KR101855723B1 - Method for Detecting Infectious Disease of Crustacea Using PNA Probes - Google Patents

Abstract

The present invention relates to a method for detecting, using a peptide nucleic acid (PNA) probe combined with a reporter and a quencher, marine infectious diseases in crustacean, selected among the group consisting of infection hypodermal and haematopoietie necrosis, infectious myonecrosis, Taura syndrome, white spot disease, white tail disease, crayfish plague, necrotizing pancreatitis, and yellowhead viral disease.

Description

[0001] The present invention relates to a method for detecting a crustacean infectious disease using a PNA probe,

The present invention relates to the use of a PNA probe conjugated with a reporter and a quencher to prevent infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease and necrotizing pancreatitis, The present invention relates to a method for detecting a marine life-threatening infectious disease of crustaceans selected from the group consisting of hair follicles.

Crustacean culture is a very important industry that can generate high added value, and it is also very important in terms of increasing income sources and expansion and growth of aquaculture technology. However, many crustaceans are caused by various viruses and germs. Especially, in case of crustacean disease occurring in aquaculture, the lethality is so high that farms are damaged. In addition, the disease can spread to nearby farms, so early detection and prevention of crustacean diseases is very important.

Currently, grafted crustaceans imported for crustacean cultivation are conducting various disease item tests and are conducting analysis based on the 'Guide to the Diagnosis of Marine Biological Diseases' produced by the National Fisheries Products Quality Management Service. The Guidance on the Diagnosis of Marine Biological Diseases is basically based on the OIE Manual of Aquatic Biological Diseases (OIE) and is used in the same way as the above manual. However, all diagnostic methods are reported and described in a single test method in comparison with various diseases, which is inefficient in terms of time and cost.

Infectious hypodermal and haematopoietic necrosis (IHHN), Infectious myonecrosis (IMNV), Taura Syndrome (TSV), white spot disease White Spot Disease (WSD), White Tail Disease (WTD), Crayfish plague (CP), Necrotising hepatopncreatitis (NH) and Yellow Head disease (YHD) Depending on the nature of the pathogen, simultaneous analysis can be used very effectively for rapid diagnosis and cost.

As a result, the inventors of the present invention have made efforts to produce a kit capable of accurately diagnosing the marine life infectious diseases of crustaceans, and as a result, the sample form of the disease causative agent is classified into RNA and DNA, and then, using a PNA probe, Of the present invention can maximize the efficiency of the diagnostic method of aquatic organism infectious disease when the fusion pattern of the probe and the sample is compared with each other.

It is an object of the present invention to provide a method and system for the diagnosis and treatment of infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease and necrotizing pancreatitis using a PNA probe coupled with a reporter and a quencher And yellow hair diseases. The present invention also provides a method for detecting a marine communicable disease selected from the group consisting of:

Another object of the present invention is to provide a method of treating a disease or condition selected from the group consisting of reporter and quenching associated with infectious subcutaneous and hematopoietic necrosis, infectious myositis, Taura syndrome, white spot disease, white tail disease, Which comprises a probe comprising a nucleotide sequence complementary to a specific nucleic acid of a virus selected from the group consisting of a rodent, a hair follicle, a crustacean, and a fish.

In order to achieve the above object, the present invention provides a pharmaceutical composition comprising (a) (i) a pharmaceutical composition comprising (i) a composition consisting of infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease and necrotizing pancreatitis, And (ii) a PNA probe complementarily binding to a specific nucleic acid sequence of a virus that is a causative agent of a crustacean, a fish pathogen, and a virus;

 (b) obtaining a fusion curve between the hybridized product and the PNA probe while changing the temperature; And

 (c) using a PNA probe coupled with a reporter and a quencher, which comprises the step of detecting the melting temperature between the hybridized product and the PNA probe and detecting the virus causing the crustacea, And a method for detecting a marine crustacean infectious disease selected from the group consisting of hematopoietic necrosis, infectious myofacial disease, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease, necrotizing pancreatitis and yellow hair disease.

The present invention also relates to the use of a compound of formula I in combination with reporter and quenching for the treatment of infectious subcutaneous and hematopoietic necrosis, infectious myositis, Taura syndrome, white spot disease, white tail disease, infectious disease and necrotizing pancreatitis, The present invention provides a kit for detecting a crustacean living organism communicable disease, which comprises a probe comprising a nucleotide sequence complementary to a specific nucleic acid of a virus selected from the group consisting of viruses, crustaceans, and fishes.

The present invention is based on the analysis of the eight kinds of fish diseases of crustaceans by analyzing the sample of disease causation into RNA and DNA group and analyzing simultaneously with a reporter and quencher coupled PNA probe, It is possible to maximize the efficiency of the biological infectious disease testing method.

