸, Cy3, Cy5, 폴리 L-라이신-플루오레세인 이소티오시아네이트(FITC), 로다민-B-이소티오시아네이트(RITC), PE(Phycoerythrin) 또는 로다민일 수 있다.The DNA aptamer included in the composition for detecting dermatophytes according to the present invention may be a conjugate labeled with a detection agent such as a chromogenic enzyme, a fluorescent substance, a radioactive isotope, or a colloid. The chromogenic enzyme may be peroxidase, alkaline phosphatase or acidic phosphatase, and the fluorescent substance is thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluoresin-6-yl , 2',7'-dichlorofluorescin-5-yl, 2',7'-dichlorofluoresin-6-yl, dihydro tetramethylrosamin-4-yl, tetramethylrodamine-5-yl , Tetramethylrodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl or 4,4-difluoro Rho-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), Rhoda Min-B-isothiocyanate (RITC), PE (Phycoerythrin) or rhodamine.

또한, 상기 DNA 앱타머는 상기 DNA 앱타머에 특이적으로 결합할 수 있는 리간드를 포함할 수 있다. 상기 리간드는 발색효소, 형광물질, 방사성 동위원소 또는 콜로이드 등의 검출체로 표지된 접합체, 및 스트렙타비딘 또는 아비딘이 처리된 리간드일 수 있다. 본 발명의 검출용 조성물은 상기 서술한 바와 같은 시약 외에도 이들의 구조를 안정하게 유지시키는 증류수 또는 완충액을 더 포함할 수 있다.In addition, the DNA aptamer may include a ligand capable of specifically binding to the DNA aptamer. The ligand may be a conjugate labeled with a chromosome, a fluorescent substance, a radioactive isotope or a colloid, and a ligand treated with streptavidin or avidin. In addition to the reagents as described above, the composition for detection of the present invention may further include distilled water or a buffer to stably maintain their structures.

본 발명에 따른 검출용 조성물을 포함하는 키트는 이에 포함되는 DNA 앱타머의 세척이나 복합체의 분리 등과 같은 이후 단계를 용이하게 하기 위해 고형 기질에 결합될 수 있다. 이때, 고형 기질로는 합성수지, 니트로셀룰로오스, 유리기판, 금속기판, 유리섬유, 미세구체 또는 미세비드가 사용될 수 있다. 또한, 합성수지로는 폴리에스터, 폴리염화비닐, 폴리스티렌, 폴리프로필렌, PVDF 또는 나일론 등이 사용될 수 있다.Kits comprising the composition for detection according to the present invention can be bound to a solid substrate to facilitate subsequent steps such as washing of DNA aptamers contained therein or separation of complexes. At this time, as the solid substrate, synthetic resin, nitrocellulose, glass substrate, metal substrate, glass fiber, microspheres or microbeads may be used. In addition, polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF or nylon may be used as the synthetic resin.

또한, 상기 키트는 당업자에게 알려진 종래의 제조방법에 의해 제조될 수 있으며, 버퍼, 안정화제, 불활성 단백질 등을 더 포함할 수 있다. 상기 키트는 시약의 양을 탐색하기 위해 검출체로서 부착된 형광물질의 형광을 검출함으로써 수행되는 형광법 또는 검출체로서 부착된 방사선 동위원소의 방사선을 검출함으로써 수행되는 방사선법을 통한 초고속 스크리닝(high throughput screening, HTS) 시스템, 검출체의 표지 없이 표면의 플라즈몬 공명 변화를 실시간으로 측정하는 SPR(surface plasmon resonance) 방법 또는 SPR 시스템을 영상화하여 확인하는 SPRI(surface plasmon resonance imaging) 방법을 이용할 수 있다.In addition, the kit may be prepared by a conventional manufacturing method known to those skilled in the art, and may further include a buffer, a stabilizer, an inert protein, and the like. The kit is a high throughput through a fluorescence method performed by detecting the fluorescence of a fluorescent substance attached as a detection body or a radiation method performed by detecting radiation of a radioactive isotope attached as a detection body to search for the amount of reagent (high throughput) A screening (HTS) system, a surface plasmon resonance (SPR) method for real-time measurement of a change in plasmon resonance of a surface without labeling of a detection body, or a surface plasmon resonance imaging (SPRI) method for imaging and confirming an SPR system may be used.

또한, 본 발명은 본 발명에 따른 검출용 조성물을 시료와 반응시키는 단계를 포함하는 피부사상균의 검출방법을 제공한다.In addition, the present invention provides a method for detecting dermatophytes comprising reacting a composition for detection according to the present invention with a sample.

상기 DNA 앱타머 및 피부사상균은 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 시료는 피부사상균을 검출하고자 하는 시료라면 모든 시료를 포함할 수 있다. 또한, 상기 시료는 음이온 교환 크로마토그래피, 친화도 크로마토그래피, 크기별 배제 크로마토그래피, 액체 크로마토그래피, 연속추출, 원심분리 또는 젤 전기영동 등의 방법을 이용하여 전처리될 수 있다.The DNA aptamer and dermatophyte may have the characteristics as described above. In addition, the sample may include any sample as long as it is a sample for detecting dermatophytes. In addition, the sample may be pretreated using methods such as anion exchange chromatography, affinity chromatography, exclusion chromatography by size, liquid chromatography, continuous extraction, centrifugation, or gel electrophoresis.

또한, 본 발명은 본 발명에 따른 DNA 앱타머를 포함하는 피부사상균 감염에 의한 질환 진단용 조성물 및 상기 진단용 조성물을 포함하는 키트를 제공한다.In addition, the present invention provides a composition for diagnosing a disease caused by a dermatophyte infection comprising the DNA aptamer according to the present invention and a kit comprising the composition for diagnosis.

상기 DNA 앱타머 및 피부사상균은 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 DNA 앱타머를 포함하는 진단용 조성물 및 키트는 상술한 바와 같은 특징을 가질 수 있다.The DNA aptamer and dermatophyte may have the characteristics as described above. In addition, the diagnostic composition and kit containing the DNA aptamer may have the characteristics as described above.

나아가, 본 발명은 본 발명에 따른 진단용 조성물을 시료와 반응시키는 단계를 포함하는 피부사상균 감염에 의한 질환의 진단에 필요한 정보를 제공하는 방법을 제공한다.Furthermore, the present invention provides a method for providing information necessary for diagnosing a disease caused by a dermatophyte infection comprising reacting a diagnostic composition according to the present invention with a sample.

상기 DNA 앱타머 및 피부사상균은 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 시료는 피부사상균을 검출하고자 하는 생체 시료라면 모든 시료를 포함할 수 있고, 구체적으로 모발, 손발톱 및 표피 각질층 등일 수 있다.The DNA aptamer and dermatophyte may have the characteristics as described above. In addition, the sample may include all samples as long as it is a biological sample to detect dermatophytes, and specifically, may be a hair, nail, and epidermal stratum corneum.

이하, 본 발명을 하기 실시예에 의해 상세히 설명한다, 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 이들에 의해 본 발명이 제한되는 것은 아니다. 본 발명의 청구범위에 기재된 기술적 사상과 실질적으로 동일한 구성을 갖고 동일한 작용 효과를 이루는 것은 어떠한 것이라도 본 발명의 기술적 범위에 포함된다.Hereinafter, the present invention will be described in detail by the following examples, provided that the following examples are only for illustrating the present invention, and the present invention is not limited by them. Any thing that has substantially the same configuration and the same operation and effect as the technical idea described in the claims of the present invention is included in the technical scope of the present invention.

실시예 1. 트리코피톤 루브럼 균주의 ERG11 단백질 정제Example 1. Purification of ERG11 protein of Trichophyton rubrum strain

트리코피톤 루브럼(trichophyton rubrum) 균주의 ERG11(lanosterol 14-α-demethylase) 단백질에 대한 앱타머를 제작하기 위해, NCBI 웹페이지(https://www.ncbi.nlm.nih.gov/)에서 얻은 서열정보를 기초로 ERG11 단백질(서열번호 8)을 다음과 같은 방법으로 정제하였다.To produce aptamers for lanosterol 14-α-demethylase (ERG11) protein from the trichophyton rubrum strain, obtained from the NCBI website (https://www.ncbi.nlm.nih.gov/) ERG11 protein (SEQ ID NO: 8) was purified based on the sequence information in the following manner.