Fig. 1 shows the results of the production of PNA probes based on the information on the nucleotide sequences of eight kinds of crustacean biotic diseases.
Figure 2 shows real-time PCR conditions for RNA groups and DNA groups.
Fig. 3 shows the results of a single detection experimental melting curve for eight species of crustacean biotic diseases.
FIG. 4 shows the results of the simultaneous analysis of crustal bioscience disease crust curve.
FIG. 5 shows the results of the melting curve experiment according to the sensitivity of simultaneous analysis of crustacean biotic diseases.
FIG. 6 shows the results of simultaneous analysis of PNA probes by pathogen concentration.
FIG. 7 shows sensitivity test results using a method for diagnosis of a crustacean bioscience disease.
Fig. 8 shows the verification conditions of the results of a guidebook for the detection of a crustacean biotic disease using a PNA probe.
FIG. 9 shows the results of the melting curve of the results of the diagnostic guide for a biological study of crustaceans using PNA probes.

In the present invention, the present invention encompasses eight important biological activities of crustaceans comprising crustaceans consisting of infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, louse infectious disease and necrotizing pancreatitis and yellow hair disease , Real-time PCR was performed using a PNA probe coupled with a reporter and a quencher, followed by simultaneous analysis through the melting temperature of each virus , And the fusion curves were obtained. The viruses were simultaneously detected using the different melting temperatures of the eight viruses. This method reduces the inconvenience of individually analyzing each disease agent individually, Saving of analysis and analysis time can be saved.

Thus, in one aspect, the present invention provides a method of treating a patient suffering from (a) (i) a group consisting of (i) infectious subcutaneous and hematopoietic necrosis, infectious myositis, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease and necrotizing pancreatitis, (Ii) a PNA probe complementarily binding to a specific nucleic acid sequence of a virus which is a causative agent of a crustacean, and (ii) a virus comprising a nucleic acid selected from the group consisting of:

 (b) obtaining a fusion curve between the hybridized product and the PNA probe while changing the temperature; And

 (c) using a PNA probe coupled with a reporter and a quencher, which comprises the step of detecting the melting temperature between the hybridized product and the PNA probe and detecting the virus causing the crustacea, And a method for detecting a marine crustacean infectious disease selected from the group consisting of hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease, necrotizing pancreatitis and yellow hair disease.

In the present invention, the PNA probe is a sequence complementary to a specific nucleic acid of a virus causing infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease and necrotizing pancreatitis and yellow hair disease And preferably one of SEQ ID NOS: 1 to 9, but the present invention is not limited thereto.

In the present invention, it is preferable to perform the detection by dividing into an RNA group and a DNA group according to the type of nucleic acid constituting the virus which is the infection cause virus. Thus, the DNA group probe comprises SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 6, and the RNA group probe is a PNA probe of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 .

In the present invention, the virus-derived nucleic acid may be characterized in that the nucleic acid is obtained by amplifying a sample using the primer pairs described in Table 1. [

In the present invention, the reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) , And the quenching may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl. .

PNA (peptide nucleic acids) are artificially synthesized as one of gene recognition materials such as LNA (Locked Nucleic Acid) and MNA (Mopholino nucleic acid), and the basic skeleton is composed of polyamide. PNA has very good affinity and selectivity and is highly stable against nucleic acid degrading enzymes and thus is not degraded into existing restriction enzymes. In addition, it has the advantage of being easy to store and not to be easily decomposed due to high thermal and chemical properties and stability.

The PNA-DNA binding force is very superior to the binding force between DNAs, and the mismatch of one nucleotide differs by about 10 to 15 ° C. Using this difference in binding force, SNP and In / Del nucleic acid changes can be detected.

It is also easy to develop a diagnostic method using the PNA probe because the Tm value changes depending on the difference in complementary DNA binding to the PNA probe. The PNA probe analyzes the difference in base sequence by a hybridization method that is different from the hydrolysis method of the TaqMan probe. Molecular beacon probes and scorpion probes are similar probes .

The hybridization analysis method uses FMCA (Fluorescence Melting Curve Analysis). The FMCA analyzes the difference in the binding force between the product and the probe after the PCR reaction is finished, by dividing the Tm. Unlike other SNP detection probes, the PNA probes used in FMCA are very easy to design and are produced using 9-15 mer sequences containing SNPs. Therefore, in order to design a probe having a desired Tm value, it is possible to adjust the Tm value according to the length of the PNA probe or to adjust the Tm value by changing the PNA probe having the same length. Because of the high Tm, the PNA can be designed to be shorter than the DNA, allowing detection of SNPs that are close to each other. The difference between the Tm values of the conventional HRM method is as low as about 0.5 ° C, which requires additional analysis programs or detailed temperature changes, making analysis difficult when two or more SNPs are present, whereas PNA probes are not affected by probe sequences and SNPs Analysis is possible.

For SNP analysis using PNA probes, it is only necessary to use a probe with a base containing a SNP and a Forward / Reverse primer set for PCR. The PCR conditions can be used as they are and the melting process is required after the PCR is completed. The fluorescence intensities are measured every 1 ° C and Tm values can be obtained. High resolution melting (HRM) As such, there is an advantage that additional program purchases or detailed temperature changes are not required.

In order to optimize the result using PNA probes Liquid type MeltingArray ^TM method and U-TOP ^TM (Universal Temperature Of PNA) method to detect deletion or insertion of substitution and a base in a single nucleotide sequence of the target nucleic acid effectively, reporter ( reporters and quenchers were used to clean the hybridization process and a liquid-phase array method in which the probe need not be fixed to the plate.

Although the length of the PNA nucleotide sequence according to the present invention is not particularly limited, the length of the PNA nucleotide sequence according to the present invention may be 12 to 18 mers in length so as to include a specific nucleotide sequence (for example, a base mutation or single nucleotide polymorphism (SNP) have. At this time, it is possible to design the PNA probe to have the desired Tm value by adjusting the length of the PNA probe, or to adjust the Tm value by changing the base sequence of the PNA probe of the same length. In addition, since PNA probes have higher binding strength than DNA and have a higher basic Tm value, they can be designed to have a shorter length than DNA, so that neighboring base mutations or SNPs can be detected. According to the existing HRM (High Resolution Melt) method, the difference in Tm value is very small at about 0.5 DEG C, so that when two or more base mutations are present, the PNA probe according to the present invention can not be matched with the base sequence variation. It is possible to analyze the difference of Tm value depending on the base position.

A "sample" in the present invention includes various samples, and preferably, a biosample is analyzed using the method of the present invention. More preferably, it may be a sample mixed with the virus species described in the present invention or a sample of an individual (for example, fish, etc.) infected with the virus, and may be a sample of plants, animals, humans, fungi, bacteria, Samples can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be from a particular tissue or organ. Representative examples of tissues include binding, skin, muscle or nervous tissue. Representative examples of organs include, but are not limited to, eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testes, Line and inner blood vessels. The biological sample to be analyzed includes any cells, tissues, fluids from the biological source, or any other medium that can be well analyzed by the present invention, including human, animal, human or animal Lt; RTI ID = 0.0 > a < / RTI > In addition, the biological sample to be analyzed includes a body fluid sample, which may be a blood sample, serum, plasma, lymph, milk, urine, feces, eye milk, saliva, semen, brain extract And tonsil tissue extracts.

The 'target nucleic acid' of the present invention refers to a nucleic acid sequence (including a base mutation or a SNP) to be detected, and includes a specific region of a nucleic acid sequence of a 'target gene' encoding a protein having a physiological / biochemical function And annealed or hybridized with the primer or probe under hybridization, annealing or amplification conditions.

"Hybridization" of the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

In the present invention, the melting curve analysis may be performed by the FMCA (Fluorescence Melting Curve Analysis) method.

The PNA probe comprising the reporter and the quencher of the present invention hybridizes with the target nucleic acid and generates a fluorescence signal. As the temperature rises, the fluorescence signal is rapidly extinguished with the target nucleic acid at the optimal melting temperature of the probe, (Base mutation or SNP) of the target nucleic acid can be detected through analysis of the high-resolution fusion curve obtained from the fluorescence signal according to the fluorescence signal. The PNA probe exhibits a predicted melting temperature (Tm) value in the case of a perfect match with the target nucleic acid sequence, but incompletely hybridizes with the target nucleic acid in which the base mutation is present, (Tm) value.

The 'base mutation' of the present invention is characterized by a mutation in the base sequence of the target nucleic acid, which includes not only single nucleotide polymorphism (SNP) but also mutation of base, substitution, deletion or insertion , The PNA probe of the present invention can be analyzed by melting curve analysis that the SNP of the target nucleic acid or the base of the target nucleic acid has been substituted, deleted or inserted so that the mutation occurs.

The Tm value changes depending on the nucleotide of the DNA complementary to the nucleotide of the PNA probe, and it is easy to develop an application using the same. PNA probes are analyzed using a hybridization method different from the hydrolysis method of TaqMan probes. Molecular beacon probes, scorpion probes, .

In order to analyze a specific base sequence (for example, base mutation or SNP) using a PNA probe, a probe containing a base (s) recognizing a specific base sequence and a forward / reverse primer set for PCR (a conventional primer Pair: according to the criteria of the Office of International Epizootics (OIE)) and a primer that generates a single-stranded genetic marker sequence fragment from a template of a genomic marker sequence amplified by the primer set Do. The PCR can be performed using conventional methods. After the PCR is completed, a melting process is required. The Tm value is obtained by measuring the intensity of fluorescence every 0.5 to 1 ° C. Particularly, general real-time PCR (real-time PCR) apparatuses are widely used and advantageous in that they do not require additional program purchase such as HRM (High Resolution Melting) or detailed temperature change.