1-1. ERG11 유전자의 클로닝1-1. Cloning of the ERG11 gene

먼저, ERG11 유전자에 대한 정방향 프라이머(서열번호 9: 5'-CGGGAATTCGTCGCCGCCAAGATGA-3') 및 역방향 프라이머(서열번호 10: 5'-CCGCTCGAGTCAGAAATAGGGCAGC-3')를 바이오니아 사(한국)에 의뢰하여 제작하였다. 1 ㎕의 주형 DNA, 5 ㎕의 10x PCR 완충용액, 4 ㎕의 2.5 mM dNTP 혼합물, 2 ㎕의 25 μM 정방향 프라이머, 2 ㎕의 25 μM 역방향 프라이머, 0.3 ㎕의 ExTaq 중합효소(Takara, 일본)(1 unit/㎕) 및 35.7 ㎕의 증류수를 혼합하여 PCR 반응물을 준비하였다. 준비된 반응물을 하기 표 1에 기재된 바와 같은 조건으로 PCR을 수행하였다. 수득된 PCR 산물을 EcoRI 및 XhoI 제한효소로 절단하여 pET21a 발현벡터에 클로닝하였다.First, the forward primer for the ERG11 gene (SEQ ID NO: 9: 5'-CGGGAATTCGTCGCCGCCAAGATGA-3') and reverse primer (SEQ ID NO: 10: 5'-CCGCTCGAGTCAGAAATAGGGCAGC-3') were prepared by requesting Bionica (Korea). 1 μl template DNA, 5 μl 10x PCR buffer, 4 μl 2.5 mM dNTP mixture, 2 μl 25 μM forward primer, 2 μl 25 μM reverse primer, 0.3 μl ExTaq polymerase (Takara, Japan) ( PCR reaction was prepared by mixing 1 unit/µl) and 35.7µl of distilled water. PCR was performed on the prepared reactions under the conditions described in Table 1 below. The obtained PCR product was digested with EcoRI and XhoI restriction enzymes and cloned into pET21a expression vector.

초기 변성 단계Initial denaturation stage 94℃, 5분94℃, 5 minutes 1회1 time 변성 단계Metamorphic stage 94℃, 30초94℃, 30 seconds 30회Episode 30 어닐링(annealing) 단계Annealing step 64℃, 30초64℃, 30 seconds 연신(elongation) 단계Elongation step 72℃, 30초72℃, 30 seconds 후기 연신 단계Late stretching phase 72℃, 5분72℃, 5 minutes 1회1 time

1-2. ERG11 단백질의 발현 및 정제1-2. ERG11 protein expression and purification

실시예 1-1에서 제조된 ERG11 단백질을 발현하는 pET21a 발현벡터를 BL21(DE3) 균주에 전기천공법(electroporation)을 이용하여 형질전환하고, 암피실린(ampicillin)이 포함된 배지에서 성장하는 콜로니를 선별하였다.The pET21a expression vector expressing the ERG11 protein prepared in Example 1-1 was transformed into an BL21 (DE3) strain using electroporation, and colonies growing in a medium containing ampicillin were selected. Did.

선별된 콜로니를 50 ㎍/㎖의 암피실린이 포함된 LB 배지(0.5% 효모 추출물, 1% 박토-트립톤, 1% NaCl)에 접종하여 12시간 이상 종균 배양하였다. 상기 종균 배양액을 전체 배양 배지 부피의 1%가 되도록 접종하고, 18℃에서 180 rpm의 조건으로 OD600 값이 0.6에 도달할때까지 배양하였다. 배양 후, 0.1, 0.5 또는 1 mM의 IPTG(isopropylthio-β-D-galactoside)를 첨가하고, 18℃에서 200 rpm의 조건으로 더 배양하였다. 20시간 후, 세포 배양액을 4℃에서 8,000 rpm으로 10분 동안 원심분리하여 펠렛을 취하고, 이를 1x PBS에 재현탁하여 동일한 조건으로 원심분리하였다. 수득된 펠렛에 1x PBS를 첨가하여 세포를 재현탁하고, 초음파 분쇄기를 사용하여 세포를 용해시켰다. 용해된 세포를 4℃에서 8,000 rpm으로 10분 동안 원심분리하여 상층액 및 펠렛을 각각 수득하였다. 수득된 상층액 및 펠렛을 이용하여 12% SDS-PAGE 분석을 수행한 결과를 도 1에 나타내었다.The selected colonies were inoculated in LB medium (0.5% yeast extract, 1% bacto-trypton, 1% NaCl) containing 50 μg/ml ampicillin and cultured for more than 12 hours. The seed culture broth was inoculated to be 1% of the total culture medium volume, and cultured at 18° C. under conditions of 180 rpm until the OD 600 value reached 0.6. After the culture, 0.1, 0.5, or 1 mM of IPTG (isopropylthio-β-D-galactoside) was added, and further cultured at 18°C under 200 rpm. After 20 hours, the cell culture solution was centrifuged at 4°C at 8,000 rpm for 10 minutes to take pellets, and resuspended in 1x PBS to centrifuge under the same conditions. Cells were resuspended by adding 1x PBS to the obtained pellets, and cells were lysed using an ultrasonic grinder. The lysed cells were centrifuged at 4°C at 8,000 rpm for 10 minutes to obtain supernatant and pellets, respectively. The results of performing 12% SDS-PAGE analysis using the obtained supernatant and pellets are shown in FIG. 1.

도 1에 나타난 바와 같이, 1 mM의 IPTG를 첨가한 경우가 가장 ERG11 단백질의 발현이 높았으며, 상기 조건으로 세포를 배양하여 ERG11 단백질을 정제하였다. 정제는 상기 기재된 바와 동일한 방법 및 조건으로 배양된 세포를 원심분리하고, 수득된 상층액으로부터 Ni-NTA 아가로스 레진을 이용하여 ERG11 단백질을 통상적인 방법으로 정제하였다. 정제된 ERG11 단백질을 1x PBS 완충액으로 3회 투석하고 단백질 농축키트(Sartorius stedim, 독일)로 농축하여 보관하였다.As shown in FIG. 1, when 1 mM of IPTG was added, the expression of ERG11 protein was highest, and cells were cultured under the above conditions to purify ERG11 protein. Purification was performed by centrifuging the cells cultured in the same manner and conditions as described above, and purifying the ERG11 protein by conventional methods using the Ni-NTA agarose resin from the obtained supernatant. The purified ERG11 protein was dialyzed three times with 1x PBS buffer and concentrated and stored with a protein concentration kit (Sartorius stedim, Germany).

실시예 2. DNA 앱타머의 제작Example 2. Construction of DNA aptamer

EGR11 단백질에 특이적으로 결합하는 앱타머를 선별하기 위해, 먼저 하기 기재된 바와 같이 DNA 앱타머를 제작하였다.To select an aptamer that specifically binds EGR11 protein, a DNA aptamer was first prepared as described below.

2-1. 랜덤 DNA 라이브러리의 증폭2-1. Amplification of random DNA libraries

먼저, dA:dG:dC:dT가 1.5:1.15:1.25:1의 비율로 포함된 40개의 랜덤 염기서열(N40)을 포함하는 76 bp 크기의 주형 DNA(서열번호 11: 5'-ATACCAGCTTATTCAATTN40AGATTGCACTTACTATCT-3')와 이에 대한 정방향 프라이머(서열번호 12: 5'-ATACCAGCTTATTCAATT-3') 및 5'-말단에 바이오티닐화된(biotinylated) 역방향 프라이머(서열번호 13: 5'-AGATTGCACTTACTATCT-3')를 바이오니아 사(한국)에 주문제작하였다. 1 ㎕의 주형 DNA, 5 ㎕의 10x PCR 완충용액, 4 ㎕의 2.5 mM dNTP 혼합물, 2 ㎕의 25 μM 정방향 프라이머, 2 ㎕의 25 μM 역방향 프라이머 또는 바이오티닐화된 역방향 프라이머, 0.3 ㎕의 ExTaq 중합효소(Takara, 일본)(1 unit/㎕), 및 35.7 ㎕의 증류수를 혼합하여 PCR 반응물을 준비하였다. 준비된 반응물을 하기 표 2에 기재된 바와 같은 조건으로 PCR을 수행하였다. 수득된 PCR 산물을 2% 아가로스 겔 전기영동을 통해 확인하고, 그 결과를 도 2A에 나타내었다. 또한, 상기 PCR 산물을 PCR 정제키트(Qiagen, 미국)를 사용하여 수득된 결과를 도 2B에 나타내었다.First, a template DNA having a size of 76 bp including 40 random nucleotide sequences (N 40 ) in which dA:dG:dC:dT is included in a ratio of 1.5:1.15:1.25:1 (SEQ ID NO: 11: 5'-ATACCAGCTTATTCAATTN 40 AGATTGCACTTACTATCT-3') and forward primers against it (SEQ ID NO: 12: 5'-ATACCAGCTTATTCAATT-3') and 5'-terminal biotinylated reverse primers (SEQ ID NO: 13: 5'-AGATTGCACTTACTATCT-3') ) Was made to Bioneer (Korea). 1 μl template DNA, 5 μl 10x PCR buffer, 4 μl 2.5 mM dNTP mixture, 2 μl 25 μM forward primer, 2 μl 25 μM reverse primer or biotinylated reverse primer, 0.3 μl ExTaq polymerization PCR reaction was prepared by mixing enzyme (Takara, Japan) (1 unit/µl) and 35.7 µl of distilled water. PCR was performed on the prepared reactions under the conditions described in Table 2. The obtained PCR product was confirmed through 2% agarose gel electrophoresis, and the results are shown in FIG. 2A. In addition, the results obtained using the PCR product using the PCR purification kit (Qiagen, USA) are shown in FIG. 2B.

초기 변성 단계Initial denaturation stage 94℃, 5분94℃, 5 minutes 1회1 time 변성 단계Metamorphic stage 94℃, 30초94℃, 30 seconds 20회Episode 20 어닐링(annealing) 단계Annealing step 52℃, 30초52℃, 30 seconds 연신(elongation) 단계Elongation step 72℃, 30초72℃, 30 seconds 후기 연신 단계Late stretching phase 72℃, 5분72℃, 5 minutes 1회1 time

도 2에 나타난 바와 같이, 76 bp 크기의 PCR 산물이 증폭 및 정제된 것을 확인하였다.2, it was confirmed that the PCR product of 76 bp in size was amplified and purified.

2-2. 단일가닥 DNA의 준비2-2. Preparation of single-stranded DNA

상기 수득된 76 bp 크기의 PCR 산물로부터 DNA 앱타머를 제조하기 위해 단일가닥 DNA(single-strand DNA, ssDNA)를 다음과 같은 방법으로 준비하였다.Single-stranded DNA (ssDNA) was prepared by the following method to prepare DNA aptamer from the obtained PCR product of 76 bp in size.

먼저, 실시예 2-1에서 정제된 PCR 산물의 총 부피가 100 ㎕가 되도록 증류수를 첨가하였다. 증류수가 첨가된 PCR 산물을 85℃에서 5분 동안 반응시켜 이중가닥 DNA(double-strand DNA, dsDNA)를 ssDNA로 변성시킨 후, 이를 4℃로 냉각하여 ssDNA를 수득하였다. 수득된 ssDNA로부터 비오틴(biotin)이 결합된 ssDNA 및 프라이머를 제거하고, 정방향의 ssDNA를 수득하였다.First, distilled water was added so that the total volume of the PCR product purified in Example 2-1 was 100 µl. The PCR product to which distilled water was added was reacted at 85°C for 5 minutes to denature double-strand DNA (dsDNA) to ssDNA, and then cooled to 4°C to obtain ssDNA. Biotin-bound ssDNA and primers were removed from the obtained ssDNA, and forward ssDNA was obtained.

구체적으로, 수득된 100 ㎕의 ssDNA에 50 ㎕의 스트렙타비딘(streptavidin, Pierce, 미국)을 첨가하여 상온에서 1시간 동안 반응시켰다. 이후, 상기 반응액을 4℃, 13,000 rpm의 조건하에서 15분 동안 원심분리하고, 상층액만을 취하였다. 상층액에 동일 부피의 PCI(페놀:클로로폼:이소아밀알콜=25:24:1) 용액을 첨가하고, 다시 4℃, 13,000 rpm의 조건하에서 15분 동안 원심분리하였다. 원심분리 후, 상층액을 취하여, 여기에 상층액의 1/100 부피에 해당하는 tRNA(sigma aldrich, 미국), 상층액의 1/10 부피에 해당하는 3 M 소듐 아세테이트(sodium acetate, pH 4.5), 및 상층액의 3배 부피에 해당하는 100% 에탄올을 첨가하였다. 이를 -70℃에서 1시간 이상 반응시키고, 다시 4℃, 13,000 rpm의 조건하에서 20분 동안 원심분리하였다. 원심분리 후, 펠렛을 65℃에서 건조시키고, 건조된 펠렛에 50 ㎕의 증류수를 첨가하여 ssDNA를 수득하였다. 수득된 ssDNA를 10% 아크릴아마이드 겔에 전기영동하여 76 bp 크기의 ssDNA가 수득된 것을 확인하였다.Specifically, 50 μl of streptavidin (streptavidin, Pierce, USA) was added to the obtained 100 μl ssDNA and reacted at room temperature for 1 hour. Thereafter, the reaction solution was centrifuged for 15 minutes at 4°C and 13,000 rpm, and only the supernatant was taken. An equal volume of PCI (phenol:chloroform:isoamyl alcohol=25:24:1) solution was added to the supernatant, and then centrifuged for 15 minutes at 4°C and 13,000 rpm. After centrifugation, the supernatant was taken and tRNA (sigma aldrich, USA) corresponding to 1/100 volume of the supernatant, 3 M sodium acetate (pH 4.5) corresponding to 1/10 volume of the supernatant , And 100% ethanol corresponding to 3 times the volume of the supernatant. This was reacted at -70°C for 1 hour or more, and centrifuged again at 4°C and 13,000 rpm for 20 minutes. After centrifugation, the pellet was dried at 65°C, and 50 µl of distilled water was added to the dried pellet to obtain ssDNA. The obtained ssDNA was electrophoresed on a 10% acrylamide gel to confirm that ssDNA having a size of 76 bp was obtained.

2-3. 3차원 구조의 DNA 앱타머 제작2-3. Production of 3D DNA aptamer

실시예 2-2에서 수득된 50 ㎕의 ssDNA에 50 ㎕의 20 mM PBS 완충액(pH 7.4)을 첨가하였다. 상기 혼합물을 85℃에서 5분 동안 끓여 변성시킨 후, 상온에서 1시간 이상 방치하여 서서히 식힘으로써, ssDNA로부터 3차원 구조의 DNA 앱타머를 제작하였다.To 50 μl of ssDNA obtained in Example 2-2, 50 μl of 20 mM PBS buffer (pH 7.4) was added. The mixture was boiled at 85° C. for 5 minutes, denatured, and allowed to stand at room temperature for 1 hour or more to cool slowly, thereby preparing a DNA aptamer having a three-dimensional structure from ssDNA.

실시예 3. ERG11 단백질에 특이적으로 결합하는 DNA 앱타머의 선별Example 3. Selection of DNA aptamer specifically binding to ERG11 protein

3-1. ERG11 단백질에 특이적으로 결합하는 DNA 앱타머의 선별3-1. Selection of DNA aptamers that specifically bind ERG11 protein

ERG11 단백질과 특이적으로 결합하는 DNA 앱타머를 SELEX 기법을 이용하여 선별하였다.DNA aptamer that specifically binds ERG11 protein was selected using SELEX technique.