The fusion curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed from DNA or RNA as a target nucleic acid and a probe. Such a method is called a fusion curve analysis because it is performed, for example, by Tm analysis or analysis of the melting curve of the double chain. Hybrid (double-stranded DNA) of the target single-stranded DNA of the detection sample and the probe is formed using a probe complementary to a specific base sequence (including base mutation or SNP) of the detection target (target). Subsequently, the hybrid formed body is subjected to a heat treatment, and dissociation (melting) of the hybrid due to temperature rise is detected by fluctuation of signals such as absorbance. Then, the Tm value is determined based on the detection result to determine the presence or absence of the specific base sequence. The Tm value is higher as the homology of the hybrid construct is higher, and lower as the homology is lower. For this reason, a Tm value (evaluation reference value) is previously obtained for a hybrid formed product of a specific base sequence to be detected and a probe complementary thereto, and the Tm value (measured value) between the target single- It can be determined that a specific base sequence exists in a match, that is, a target DNA. If the measured value is lower than the evaluation reference value, mismatching, that is, a base to be targeted to the target DNA It can be judged that there are no sequences or mutations.

The fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent substance, and more specifically, a melting curve can be analyzed using a probe containing a fluorescent substance. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In the present invention, the amplification may be performed using a Real-Time Polymerase Chain Reaction (PCR) method.

In the real-time polymerase chain reaction (PCR) method of the present invention, a fluorescent substance is interchelated in a double strand DNA chain in a PCR process, and the PCR product is amplified, By analyzing the pattern of the melting curve, especially the temperature (Tm) at which the DNA is melted (denatured), the amount of fluorescent substance present between the double strands of DNA is reduced by loosening the strand, and the presence or absence of a specific nucleotide sequence To detect and / or identify a virus type.

Technological methods for optimizing the results of the present invention include a liquid type U-TOP method (line of sight biomaterials, Korea), a reporter capable of effectively detecting the substitution of a single base sequence of a target nucleic acid and the deletion or insertion of a base ) And a quencher coupled with a PNA probe, and a liquid-phase array method in which the PNA probe does not need to be fixed to a plate shape can be utilized.

The method for detecting the crustacean aquatic organisms infectious disease of the present invention can be carried out by using a detection kit.

Accordingly, the present invention, in another aspect, relates to a method for the treatment and / or prophylaxis of infectious subcutaneous and / or hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, Which comprises a PNA probe comprising a nucleotide sequence complementary to a specific nucleic acid of a virus selected from the group consisting of pancreatitis and yellow head disease, which is a crustacea, and a kit for detecting a marine crustacean infectious disease.

In the present invention, it is preferable to perform the detection by dividing into an RNA group and a DNA group according to the type of nucleic acid constituting the virus which is the infection cause virus. Thus, the DNA group probe comprises SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 6, and the RNA group probe is a PNA probe of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 .

In the present invention, the reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) , And the quenching may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl. .

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example 1: Preparation of PNA probes and primers for 8 items of crustacean aquatic organisms infectious diseases

Infectious hypodermal and haematopoietic necrosis (IHHN), Infectious myonecrosis (IMNV), Taura Syndrome (TSV), White Spot Disease, Simultaneous analytical diagnosis of WSD, White Tail Disease (WTD), Crayfish plague (CP) and Necrotising hepatopncreatitis (NH), Yellow Head disease (YHD) In order to produce the kit, the nucleotide sequence analysis was performed through the NCBI DB based on the information of the nucleotide sequence described in the 'Guide to the Diagnosis of Marine Biological Diseases' used by the National Fisheries Products Quality Management Service. Based on the analysis results, PNA probes capable of specifically detecting in the amplification products using the primers (SEQ ID NOs: 23 to 42) were prepared using primers of the existing diagnostic guide to aquatic life biological diseases (SEQ ID NOs: 23 to 42) And Figure 2b).