구체적으로, 실시예 2-3에서 제작된 DNA 앱타머에 10 ㎕의 실시예 1-2에서 정제된 ERG11 단백질을 첨가하여 4℃에서 12시간 동안 반응시켜 준비하였다. 한편, 200 ㎕의 Ni-NTA 아가로즈 레진에 1x His 결합 완충액(5 mM 이미다졸, 500 mM NaCl, 20 mM Tris-HCl(pH7.9))을 첨가하고 교반하였다. 상기 교반물을 4℃에서 13,000 rpm의 조건하에서 10분 동안 원심분리하여 상층액을 제거하고, 활성화된 Ni-NTA 아가로즈 레진을 얻었다. 활성화된 Ni-NTA 아가로즈 레진에 상기 준비된 DNA 앱타머 및 ERG11 단백질 반응물을 첨가하고, 4℃에서 1시간 동안 반응시켰다. 1시간 후, 결합하지 않은 DNA 앱타머를 1x His 결합 완충액으로 3회 세척하고, 200 ㎕의 1x DNA 앱타머 용출 완충액(1 M 이미다졸, 500 mM NaCl, 20 mM Tris-HCl(pH 7.9))을 첨가한 뒤, 이를 85℃에서 5분 동안 끓여 변성시켰다. 4℃에서 13,000 rpm의 조건 하에서 10분 동안 원심분리하여 변성된 DNA 앱타머를 수득하였고, 이는 2회 수행되었다. 이후, 얻어진 펠렛에 PCI 용액 및 에탄올 침전법을 수행하여 최종적으로 50 ㎕의 증류수에 현탁된 DNA 앱타머를 회수하였다.Specifically, 10 µl of the purified ERG11 protein in Example 1-2 was added to the DNA aptamer prepared in Example 2-3 to prepare it by reacting at 4° C. for 12 hours. Meanwhile, 1× His binding buffer (5 mM imidazole, 500 mM NaCl, 20 mM Tris-HCl (pH7.9)) was added to 200 μl of Ni-NTA agarose resin and stirred. The supernatant was removed by centrifuging the stirred material at 4° C. for 10 minutes under conditions of 13,000 rpm, and an activated Ni-NTA agarose resin was obtained. The prepared DNA aptamer and ERG11 protein reactants were added to the activated Ni-NTA agarose resin and reacted at 4°C for 1 hour. After 1 hour, unbound DNA aptamer was washed 3 times with 1x His binding buffer, 200 μl of 1x DNA aptamer elution buffer (1 M imidazole, 500 mM NaCl, 20 mM Tris-HCl (pH 7.9)) After adding, it was denatured by boiling at 85°C for 5 minutes. The denatured DNA aptamer was obtained by centrifugation at 4°C for 10 minutes under the conditions of 13,000 rpm, which was performed twice. Thereafter, a PCI solution and an ethanol precipitation method were performed on the obtained pellet, and finally DNA aptamer suspended in 50 µl of distilled water was recovered.

3-2. 비특이적으로 결합하는 DNA 앱타머의 제거3-2. Removal of non-specifically binding DNA aptamers

ERG11 단백질이 아닌 Ni-NTA 아가로즈 레진에 결합하는 비특이적 DNA 앱타머를 제거하는 동시에 ERG11 단백질에 결합하는 DNA 앱타머의 특이성을 향상시키기 위해 다음과 같은 실험을 수행하였다.The following experiment was performed to remove the non-specific DNA aptamer that binds to the Ni-NTA agarose resin other than the ERG11 protein and to improve the specificity of the DNA aptamer that binds to the ERG11 protein.

먼저, 실시예 3-1에서 수득된 DNA 앱타머를 이용하여, 실시예 3-1의 과정을 6회 반복하여 특이성이 향상된 DNA 앱타머를 선별하였다. 선별된 DNA 앱타머를 이용하여 ERG11 단백질이 결합되지 않은 Ni-NTA 아가로즈 레진에 결합하는 DNA 앱타머를 선별하는 네가티브 SELEX(negative SELEX)을 수행하였다. 실험은 ERG11 단백질 및 Ni-NTA 아가로즈 레진을 함께 첨가하는 것 대신 활성화된 Ni-NTA 아가로즈 레진만을 사용한 것을 제외하고는 실시예 3-1과 동일한 조건 및 방법으로 수행되었다. 이때, DNA 앱타머는 Ni-NTA 아가로즈 레진에 결합하지 않는 앱타머만을 수득하였다. 수득된 앱타머를 이용하여, 실시예 3-1의 과정을 4회 더 반복하여 총 10회의 SELEX를 수행함으로써 최종적으로 ERG11 단백질에 특이적으로 결합하는 앱타머를 수득하였다.First, using the DNA aptamer obtained in Example 3-1, the process of Example 3-1 was repeated 6 times to select a DNA aptamer with improved specificity. Negative SELEX (negative SELEX) was performed using the selected DNA aptamer to select the DNA aptamer that binds to the Ni-NTA agarose resin to which the ERG11 protein is not bound. The experiment was carried out in the same conditions and methods as in Example 3-1, except that only the activated Ni-NTA agarose resin was used instead of adding ERG11 protein and Ni-NTA agarose resin together. At this time, the DNA aptamer obtained only an aptamer that does not bind to Ni-NTA agarose resin. Using the obtained aptamer, the procedure of Example 3-1 was repeated 4 more times to perform a total of 10 SELEX to finally obtain an aptamer specifically binding to the ERG11 protein.

실시예 4. DNA 앱타머의 친화성 확인Example 4. Confirmation of the affinity of the DNA aptamer

4-1. 나노드랍 방법을 이용한 친화성 확인4-1. Affinity confirmation using nanodrop method

10회의 SELEX를 통해 각 라운드에서 수득된 DNA 앱타머의 ERG11 단백질에 대한 친화성을 나노드랍 방법으로 확인하였다.The affinity of the DNA aptamer obtained in each round to the ERG11 protein was confirmed by nanodrop method through 10 times of SELEX.

구체적으로, 실시예 3에서 각 회별로 수득된 DNA 앱타머 샘플의 농도를 나노드롭(Nanodrop 2000 Micro spectrophotometer, Thermo scientific)을 이용하여 제조사의 프로토콜에 따라 측정하였다.Specifically, the concentration of the DNA aptamer sample obtained for each time in Example 3 was measured according to the manufacturer's protocol using a nanodrop (Nanodrop 2000 Micro spectrophotometer, Thermo scientific).

그 결과, 도 3에 나타난 바와 같이, 9회에 수득된 DNA 앱타머의 농도가 812.7 ng/㎕로 가장 높았으며, 8회 및 10회에 수득된 DNA 앱타머의 농도는 각각 775.7 ng/㎕와 754.2 ng/㎕였다. 따라서, 상기로부터 SELEX를 9회 수행한 뒤 수득된 DNA 앱타머 풀(pool)이 ERG11 단백질과 가장 특이적으로 결합함을 알 수 있었다.As a result, as shown in Figure 3, the concentration of DNA aptamer obtained in 9 times was the highest at 812.7 ng/µl, and the concentration of DNA aptamer obtained in 8 and 10 times was 775.7 ng/µl, respectively. It was 754.2 ng/µl. Therefore, it was found that the DNA aptamer pool obtained after performing SELEX 9 times from the above binds most specifically to the ERG11 protein.

4-2. 실시간 PCR 방법을 이용한 친화성 확인4-2. Confirmation of affinity using real-time PCR method

10회의 SELEX를 통해 각 라운드에서 수득된 DNA 앱타머의 ERG11 단백질에 대한 친화성을 실시간 PCR 방법으로 확인하였다.The affinity of the DNA aptamer obtained in each round for the ERG11 protein was confirmed by 10 times of SELEX by a real-time PCR method.

먼저, 실시예 2-2에서 준비된 ssDNA와 8회, 9회 및 10회 SELEX를 수행한 뒤 수득된 ssDNA 형태의 DNA 앱타머를 실시예 2-1에 기재된 바와 같은 방법 및 조건으로 PCR을 수행하였다. 수득된 PCR 산물을 이용하여 실시예 2-2에 기재된 바와 같은 방법 및 조건으로 ssDNA를 수득하고, 이의 농도를 통상적인 방법으로 측정하여 동일한 농도로 준비하였다. 실시예 2-3에서 제작된 DNA 앱타머 대신 상기 준비된 ssDNA를 사용한 것을 제외하고는, 실시예 3-1과 동일한 조건 및 방법으로 SELEX를 1회 수행하였다. 수득된 DNA 앱타머에, 이의 1/100 부피의 tRNA, 이의 1/10 부피의 3 M 소듐 아세테이트(pH 4.5) 및 이의 3 부피의 100% 에탄올을 첨가하여 -70℃에서 1시간 이상 반응시켰다. 반응이 끝난 후, 반응물을 원심분리하여 수득된 펠렛을 85℃에서 건조시키고, 50 ㎕의 증류수에 현탁하고, 100, 10-1 및 10-2로 단계희석하여 실시간 PCR을 위한 주형으로서 준비하였다. 준비된 주형을 이용하여 iQ SYBR 그린 수퍼믹스(iQ SYBR Green Supermix, Bio-rad, 미국)를 사용하여 제조사의 프로토콜에 따라 실시간 PCR을 하기 표 3에 기재된 바와 같이 수행하였다.First, the ssDNA prepared in Example 2-2 was subjected to SELEX 8, 9, and 10 times, and then the obtained ssDNA type DNA aptamer was subjected to PCR using the method and conditions as described in Example 2-1. . SsDNA was obtained by the method and conditions as described in Example 2-2 using the obtained PCR product, and the concentration thereof was measured by a conventional method to prepare the same concentration. SELEX was performed once in the same conditions and methods as in Example 3-1, except that the prepared ssDNA was used instead of the DNA aptamer prepared in Example 2-3. To the obtained DNA aptamer, 1/100 of its tRNA, 1/10 of its volume, 3 M sodium acetate (pH 4.5) and 3 of its volume of 100% ethanol were added and reacted at -70°C for at least 1 hour. After the reaction was completed, the pellets obtained by centrifuging the reactants were dried at 85° C., suspended in 50 μl of distilled water, and diluted in steps of 10 0 , 10 -1 and 10 -2 to prepare as a template for real-time PCR. . Using the prepared template, iQ SYBR Green Supermix (iQ SYBR Green Supermix, Bio-rad, USA) was used to perform real-time PCR according to the manufacturer's protocol as described in Table 3 below.

초기 변성 단계Initial denaturation stage 94℃, 5분94℃, 5 minutes 1회1 time 변성 단계Metamorphic stage 94℃, 20초94℃, 20 seconds 30회Episode 30 어닐링(annealing) 단계Annealing step 52℃, 20초52℃, 20 seconds 연신(elongation) 단계Elongation step 72℃, 20초72℃, 20 seconds 후기 연신 단계Late stretching phase 72℃, 5분72℃, 5 minutes 1회1 time

그 결과, 주형 DNA를 10-2로 희석한 샘플에서 PCR 산물이 검출되었으며, SELEX를 8회, 9회 및 10회 수행하여 수득된 DNA 앱타머에 대한 PCR 효율은 각각 78.77%, 86.88% 및 81.06%였다. 즉, 상기로부터 SELEX를 9회 수행한 뒤 수득된 DNA 앱타머 풀(pool)이 ERG11 단백질과 가장 특이적으로 결합함을 알 수 있었다.As a result, PCR products were detected in samples diluted with template DNA of 10 -2 , and PCR efficiencies for DNA aptamers obtained by performing SELEX 8, 9, and 10 times were 78.77%, 86.88%, and 81.06, respectively. %. That is, it was found that the DNA aptamer pool obtained after performing SELEX 9 times from the above binds most specifically to the ERG11 protein.

실시예 5. DNA 앱타머의 서열 확인Example 5. Sequence confirmation of DNA aptamer

상기에서 ERG11 단백질과 가장 친화성을 높은것으로 확인된 9회의 SELEX 수득을 통해 얻은 DNA 앱타머의 서열을 다음과 같은 방법으로 확인하였다.The sequence of the DNA aptamer obtained by obtaining 9 times of SELEX identified as having the highest affinity to the ERG11 protein was confirmed by the following method.

먼저, 상기 실시예 3에서 SELEX를 9회 수행하여 수득된 DNA 앱타머를 주형으로 정방향 프라이머(서열번호 14: 5'-ATACCAGCTTATTCAATT-3') 및 역방향 프라이머(서열번호 15: 5'-AGATTGCACTTACTATCT-3')를 이용하여 PCR을 수행하였다. PCR 결과 이중가닥 형태의 DNA를 수득하였고, 수득된 dsDNA는 T-블런트 클로닝 키트(SolGent, 한국)를 이용하여 제조사의 프로토콜에 따라 T-벡터에 클로닝되었다.First, a forward primer (SEQ ID NO: 14: 5'-ATACCAGCTTATTCAATT-3') and a reverse primer (SEQ ID NO: 15: 5'-AGATTGCACTTACTATCT-3) are used as a template for the DNA aptamer obtained by performing SELEX 9 times in Example 3 above. PCR was performed using'). As a result of PCR, double-stranded DNA was obtained, and the obtained dsDNA was cloned into a T-vector according to the manufacturer's protocol using a T-blunt cloning kit (SolGent, Korea).

구체적으로, 1 ㎕의 T-벡터(10 ng/㎕), 4 ㎕의 PCR 산물(20 ng/㎕) 및 1 ㎕의 6x T-블런트 완충액을 25℃에서 5분 동안 반응시켰다. 반응 후, 6 ㎕의 반응물을 100 ㎕의 DH5α 수용성 균주와 혼합하고, 42℃에서 30초 동안 열충격을 가해 형질전환시켰다. 이를 2분 동안 얼음에 방치하고, 900 ㎕의 SOC 배지(2% 트립톤, 0.5% 효모 추출물, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 및 20 mM 글루코스)를 첨가하여 37℃에서 1시간 동안 배양하였다. 200 ㎕의 배양액을 암피실린(Sigma Aldrich, 미국), 카나마이신(Sigma Aldrich, 미국), X-갈(X-gal, Sigma Aldrich, 미국) 및 IPTG(Thermo Scientific, 미국)가 포함된 LB 배양 플레이트에 스프레딩하였다. 이를 37℃에서 15시간 배양한 뒤, 생성된 콜로니 중 흰색 콜로니만 50개 선별하여 통상적인 방법으로 DNA를 추출하고, 그 염기서열을 Solgent(한국) 사에 의뢰하여 확인하였다. 그 결과, 중복되지 않은 27개의 DNA 앱타머를 수득하였다.Specifically, 1 µl of T-vector (10 ng/µl), 4 µl of PCR product (20 ng/µl) and 1 µl of 6x T-blunt buffer was reacted at 25° C. for 5 minutes. After the reaction, 6 µl of the reactant was mixed with 100 µl of DH5α water-soluble strain, and transformed by applying a thermal shock at 42° C. for 30 seconds. It was left on ice for 2 minutes, and 900 μl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2 , 10 mM MgSO 4 and 20 mM glucose) was added. Incubated at 37°C for 1 hour. 200 μl of culture broth in LB culture plates containing ampicillin (Sigma Aldrich, USA), kanamycin (Sigma Aldrich, USA), X-gal (X-gal, Sigma Aldrich, USA) and IPTG (Thermo Scientific, USA) I read it. After culturing it at 37°C for 15 hours, only 50 white colonies were selected from the generated colonies, DNA was extracted by a conventional method, and the base sequence was confirmed by requesting Solgent (Korea). As a result, 27 non-overlapping DNA aptamers were obtained.

실시예 6. ERG11 단백질에 대한 DNA 앱타머의 친화성 확인Example 6. Confirmation of the affinity of the DNA aptamer for ERG11 protein

27개의 DNA 앱타머의 ERG11 단백질에 대한 친화성을 나노드랍 방법으로 확인하였다. 구체적으로, 실시예 5에서 서열이 확인된 27개의 DNA 앱타머를 실시예 2-3과 동일한 조건 및 방법으로 3차원 구조로 제작한 뒤, 실시예 3-1과 동일한 조건 및 방법으로 SELEX를 수행하여 DNA 앱타머를 수득하였다. 수득된 DNA 앱타머를 실시예 4-1과 동일한 조건 및 방법으로 나노드랍을 수행하였고, 그 결과를 도 4에 나타내었다.The affinity of 27 DNA aptamers for ERG11 protein was confirmed by nanodrop method. Specifically, 27 DNA aptamers of which sequence was confirmed in Example 5 were produced in a three-dimensional structure under the same conditions and methods as Example 2-3, and then SELEX was performed under the same conditions and methods as Example 3-1. The DNA aptamer was obtained. The obtained DNA aptamer was subjected to nanodrops under the same conditions and methods as in Example 4-1, and the results are shown in FIG. 4.