PNA probes and primers for detection of marine infectious diseases No. Name sequence (5'-3`) Remarks One IHHN
Infectious Subcutaneous and Hematopoietic Disease Dabcyl-ACCAGACATAGAG-OK (FAM) (SEQ ID NO: 1)
Dabcyl-ACCAGACATAGAG-OK (HEX) (SEQ ID NO: 2)
Dabcyl-ACCAGACATAGAG-OK (Cy5) (SEQ ID NO: 3) PNA probes 2 IMNVp1
Infectious myositis Dabcyl-GGTAGACTGCAAG-OK (FAM) (SEQ ID NO: 4)
Dabcyl-GGTAGACTGCAAG-OK (Q705) (SEQ ID NO: 5) 3 TSV
Taura Syndrome Dabcyl-CACAATATTCGA-O-K (HEX) (SEQ ID NO: 6) 4 WSD
White spot Dabcyl-ATGCCGTCTATCACA-O-K (Cy5) (SEQ ID NO: 7) 5 CP
Lobster epidemic Dabcyl-TTCGGGACGAC-O-L (HEX) (SEQ ID NO: 8) 6 NHP
Necrotizing pancreatitis Dabcyl-GCCCGTCAAGC-O-K (TxR) (SEQ ID NO: 9) 7 YHD
Yellow head bottle Dabcyl-AGACATGACAATTCA-O-K (TxR) (SEQ ID NO: 10) 8 WTD_MrNV
Dabcyl-GAACATGACTTCACG-OK (Cy5) (SEQ ID NO: 11)
Dabcyl-GAACATGACTTCACG-OK (FAM) (SEQ ID NO: 12) 9 WTD_XSV Dabcyl-CCCATGATCCTCGC-O-K (Q705) (SEQ ID NO: 13) 12 WSD-1R CTGGCGCATG AGGCGAATGG TAC (SEQ ID NO: 14) primer 13 IHHN
Infectious Subcutaneous and Hematopoietic Disease TACTCCGGACACCCAACCA (SEQ ID NO: 23)
GGCTCTGGCAGCAAAGGTAA (SEQ ID NO: 24) primer 14 IMNVp1
Infectious myositis GGACCTATCATACATAGCGTTGCA (SEQ ID NO: 25)
AACCCATATCTATTGTCGCTGGAT (SEQ ID NO: 26) primer 15 TSV
Taura Syndrome TTGGGCACCAAACGACATT (SEQ ID NO: 27)
GGGAGCTTAAACTGGACACACTGT (SEQ ID NO: 28) primer 16 WSD
White spot TGGTCCCGTCCTCATCTCAG (SEQ ID NO: 29)
GCTGCCTTGCCGGAAATTA (SEQ ID NO: 30) primer 17 WTD
White-tailed bottle MrNV-F: AGGATCCACTAAGAACGTGG (SEQ ID NO: 31)
MrNV-R: CACGGTCACAATCCTTGCG (SEQ ID NO: 32)
XSV-F: AGCCACACTCTCGCATCTGA (SEQ ID NO: 33)
XSV-R: CTCCAGCAAAGTGCGATACG (SEQ ID NO: 34) primer 18 CP
Lobster epidemic AAGGCTTGTGCTGGGATGTT (SEQ ID NO: 35)
CTTCTTGCGAAACCTTCTGCTA (SEQ ID NO: 36) primer 19 NHP
Necrotizing pancreatitis CGTTCACGGGCCTTGTACAC (SEQ ID NO: 37)
GCTCATCGCCTTAAAGAAAAGATAA (SEQ ID NO: 38) primer 20 YHD
Yellow head bottle GY1: GACATCACTCCAGACAACATCTG (SEQ ID NO: 39)
GY4: GTGAAGTCCATGTGTGTGAGACG (SEQ ID NO: 40)
GY2: CATCTGTCCAGAAGGCGTCTATGA (SEQ ID NO: 41)
Y3: ACGCTCTGTGACAAGCATGAAGTT (SEQ ID NO: 42) primer

In Table 1, O means linker and K means lysine.

In order to carry out the relative evaluation of the simultaneous assay kit using the PNA probe, the primer and the probe described in the "Guide to the Diagnosis of Marine Organisms Disease" (Publication Registration No. 11-1192073-000006-12) In the case of yellow hair and white tail disease, the probe was not made for the above two because the guiding method was electrophoresis and SYBR method. In the case of WSD, the reverse primer disclosed in the Guidance on the Diagnosis of Marine Biological Diseases was newly prepared and used.

First, PNA probes were directly designed for the detection of 8 items of crustacean marine organism infectious diseases. All PNA probes (FAM-labeled, Dabcyl) used in the present invention were synthesized by HPLC purification method in Panagene (Korea), and the purity of all the synthesized probes was confirmed by mass spectrometry. The unnecessary secondary structure of the probe was avoided for effective coupling.

Finally, in order to construct a simultaneous assay kit by dividing into RNA and DNA groups, it was manufactured so that the interference between the probe and the primer in the group did not occur. The fusion temperature of the probe did not exceed 72 ° C, Respectively.

Example 2: Individual melting curve analysis in a real-time gene amplification apparatus for detection of aquatic organisms infecting crustaceans using a PNA probe

In the case of a sample for detection of a crustacean fish microbial infectious disease, the following cannabis including the base sequence of the TaqMan probe and the PNA probe base sequence were prepared (SEQ ID NOS: 15 to 22).

Positive control IH (IHHN, infectious subcutaneous and hematopoietic necrosis) (SEQ ID NO: 15)

ACATACTCCGGACACCCAACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATCTGGGAGTTACCTTTGCTGCCAGAGCCGAAG

Positive control-IM (IMNV, infectious mycoses) (SEQ ID NO: 16)

TCCTGGACCTATCATACATAGCGTTGCATTTGCAAGAACTGGTTCAGTATGGACACCTGCCACCTTTACTTTCAATACTACATCATCCCCGGGTAGACTGCAAGTACAAATGTCATCCAGCGACAATAGATATGGGTTCA

Positive control-TS (TSV, Taura Syndrome) (SEQ ID NO: 17)

GTGCTTGGGCACCAGACGACATTCCAGCACTGACGCACAATATTCGATCATCACAGTGTGTCCAGTTTAAGCTCCCTACA

Positive control-WS (WSD, white spot) (SEQ ID NO: 18)

GAATCAATGGATTATGAAGATAGCGAAACAACATCCAACAATGGTCCCGTCCTCATCTCAGAAGCCATGAAGAATGCCGTCTATCACACACTAATTTCCGGCAAGGCAGCTCGCCCGGAAAATGTACCATTCGCCTCATGCGCCAG

Positive control-WT (WTD, white tail) (SEQ ID NO: 19)

TTTCAGGATCCACTTAGAACGTGGAGAAAGTTGAACATGACTTCACGCACGTGCAACGCAAGGATTGTGACCGTGAGAACGAGCCAAACTCTCGCATCTGAGTATAAATCATGCCCCATGATCCTCGCATCGTATCGTACTTTGCTGGAGAAAAC

Positive control-CP (CP, infectious disease) (SEQ ID NO: 20)

CTTTATAAGGCTTGTGCTGAGGATGTTCTTCGGGACGACCCGGCTAGCAGAAGGTTTCGCAAGAAGCCGATG

Positive control-NH (NH, necrotizing pancreatitis) (SEQ ID NO: 21)

≪ RTI ID =

Positive control-YH (YHD, Yellowhead disease) (SEQ ID NO: 22)

TATACAACTTCGACATCACTCCAGACAACATCTGTCCAGAAGGCGTCTATGACTTCGCACATGAAGACATGACAATTCATCTCAACTTCATGCTTGTCACAGAGCGTCACCGTGATCGTCTCACACACATGGACTTCACCTC

The test was carried out on eight crustacean marine lifeblood infectious diseases using the prepared protoplasts. First, the detection experiment was carried out using the PNA probe and positive control group. Simultaneous analysis Before each experiment, each of the eight items was analyzed individually. In the case of PNA probes and primers used in the experiment, all of the diseases were classified according to the items.

Equipment used for a single detection experiment was used as the CFX96 ^TM (Bio-Rad, USA) conditions were PNA probes 0.5㎕ / 10pmol, Forward primer 1㎕ / 3pmol, Reverse primer 1㎕ / 30pmol, target yangseongche 3㎕ / 10ng, (IMNV, TSV, WTD, YHD), 10 μl of a 2X one step qRT PCR PreMix (Seed Biomaterials, Korea), and 4 samples corresponding to DNA pathogens For the disease (IHHN, WSD, CP, NH), 10 μl of 2X qPCR PreMix (Eye Biomaterials, Korea) was added to give a total volume of 20 μl. Experimental conditions were separated into RNA and DNA groups (FIG. 2).

As a result of real-time PCR, as shown in FIG. 3, the fusion curve and the specific detection temperature were normally observed according to the RNA target and the DNA target, and it was confirmed that there was no abnormality in the result analysis in the individual experiment of the 8 kinds of infectious diseases .

Example 3 Simultaneous Analysis in a Real-Time Gene Amplification Apparatus for the Detection of Crustacean Marine Aquatic Infectious Disease Using a PNA Probe

Simultaneous analysis of RNA and DNA groups was performed using PNA probes identified by individual analysis. The equipment used for the simultaneous analysis experiment was CFX96 ^™ (Bio-Rad, USA) and the experimental conditions were as follows.

5 pmol of the PNA probes (IMNVp1, TSV, YHD, WTD-MrNV and WTD-XSV), 0.5 μl / 6 pmol of the forward primer, 0.5 μl / 60 pmol of the reverse primer, 4.5 μl / One step qRT PCR PreMix (Seesaw Biomaterials, Korea) 10 μl, distilled water was added so that the final volume was 20 μl.

For the DNA group, 0.5 μl / 5 pmol of PNA probes (IHHN, WSD, CP, NH), 0.5 μl / 6 pmol of the forward primer, 0.5 μl / 60 pmol of the reverse primer, 5 μl / 5 ng of the target isomer mixture, 2 × qPCR PreMix Korea, Korea) was added to make a total volume of 30 占 퐇. The experimental conditions were divided into RNA and DNA groups and proceeded in the same manner as shown in Fig.

As a result of analysis using real-time gene amplification device, as shown in FIG. 4, simultaneous analysis of all eight items of crustacean, marine and infectious diseases were able to confirm accurate detection temperatures.

Simultaneous analysis was performed based on the above results and experimental conditions, and the sensitivity test of the experiment was conducted. Sample concentrations exhibited a diluted after mixing yangseongche groups to ^{40ng x 10 -2 ~ 40ng x 10} -14 simultaneous progress analysis (Fig. 5), the results are shown in Table 2, the sensitivity test results 40ngx10 ^-8 Can be detected.

Simultaneous analysis of crustacean marine organism infectious disease sensitivity test results division Inspection items Check 40ng
x10 ^-2 40ng
x10 ^-4 40ng x 10 ^-6 40ng
x10 ^-8 40ng
x10 ^-10 40ng
x10 ^-12 40ng
x10 ^-14 NTC RNA Infectious myositis
(IMNV) Melting Tm 68.00 68.00 67.00 67.00 None None None None Taura Syndrome
(TSD) Melting Tm 52.00 52.00 52.00 51.00 None None None None Yellow head bottle
(YHD) Melting Tm 66.00 66.00 65.00 65.00 None None None None White-tailed bottle
(WTD) Melting Tm
(MrNV) 65.00 64.00 63.00 63.00 None None None None Melting Tm
(XSV) 63.00 62.00 62.00 62.00 None None None None DNA Contagious subcutaneous and
Hematopoietic dysplasia
(IHHN) Melting Tm 65.00 65.00 64.00 65.00 None None None None Lobster epidemic
(CP) Melting Tm 64.00 64.00 63.00 63.00 None None None None White spot
(WSD) Melting Tm 64.00 64.00 63.00 63.00 None None None None Necrotizing pancreatitis
(NH) Melting Tm 66.00 65.00 65.00 64.00 None None None None

As a result of the sensitivity test, the performance of the simultaneous assay kit was confirmed, and the performance of the additional simultaneous assay kit was confirmed through experiments of different concentrations of the pathogen.

When crustaceans are infected by aquatic life communicable diseases, there may be one or many pathogens present in a single sample, and the concentrations of pathogens may also be scattered at various concentrations. Therefore, simultaneous analysis experiments were carried out at various concentrations by different concentrations of the corresponding pathogens in the RNA and DNA groups. The concentrations of the pathogens used in the experiments are shown in Table 3, and the results of the melting curve in the real-time gene amplification apparatus are shown in FIG. Table 4 also shows the melting temperature of the concentration table and the melting curve test results.

As a result, as shown in FIG. 6, even if the concentrations were different from each other in one sample, the result could be confirmed accurately in deriving the results.

Example 4: Guideline for Diagnosis of Aquatic Infectious Diseases Using PNA Probes Method Validation of Results

In most of the cases of the Crustacea infectious disease testing method described in the Guideline for the Diagnosis of Marine Biological Diseases, most of the diagnostic methods using the TaqMan probe in the real-time gene amplification apparatus were used, but the yellow hair disease was performed by electrophoresis after gene amplification and the white tail disease was performed by the SYBR method .

 The detection experiment was carried out using the diagnostic method described in the Guideline for Diagnosis of Marine Biological Diseases by using a canine (Fig. 7).

Based on the results of the above experiments, verification tests of the diagnostic methods described in the handbook were conducted using the results of the experiments conducted.

10 μl of 2X Melting Array Buffer (Seen Biomaterials, Korea), 0.5 μl / 10 pmol of PNA probe, and distilled water to make final volume 20 μl. . The experimental method is shown in FIG. 8, and the results of the melting curve in the real-time gene amplification apparatus are shown in FIG. 9, and the results in FIGS. 7 and 9 are summarized in Table 5.

Figure 7, which is a result of the existing diagnostic guideline method, shows that in the case of infectious myofacial infection, Taura syndrome, infectious subcutaneous and hematopoietic necrosis, infectious disease, white spot disease, and necrotizing pancreatitis among TaqMan probes, A value of around 35 or more has occurred. Such a result is negatively processed, and it is difficult to read the result. In the case of white tail disease, the low temperature of SYBR and Ct value of NTC were the same.

8, which is a method of the present invention, the result of the verification using the resultant product, the result of the cutoff value Ct35 generated by the method of the guidebook was confirmed accurately by the melting curve temperature, and in the case of the SYBR method It can be confirmed that it is very effective to improve the accuracy of the test method of the existing manual by showing the accurate melting curve irrespective of the Ct value and the low Ct value generated in NTC.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> National Fishery Products Quality Management Service <120> Method for Detecting Infectious Disease of Crustacea Using PNA          Probes <130> P17-B049 <160> 42 <170> Kopatentin 2.0 <210> 1 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 1 accagacata gag 13 <210> 2 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 2 accagacata gag 13 <210> 3 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 3 accagacata gag 13 <210> 4 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 4 ggtagactgc aag 13 <210> 5 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 5 ggtagactgc aag 13 <210> 6 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 6 cacaatattc ga 12 <210> 7 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 7 atgccgtcta tcaca 15 <210> 8 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 8 ttcgggacga c 11 <210> 9 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 9 gcccgtcaag c 11 <210> 10 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 10 agacatgaca attca 15 <210> 11 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 11 gaacatgact tcacg 15 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 12 gaacatgact tcacg 15 <210> 13 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 13 cccatgatcc tcgc 14 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ctggcgcatg aggcgaatgg tac 23 <210> 15 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 15 acatactccg gacacccaac caataagacc agacatagag ctacaatcct cgcctatctg 60 ggagttacct ttgctgccag agccgaag 88 <210> 16 <211> 140 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 16 tcctggacct atcatacata gcgttgcatt tgcaagaact ggttcagtat ggacacctgc 60 cacctttact ttcaatacta catcatcccc gggtagactg caagtacaaa tgtcatccag 120 cgacaataga tatgggttca 140 <210> 17 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 17 gtgcttgggc accagacgac attccagcac tgacgcacaa tattcgatca tcacagtgtg 60 tccagtttaa gctccctaca 80 <210> 18 <211> 146 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 18 gaatcaatgg attatgaaga tagcgaaaca acatccaaca atggtcccgt cctcatctca 60 gaagccatga agaatgccgt ctatcacaca ctaatttccg gcaaggcagc tcgcccggaa 120 aatgtaccat tcgcctcatg cgccag 146 <210> 19 <211> 155 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 19 tttcaggatc cacttagaac gtggagaaag ttgaacatga cttcacgcac gtgcaacgca 60 aggattgtga ccgtgagaac gagccaaact ctcgcatctg agtataaatc atgccccatg 120 atcctcgcat cgtatcgtac tttgctggag aaaac 155 <210> 20 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 20 ctttataagg cttgtgctga ggatgttctt cgggacgacc cggctagcag aaggtttcgc 60 aagaagccga tg 72 <210> 21 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 21 gaatacgttc acgggccttg tacacactgc ccgtcaagcc atggaagtta tcttttcttt 60 aaggcgatga gctaaccag 79 <210> 22 <211> 142 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 22 tatacaactt cgacatcact ccagacaaca tctgtccaga aggcgtctat gacttcgcac 60 atgaagacat gacaattcat ctcaacttca tgcttgtcac agagcgtcac cgtgatcgtc 120 tcacacacat ggacttcacc tc 142 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tactccggac acccaacca 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ggctctggca gcaaaggtaa 20 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ggacctatca tacatagcgt tgca 24 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 aacccatatc tattgtcgct ggat 24 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ttgggcacca aacgacatt 19 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gggagcttaa actggacaca ctgt 24 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tggtcccgtc ctcatctcag 20 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 gctgccttgc cggaaatta 19 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 aggatccact aagaacgtgg 20 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 cacggtcaca atccttgcg 19 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 agccacactc tcgcatctga 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ctccagcaaa gtgcgatacg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 aaggcttgtg ctgggatgtt 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 cttcttgcga aaccttctgc ta 22 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 cgttcacggg ccttgtacac 20 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 gctcatcgcc ttaaagaaaa gataa 25 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gacatcactc cagacaacat ctg 23 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 gtgaagtcca tgtgtgtgag acg 23 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 catctgtcca gaaggcgtct atga 24 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 acgctctgtg acaagcatga agtt 24

Claims (10)

A PNA probe having a nucleotide sequence represented by SEQ ID NOS: 1 to 9, comprising a reporter and a quencher, is used for infectious subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, Simultaneous Detection of Crustacean Communicable Disease Including White Spot, White Tail, Lobster, Necrotizing Pancreatitis and Yellow Head Disease:
(a) (i) a virus selected from the group consisting of infectious subcutaneous and hematopoietic necrosis, infectious myositis, Taura syndrome, white spot disease, white tail disease, crawfish infectious disease, necrotizing pancreatitis and yellow hair disease; (Ii) mixing and hybridizing a PNA probe complementarily binding to a specific nucleic acid sequence of the virus, which is the causative virus of the crustacean,
(b) obtaining a fusion curve between the hybridized product and the PNA probe while changing the temperature; And
(c) detecting the fusion temperature between the hybridized product and the PNA probe to detect a virus caused by a crustacean, aquatic lifeblood, or the like.
delete delete delete 4. The method of claim 1 wherein the reporter is selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Lt; RTI ID = 0.0 &gt; CY5. &Lt; / RTI &gt;
The method according to claim 1, wherein the quencher is at least one selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2 and Dabcyl.
A reporter and a quencher are combined with the nucleotide sequence shown in SEQ ID NOs: 1 to 9, and a transfected subcutaneous and hematopoietic necrosis, infectious mycoses, Taura syndrome, white spot disease, white tail disease, A kit for the detection of a crustacean marine microbial infectious disease containing a PNA probe comprising a nucleotide sequence complementary to a specific nucleic acid of a virus which is a crustacean marine life-threatening infectious disease comprising an infectious disease, necrotizing pancreatitis and yellow hair disease .
delete 8. The method of claim 7 wherein the reporter is selected from the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Lt; RTI ID = 0.0 &gt; CY5. &Lt; / RTI &gt;
The kit according to claim 7, wherein the quencher is at least one selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2 and Dabcyl.

Images