도 4에 나타낸 바와 같이, 총 27개의 DNA 앱타머 중 ERG11 단백질에 높은 친화력으로 결합하는 7개의 앱타머를 최종적으로 선별하였고, 선별된 DNA 앱타머의 서열을 하기 표 4에 나타내었다.As shown in FIG. 4, 7 aptamers that bind with high affinity to ERG11 protein among a total of 27 DNA aptamers were finally selected, and sequences of the selected DNA aptamers are shown in Table 4 below.

클론Clone 서열order 서열번호Sequence number Tr1Tr1 TCGACTATTGACTAAGAACGGCCGTTCCGGCTGGTAGTTCTCGACTATTGACTAAGAACGGCCGTTCCGGCTGGTAGTTC 서열번호 1SEQ ID NO: 1 Tr4Tr4 TCGGAAACTAACTAGTGAGGGGATACCGTTGGAGCAATTTTCGGAAACTAACTAGTGAGGGGATACCGTTGGAGCAATTT 서열번호 2SEQ ID NO: 2 Tr7Tr7 CCAGTGACATTATAAGGAGAACGTTCTGTATCTATAGGCACCAGTGACATTATAAGGAGAACGTTCTGTATCTATAGGCA 서열번호 3SEQ ID NO: 3 Tr12Tr12 CGGTCATTCGGTAGGAATTATGACGCTTATCTCGTCTTTCCGGTCATTCGGTAGGAATTATGACGCTTATCTCGTCTTTC 서열번호 4SEQ ID NO: 4 Tr15Tr15 ACATTCGACAGTGTAAATTTACATCAGGGGTCTTTAGATGACATTCGACAGTGTAAATTTACATCAGGGGTCTTTAGATG 서열번호 5SEQ ID NO: 5 Tr20Tr20 CGGAACATGTTTTTCAGATATGGAGTTAACCTACAAGGAGCGGAACATGTTTTTCAGATATGGAGTTAACCTACAAGGAG 서열번호 6SEQ ID NO: 6 Tr25Tr25 CGTGCCCCGTGCTTGTAATTGCTCGGAGGTAATATGTGCGCGTGCCCCGTGCTTGTAATTGCTCGGAGGTAATATGTGCG 서열번호 7SEQ ID NO: 7

실시예 7. DNA 앱타머의 구조 확인Example 7. Confirmation of the structure of DNA aptamer

실시예 6에서 최종 선별된 DNA 앱타머의 구조를 DNA mfold 프로그램(Rensselear polytechnic institute)을 이용하여 이미지화한 결과를 도 5에 나타내었다.The structure of the DNA aptamer finally selected in Example 6 is imaged using a DNA mfold program (Rensselear polytechnic institute).

실험예 1. ERG11 단백질에 대한 DNA 앱타머의 친화력 확인Experimental Example 1. Confirmation of the affinity of DNA aptamer for ERG11 protein

1-1. ERG11 단백질 코팅 센서 칩의 제작1-1. Fabrication of ERG11 protein coated sensor chip

표면 플라즈마 공명(surface plasmon resonance, SPR) 실험을 통해 선별된 DNA 앱타머의 결합력을 정량적으로 확인하기 위해 ERG11 단백질이 코팅된 센서 칩을 다음과 같은 방법으로 제작하였다.In order to quantitatively confirm the binding force of the selected DNA aptamer through surface plasmon resonance (SPR) experiment, a sensor chip coated with ERG11 protein was prepared in the following manner.

먼저, 카르복실기로 표면이 코팅된 센서 칩 CM5(GE healthcare, 영국)에 0.1 M NHS(Nhydroxysuccinimide) 및 0.4 M EDC(N-ethyl-N'(dimethylaminopropyl) carbodiimide)가 혼합된 혼합액을 5 ㎕/min의 속도로 흘려주어 표면의 카르복실기를 활성화시켰다. 카르복실기가 활성화된 센서 칩 CM5의 표면에, 60 ㎍/㎖ 농도의 ERG11 단백질을 포함하는 10 mM 아세트산 나트륨(pH 4.5) 용액을 5 ㎕/min의 속도로 10분 동안 처리하였다. ERG11 단백질이 코팅된 센서 칩 CM5에 1 M 에탄올아민 하이드로클로라이드(pH 8.5)를 5 ㎕/min의 속도로 10분 동안 흘려주어 표면의 활성화된 카르복실기를 불활성화시켰다. 그 결과, 표면에 ERG11 단백질이 코팅된 센서 칩 CM5를 제작하였다.First, a mixture of a mixture of 0.1 M NHS (Nhydroxysuccinimide) and 0.4 M EDC (N-ethyl-N' (dimethylaminopropyl) carbodiimide) in a sensor chip CM5 (GE healthcare, UK) coated with a carboxyl group is 5 μl/min. Flowed at a rate to activate the carboxyl groups on the surface. On the surface of the sensor chip CM5 activated with a carboxyl group, a 10 mM sodium acetate (pH 4.5) solution containing ERG11 protein at a concentration of 60 μg/ml was treated for 10 minutes at a rate of 5 μl/min. 1 M ethanolamine hydrochloride (pH 8.5) was flowed on the sensor chip CM5 coated with ERG11 protein at a rate of 5 μl/min for 10 minutes to inactivate activated carboxyl groups on the surface. As a result, a sensor chip CM5 coated with ERG11 protein on the surface was produced.

1-2. DNA 앱타머의 친화력 확인1-2. Check the affinity of DNA aptamer

상기 선별된 DNA 앱타머의 ERG11 단백질에 대한 친화력을 SPR 방법을 이용하여 정량적으로 확인하였다(도 6).The affinity of the selected DNA aptamer for ERG11 protein was quantitatively confirmed using an SPR method (FIG. 6).

먼저, 실시예 6에서 선별된 서열번호 1 내지 7로 기재되는 염기서열로 구성된 DNA 앱타머를 HBS-EP 완충액(GE Healthcare, BR-1001-88)에 100, 300 또는 500 nM의 농도가 되도록 희석하여 준비하였다. 실험은 BIAcore 3000(BIACORE)을 사용하여 제조사의 프로토콜에 따라 수행되었으며, 실험예 1-1에서 제작된 ERG11 단백질이 코팅된 센서 칩 CM5에 대한 DNA 앱타머의 결합력과 아무것도 코팅되지 않은 센서 칩 CM5에 대한 DNA 앱타머의 결합력 차이를 확인하였다. 이때, 속도 변수는 BIA 평가프로그램(BIACORE)을 이용하여 수득 및 정량하였고, 각 실험 후, 센서 칩은 1 M NaCl 및 50 mM NaOH 완충액을 이용하여 재생시켰다. 그 결과, DNA 앱타머의 ERG11 단백질에 대한 친화력을 하기 표 5에 해리 상수(KD) 값으로 나타내었다.First, a DNA aptamer consisting of the nucleotide sequence described in SEQ ID NOs: 1 to 7 selected in Example 6 was diluted in HBS-EP buffer (GE Healthcare, BR-1001-88) to a concentration of 100, 300 or 500 nM. Was prepared. The experiment was performed according to the manufacturer's protocol using BIAcore 3000 (BIACORE), and the binding force of the DNA aptamer to the sensor chip CM5 coated with the ERG11 protein prepared in Experimental Example 1-1 and the sensor chip CM5 coated with nothing Differences in the binding power of the DNA aptamers were confirmed. At this time, the speed variable was obtained and quantified using the BIA evaluation program (BIACORE), and after each experiment, the sensor chip was regenerated using 1 M NaCl and 50 mM NaOH buffer. As a result, the affinity of the DNA aptamer for the ERG11 protein is shown in Table 5 below as a dissociation constant (K D ) value.

클론Clone KD(M)K D (M) Tr1Tr1 5.11×10-9 5.11×10 -9 Tr4Tr4 8.15×10-11 8.15×10 -11 Tr7Tr7 1.02×10-11 1.02×10 -11 Tr12Tr12 2.15×10-10 2.15×10 -10 Tr15Tr15 3.72×10-10 3.72×10 -10 Tr20Tr20 9.38×10-9 9.38×10 -9 Tr25Tr25 1.20×10-10 1.20×10 -10

상기 표 5에 나타난 바와 같이, 선별된 7개의 DNA 앱타머는 모두 ERG11 단백질과 높은 결합력으로 결합하였고, 특히 Tr7의 앱타머의 해리상수가 1.02×10-11 M으로 가장 높았다.As shown in Table 5, all of the seven selected DNA aptamers bound to the ERG11 protein with high binding strength, and in particular, the dissociation constant of the Tr7 aptamer was highest at 1.02×10 -11 M.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> DNA APTAMER SPECIFICALLY BINDING TO ERG11 PROTEIN AND USING THE SAME <130> DP-2018-0320-KR <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr1 DNA aptamer <400> 1 tcgactattg actaagaacg gccgttccgg ctggtagttc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr4 DNA aptamer <400> 2 tcggaaacta actagtgagg ggataccgtt ggagcaattt 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr7 DNA aptamer <400> 3 ccagtgacat tataaggaga acgttctgta tctataggca 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr12 DNA aptamer <400> 4 cggtcattcg gtaggaatta tgacgcttat ctcgtctttc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr15 DNA aptamer <400> 5 acattcgaca gtgtaaattt acatcagggg tctttagatg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr20 DNA aptamer <400> 6 cggaacatgt ttttcagata tggagttaac ctacaaggag 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr25 DNA aptamer <400> 7 cgtgccccgt gcttgtaatt gctcggaggt aatatgtgcg 40 <210> 8 <211> 1785 <212> DNA <213> Artificial Sequence <220> <223> ERG11 gene <400> 8 atgggcctct tagccgacat tgtctctcgt ttctgcgaga actgctcgac cctgtccacc 60 gccgcgctcg tcgcaagtgc catatcggct tttatcgtcc tctccattgt tatcaacgtc 120 ctgcagcagc tcctgttcaa ggaccctaca aagcctccgg tggtcttcca ctggtttccg 180 ataattggaa gcacgatctc ctatggaatt gacccataca agttctttga cgactgcaag 240 gagaaggttg gtggtggaaa tcaactagct ataccagaag aatgcgcaaa gctaacatat 300 agataattac ggtattctag tatggagata tcttcacatt catactcctg ggcaagaaga 360 cgactgtttt ccttggtaca aagggaaacg atttcatttt gaacggcaag ctcaaggatg 420 tttgcgcaga ggatgtctac tcccctctca ccaccccagt gttcggacga catgtggtgt 480 atgattgccc aaattccaag ctcatggagc agaagaaggt gtgtacggca atttattttt 540 gtctcaacct cctggctgtc cattgctaat ttaatcgcct gctagttcgt caagttcggc 600 ctcacctctg aagctcttcg atcctatgtc accctgatca ccaaagaagt cgagcagttc 660 ttcgagtcct ctcccatctt caagggcgac tccggagttt tcaatgtcag caaggttatg 720 gctgaaatca ccatctacac cgcctctcga tctctacagg gcaaggaagt gcgcggaaag 780 ttcgattcca gctttgcaga actctactcc gatctcgaca tgggcttcgc tgccatcaac 840 ttcatgttcc catggttccc cttcccacac aaccgcaagc gcgaccgtgc tcaaaggaag 900 atggcccagg tttacaccga catcatccgt cagcgacgtg cggctggcgg agagaaagac 960 tccgaggaca tggtatggaa cttgatgtcg tccgtgtaca agaatggaac gccaattcca 1020 gatatcgagg ttgcccacat gatgattgcc ctacttatgg ccggccaaca ctcttcttcc 1080 tccaccggct cctggatcgt tctccgcctt gccagccgtc cagatattct cgaggagctc 1140 tacgaggaac agaaacgtgt tctcggcgag gatcttccac cactcaccta cgaagctctt 1200 cagaaactcg accttcacaa caatgtaatc aaggagactc tccgccttca cgctccaatc 1260 cactccatcc tccgtgctgt caaatcccct atgcccgttg aagggaccaa ctatgttgtc 1320 ccaacctctc acaacctcct tgccgctcct ggtgttccct cacgagaccc tcagtacttc 1380 cctgaccccc tggtctggaa ccctcaccga tgggagaaca acgttggtgt caccgtagtc 1440 gaggccagtg aagaaaagac agattacgga tacggtttgg ttagcaaggg tgccaacagt 1500 ccttacctcc cattcggctc aggcagacac agatgtatcg gtgaacaatt tgcatatgtt 1560 cagcttggaa ccgtaacagc tacgctagcc agactaatga gatggaagca agttgaaggc 1620 accaaagatg ttgtgccgcc aactgactat tcggtaagtt tggcatatta cgctccttta 1680 tcccgctcga ttttactaac tttccattaa tagtccctct tctcgaagcc atttggcaac 1740 ccaatggtct cgtgggagaa acgaaagcag gcttctcaga aatga 1785 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer for ERG11 gene <400> 9 cgggaattcg tcgccgccaa gatga 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for ERG11 gene <400> 10 ccgctcgagt cagaaatagg gcagc 25 <210> 11 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> template DNA <400> 11 ataccagctt attcaattna gattgcactt actatct 37 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for template DNA <400> 12 ataccagctt attcaatt 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for template DNA <400> 13 agattgcact tactatct 18 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for SELEX <400> 14 ataccagctt attcaatt 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for SELEX <400> 15 agattgcact tactatct 18 <110> Chungbuk National University Industry-Academic Cooperation Foundation <120> DNA APTAMER SPECIFICALLY BINDING TO ERG11 PROTEIN AND USING THE SAME <130> DP-2018-0320-KR <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr1 DNA aptamer <400> 1 tcgactattg actaagaacg gccgttccgg ctggtagttc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr4 DNA aptamer <400> 2 tcggaaacta actagtgagg ggataccgtt ggagcaattt 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr7 DNA aptamer <400> 3 ccagtgacat tataaggaga acgttctgta tctataggca 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr12 DNA aptamer <400> 4 cggtcattcg gtaggaatta tgacgcttat ctcgtctttc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr15 DNA aptamer <400> 5 acattcgaca gtgtaaattt acatcagggg tctttagatg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr20 DNA aptamer <400> 6 cggaacatgt ttttcagata tggagttaac ctacaaggag 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tr25 DNA aptamer <400> 7 cgtgccccgt gcttgtaatt gctcggaggt aatatgtgcg 40 <210> 8 <211> 1785 <212> DNA <213> Artificial Sequence <220> <223> ERG11 gene <400> 8 atgggcctct tagccgacat tgtctctcgt ttctgcgaga actgctcgac cctgtccacc 60 gccgcgctcg tcgcaagtgc catatcggct tttatcgtcc tctccattgt tatcaacgtc 120 ctgcagcagc tcctgttcaa ggaccctaca aagcctccgg tggtcttcca ctggtttccg 180 ataattggaa gcacgatctc ctatggaatt gacccataca agttctttga cgactgcaag 240 gagaaggttg gtggtggaaa tcaactagct ataccagaag aatgcgcaaa gctaacatat 300 agataattac ggtattctag tatggagata tcttcacatt catactcctg ggcaagaaga 360 cgactgtttt ccttggtaca aagggaaacg atttcatttt gaacggcaag ctcaaggatg 420 tttgcgcaga ggatgtctac tcccctctca ccaccccagt gttcggacga catgtggtgt 480 atgattgccc aaattccaag ctcatggagc agaagaaggt gtgtacggca atttattttt 540 gtctcaacct cctggctgtc cattgctaat ttaatcgcct gctagttcgt caagttcggc 600 ctcacctctg aagctcttcg atcctatgtc accctgatca ccaaagaagt cgagcagttc 660 ttcgagtcct ctcccatctt caagggcgac tccggagttt tcaatgtcag caaggttatg 720 gctgaaatca ccatctacac cgcctctcga tctctacagg gcaaggaagt gcgcggaaag 780 ttcgattcca gctttgcaga actctactcc gatctcgaca tgggcttcgc tgccatcaac 840 ttcatgttcc catggttccc cttcccacac aaccgcaagc gcgaccgtgc tcaaaggaag 900 atggcccagg tttacaccga catcatccgt cagcgacgtg cggctggcgg agagaaagac 960 tccgaggaca tggtatggaa cttgatgtcg tccgtgtaca agaatggaac gccaattcca 1020 gatatcgagg ttgcccacat gatgattgcc ctacttatgg ccggccaaca ctcttcttcc 1080 tccaccggct cctggatcgt tctccgcctt gccagccgtc cagatattct cgaggagctc 1140 tacgaggaac agaaacgtgt tctcggcgag gatcttccac cactcaccta cgaagctctt 1200 cagaaactcg accttcacaa caatgtaatc aaggagactc tccgccttca cgctccaatc 1260 cactccatcc tccgtgctgt caaatcccct atgcccgttg aagggaccaa ctatgttgtc 1320 ccaacctctc acaacctcct tgccgctcct ggtgttccct cacgagaccc tcagtacttc 1380 cctgaccccc tggtctggaa ccctcaccga tgggagaaca acgttggtgt caccgtagtc 1440 gaggccagtg aagaaaagac agattacgga tacggtttgg ttagcaaggg tgccaacagt 1500 ccttacctcc cattcggctc aggcagacac agatgtatcg gtgaacaatt tgcatatgtt 1560 cagcttggaa ccgtaacagc tacgctagcc agactaatga gatggaagca agttgaaggc 1620 accaaagatg ttgtgccgcc aactgactat tcggtaagtt tggcatatta cgctccttta 1680 tcccgctcga ttttactaac tttccattaa tagtccctct tctcgaagcc atttggcaac 1740 ccaatggtct cgtgggagaa acgaaagcag gcttctcaga aatga 1785 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer for ERG11 gene <400> 9 cgggaattcg tcgccgccaa gatga 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for ERG11 gene <400> 10 ccgctcgagt cagaaatagg gcagc 25 <210> 11 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> template DNA <400> 11 ataccagctt attcaattna gattgcactt actatct 37 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for template DNA <400> 12 ataccagctt attcaatt 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for template DNA <400> 13 agattgcact tactatct 18 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for SELEX <400> 14 ataccagctt attcaatt 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for SELEX <400> 15 agattgcact tactatct 18

Claims (13)

서열번호 1 내지 7로 기재된 염기서열로 구성되는 ERG11(lanosterol 14-α-demethylase) 단백질에 특이적으로 결합하는 DNA 앱타머.
A DNA aptamer that specifically binds to the ERG11 (lanosterol 14-α-demethylase) protein consisting of the nucleotide sequence of SEQ ID NOs: 1 to 7.
제1항에 있어서, 상기 ERG11 단백질은 피부사상균(dermatophyte) 유래 단백질인, DNA 앱타머.
According to claim 1, wherein the ERG11 protein is a dermatophyte (dermatophyte) derived protein, DNA aptamer.
제2항에 있어서, 상기 피부사상균은 트리코피톤 루브럼(trichophyton rubrum)인, DNA 앱타머.
The DNA aptamer according to claim 2, wherein the dermatophyte is trichophyton rubrum .
삭제delete 삭제delete 삭제delete 삭제delete 제1항의 DNA 앱타머를 포함하는 피부사상균의 검출용 조성물.
A composition for the detection of dermatophytes, comprising the DNA aptamer of claim 1.
제8항의 검출용 조성물을 포함하는 피부사상균의 검출용 키트.
A kit for detection of dermatophyte, comprising the composition for detection of claim 8.
제8항의 검출용 조성물을 시료와 반응시키는 단계를 포함하는 피부사상균의 검출방법.
A method of detecting dermatophytes comprising reacting the composition for detection of claim 8 with a sample.
제1항의 DNA 앱타머를 포함하는 피부사상균 감염에 의한 질환 진단용 조성물.
A composition for diagnosing a disease caused by a dermatophyte infection comprising the DNA aptamer of claim 1.
제11항의 진단용 조성물을 포함하는 피부사상균 감염에 의한 질환 진단용 키트.
A kit for diagnosing diseases caused by dermatophyte infection comprising the diagnostic composition of claim 11.
제11항의 진단용 조성물을 시료와 반응시키는 단계를 포함하는 피부사상균 감염에 의한 질환의 진단에 필요한 정보를 제공하는 방법.A method of providing information necessary for the diagnosis of a disease caused by a dermatophyte infection comprising the step of reacting the diagnostic composition of claim 11 with a sample.
KR1020180141866A 2018-11-16 2018-11-16 Dna aptamer specifically binding to erg11 protein and using the same KR102127949B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180141866A KR102127949B1 (en) 2018-11-16 2018-11-16 Dna aptamer specifically binding to erg11 protein and using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180141866A KR102127949B1 (en) 2018-11-16 2018-11-16 Dna aptamer specifically binding to erg11 protein and using the same

Publications (2)

Publication Number Publication Date
KR20200057444A KR20200057444A (en) 2020-05-26
KR102127949B1 true KR102127949B1 (en) 2020-06-29

Family

ID=70915257

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180141866A KR102127949B1 (en) 2018-11-16 2018-11-16 Dna aptamer specifically binding to erg11 protein and using the same

Country Status (1)

Country Link
KR (1) KR102127949B1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6518035B1 (en) * 1998-06-02 2003-02-11 Rosetta Inpharmatics, Inc. Targeted methods of drug screening using co-culture methods
KR100771192B1 (en) 2005-07-29 2007-10-30 재단법인서울대학교산학협력재단 Antifungal agent against dermatophytes containing tea tree oil

Also Published As

Publication number Publication date
KR20200057444A (en) 2020-05-26

Similar Documents

Publication Publication Date Title
KR102549625B1 (en) Personalized Immunogenic Peptide Identification Platform
Sosinska et al. Mass spectrometric quantification of the adaptations in the wall proteome of Candida albicans in response to ambient pH
WO2016188449A1 (en) Single-domain antibody targeting cd47
İzgü et al. Killer toxin of Pichia anomala NCYC 432; purification, characterization and its exo-β-1, 3-glucanase activity
CA3110923A1 (en) Process for preparing vaccine compositions
CN1699408A (en) Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof
JP2000509246A (en) New compound
US20120065126A1 (en) Pharmaceutical Compositions Containing Antifungal Peptides
Seidler et al. GAPDH, as a virulence factor
Kumar et al. sof gene as a specific genetic marker for detection of Streptococcus pyogenes causing pharyngitis and rheumatic heart disease
Liu et al. Expression and antibacterial activity of hybrid antimicrobial peptide cecropinA-thanatin in Pichia pastoris
JP2020505042A (en) Ribosomal RNA origami and method for preparing the same
Liu et al. Preparation of a nanobody specific to dectin 1 and its anti-inflammatory effects on fungal keratitis
KR102127949B1 (en) Dna aptamer specifically binding to erg11 protein and using the same
CN111939247B (en) Protein mixed vaccine for preventing toxoplasmosis of human and animals
WO2011014989A1 (en) Oligonucleotide aptamers targeting at mycobacterium tuberculosis ag85b, preparing method and uses thereof
US6300067B1 (en) TFIIB transcription factor from Candida albicans and methods of screening for inhibitors of Candida albicans growth
CN108948163B (en) Macadamia nut plant defensin and application thereof
KR102123267B1 (en) Dna aptamer specifically binding to propionibacterium acnes and using the same
KR102612990B1 (en) Rna aptamer specifically binding to esm-1 protein and using the same
Gangwar et al. Immunogenicity and protective efficacy of Recombinase A from Wolbachia endosymbiont of filarial nematode Brugia malayi (wBmRecA)
KR102050297B1 (en) DNA Aptamer Specifically Binding to PG-1 Peptide and Its Use
KR20110093024A (en) Dna aptamer specifically binding to anthrax toxins and uses thereof
KR102271882B1 (en) Dna aptamer specifically binding to surface of capnocytophaga ochracea and using the same
KR102310333B1 (en) Dna aptamer specifically binding to capsid protein of foot-and-mouth disease virus and using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant