KR20200129600A - Pepetide nucleic acid probe for genotyping Helicobacter pylori and Method using the same - Google Patents

Abstract

The present invention relates to a PNA probe for genotyping Helicobacter pylori and a method for genotyping Helicobacter pylori using the same. The PNA probe according to the present invention can confirm and discriminate the presence or absence of a mutation that is difficult to confirm or verify by clearing the difference in Tm value between two mutations that did not show a difference in Tm value. In addition, the present invention enables the diagnosis of clarithromycin resistance-causing point mutations of Helicobacter pylori, which were difficult to distinguish between Tm values when two mutations were present in succession. Thus, the present invention enables simultaneous analysis of a Helicobacter pylori detection test and a clarithromycin resistance test, which were conventionally performed separately, with high sensitivity and high accuracy within a short time, so that a suitable disinfection treatment can be quickly applied.

Description

PNA probe for genotype discrimination of Helicobacter pylori and method for genotyping of Helicobacter pylori using the same {Pepetide nucleic acid probe for genotyping Helicobacter pylori and Method using the same}

The invention Helicobacter pylori (Helicobacter pylori) relates to a Helicobacter pylori genotype determination method using PNA probes, and this for genotype determination, more specifically, selected from a PNA probe and SEQ ID NO: 1 to 10 selected from SEQ ID NO: 13 to 22 The present invention relates to a method of amplifying a Helicobacter pylori gene using a pair of primers and determining a Helicobacter pylori genotype through hybridization of a PNA probe.

PNA (Peptide Nucleic Acid), a nucleic acid-like substance, is electrically neutral, so it has superior recognition and binding ability to target DNA than DNA, and thus, it can induce strong binding even with a shorter length than DNA. I can. In addition, various modifications are possible to determine the desired Tm value, and unlike TaqMan DNA probes, which require one probe for one SNP, the base mutation of the target nucleic acid is easily distinguished by temperature difference through dissolution curve analysis with one PNA probe. It is easy to do genotyping.

Helicobacter pylori is a Gram-negative bacterium that inhabits human gastric mucosa, damages epithelial cells and induces inflammation, causing digestive diseases such as chronic gastritis, gastric ulcer, duodenal ulcer, gastric marginal B-cell lymphoma and gastric cancer. In a meta-analysis that analyzed the effect of Helicobacter pylori on gastric cancer incidence, the relative risk of gastric cancer in the Helicobacter pylori-positive group was 3 times higher than that of the negative group, and 1.7-5.3 times higher in Korea, and the reinfection rate of Helicobacter pylori was found in Western Europe. It is about 0.5-2.5% per year, whereas in Asia it is high at 4.3-13.0%, and in Korea it has a reinfection rate of 2.9-9.1%. The incidence of gastric cancer in Korea is still the highest in the world, and the infection rate of Helicobacter pylori is also higher than in other developed countries, so the risk of disease is high. In addition to digestive diseases, Helicobacter pylori is known to be associated with blood diseases such as diabetes, hypertension, glaucoma, and anemia, immune diseases and metabolism, and skin diseases (Siddique O et al., Am J Med. Vol. 15, pp. .30013-5, 2017).

Diagnosis of Helicobacter pylori is possible through a variety of methods.Checking the presence or absence of bacteria through staining or culturing the gastric mucosa, rapid urease test and urea breath test using urease produced by bacteria, antigen test using feces, serum Antibody tests and polymerase chain reaction (PCR) methods have been used (Khadanoi F et al., Helicobacter, Vol. 22, Issue. 6, e12444, 2017).

The Helicobacter pylori test requires not only the detection of bacteria, but also an antibiotic resistance test.In particular, the development of resistance to clarithromycin, an antibiotic mainly used for the antibacterial treatment of Helicobacter pylori, is considered as a major cause of treatment failure. Clarithromycin resistance is known to be related to mutations in the nucleotide sequence in the 23S rRNA gene of Helicobacter pylori, and among them, A2142G and A2143G mutations are the most common and show a high resistance rate to clarithromycin, which greatly reduced the eradication rate of patients. In developed countries in the United States, Europe, and Asia, it has been reported that there are already many regions with a high tolerance rate of more than 20% to clarithromycin, and it is also showing a steady increase in Korea, so it is becoming more important to check the mutations causing clarithromycin resistance before treatment. .

Currently, the culture test and PCR test are used for the diagnosis of clarithromycin resistance, but the culture test is highly accurate, but the culture conditions are difficult and it takes a long time to confirm the result.The PCR test has the possibility of contamination due to further manipulation after the reaction. It is a situation that has a limit of existence.

On the other hand, Japanese Patent No. 2011-062143 describes a method for amplifying the 23S rRNA gene of Helicobacter pylori and determining whether or not pylori is resistant to clarythromycin using a detection probe, but the mutation to be detected There is a disadvantage in that each probe must be used differently.

The real-time PCR test method using PNA as a probe is used to detect various types of mutations such as base deletion, insertion, and single base mutation. This is based on the biological stability of PNA and its excellent recognition ability and binding power for target DNA. In particular, the melting curve analysis method using a PNA probe has the advantage that it is possible to easily determine whether a base is mutated through a difference in Tm value.

Accordingly, the present inventors made diligent efforts to develop a method for determining the genotype of Helicobacter pylori with high speed and accuracy. As a result, the 23s rRNA gene of Helicobacter pylori was amplified with a primer, and then hybridized with a gene mutation-specific probe to analyze the melting curve. If so, it was confirmed that the genotype of Helicobacter pylori can be quickly and accurately determined, and the present invention was completed.

It is an object of the present invention to provide a probe and primer pair capable of discriminating the genotype of Helicobacter pylori.

Another object of the present invention is to provide a Helicobacter pylori genotyping method using the probe and primer pair.

To achieve the above object, the present invention provides a Helicobacter pylori (Helicobacter pylori) genotype determination PNA probe containing any one of the sequences selected from the group consisting of SEQ ID NO: 13 to SEQ ID NO: 22.

The present invention also includes a base sequence of SEQ ID NO: 1 as a forward primer and SEQ ID NO: 3 as a reverse primer; The base sequence of SEQ ID NO: 2 as a forward primer and SEQ ID NO: 3 as a reverse primer; The nucleotide sequence of SEQ ID NO: 4 as a forward primer and SEQ ID NO: 5 as a reverse primer; The nucleotide sequence of SEQ ID NO: 4 as a forward primer and SEQ ID NO: 6 as a reverse primer; And a nucleotide sequence of SEQ ID NO: 7, as a forward primer, and SEQ ID NO: 8 as a reverse primer; And it provides a Helicobacter pylori ( Helicobacter pylori ) gene amplification primer pair selected from the group consisting of the nucleotide sequence of SEQ ID NO: 9 as a forward primer and SEQ ID NO: 10 as a reverse primer.

The present invention also provides said PNA probe and primer pair Helicobacter pylori (Helicobacter pylori) genotype to determine the composition and Helicobacter pylori (Helicobacter pylori) genotype determination kit for containing the same comprising a.

The present invention also includes the steps of: a) extracting gDNA from the specimen; b) amplifying the Helicobacter pylori 23s rRNA gene using the primer pair, and hybridizing the amplified product with the PNA probe; And c) analyzing the melting curve of the reactant hybridized in step b) to determine the genotype of the gene. It provides a method for determining a genotype of Helicobacter pylori comprising.

The PNA probe according to the present invention can confirm and discriminate the presence or absence of a mutation that is difficult to confirm or has been difficult to verify by clearing the difference in Tm value between two mutations that did not show a difference in Tm value. If present, it is possible to diagnose the point mutations causing clarithromycin resistance of Helicobacter pylori, which was difficult to distinguish between Tm values, so that the previously performed Helicobacter pylori detection test and clarithromycin resistance test, respectively, have high sensitivity and high accuracy in a short time. By enabling simultaneous analysis, suitable antibacterial therapy can be applied quickly.

FIG. 1 shows a vector map and sequence of a target substance (SEQ ID NOs: 24 to 27) simulating a Helicobacter pylori wild type, A2142G and A2143G mutations, and internal controls according to an embodiment of the present invention.
2 is a schematic diagram showing real-time PCR reaction conditions according to the present invention.
3 is an analysis result by a combination of three target substances (SEQ ID NOs: 24 to 26) as a template, primers of SEQ ID NOs: 1 and 3 and one probe selected from SEQ ID NOs: 13 to 14.
4 is an analysis result of the combination of the primers of SEQ ID NOs: 2 and 3 and the probe of SEQ ID NO: 15 using three target substances (SEQ ID NOs: 24 to 26) as a template.
5 is an analysis result of one primer pair selected from SEQ ID NOs: 4 to 10 and one probe combination selected from SEQ ID NOs: 16 to 22 using three target substances (SEQ ID NOs: 24 to 26) as templates.
6 is an analysis result of the combination of primers of SEQ ID NOs: 9 and 10 and probes of SEQ ID NO: 22 using three target substances (SEQ ID NOs: 24 to 26) as a template.
7 is a schematic diagram of a method of analyzing wild-type and point mutations of Helicobacter pylori with high sensitivity using a PNA probe.
8 shows the detection result of the Helicobacter pylori kit, where A is the wild type detection result; B is the detection result of point mutation A2142G; C is the point mutation A2143G detection result; D is the result of simultaneous detection of wild type and A2142G; E is the result of simultaneous detection of wild type and A2143G; And F shows the result of not detecting Helicobacter pylori.
9 is a test result of cross-reaction confirmation of the specificity of the Helicobacter pylori diagnostic kit according to an embodiment of the present invention.
10 is a result of confirming the Limit of Detection (LOD) of the Helicobacter pylori diagnostic kit according to an embodiment of the present invention.
11 is a result of confirming the performance of the Helicobacter pylori diagnostic kit according to an embodiment of the present invention in clinical samples 1 to 4.
12 is a result of confirming the performance of the Helicobacter pylori diagnostic kit according to an embodiment of the present invention in clinical samples 5 to 7.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

The term "probe" of the present invention refers to a nucleic acid fragment such as RNA or DNA corresponding to a short number of bases to hundreds of bases capable of specific binding to a gene or mRNA, and an oligonucleotide probe, It may be produced in the form of a single stranded DNA (single stranded DNA) probe, a double stranded DNA (double stranded DNA) probe, an RNA probe, or the like, and may be labeled for easier detection, but is not particularly limited thereto.

The term "hybridization" of the present invention means that complementary single-stranded nucleic acids form double-stranded nucleic acids. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect match or even in the presence of some mismatch bases. The degree of complementarity required for hybridization may vary according to hybridization conditions, and in particular, may be controlled by temperature.

In the present invention, a target nucleic acid refers to a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.

In the present invention, it was intended to develop a fast and accurate method for genotyping of Helicobacter pylori .

In the present invention, when the genotype of the 23s rRNA gene, which is known to be deeply related to antibiotic resistance of Helicobacter pylori, is detected with a PNA probe, it was to be confirmed that the genotype can be determined only by analyzing the melting curve without going through a complicated process.

That is, in an embodiment of the present invention, when designing a PNA probe that specifically binds each of the wild-type, A2142G and A2143G SNPs of the Helicobacter pylori 23s rRNA gene, and analyzing the melting curve using this, the melting curve without additional analysis work It was confirmed that the genotype of the gene can be determined only by the analysis of (Fig. 5).

Therefore, the present invention relates to a PNA probe for genotyping of Helicobacter pylori comprising any one sequence selected from SEQ ID NO: 13 to SEQ ID NO: 22.

PNA (Peptide Nucleic Acid) is one of the gene recognition substances, such as LNA (Locked Nucleic Acid) and MNA (Mopholino nucleic acid), artificially synthesized and the basic skeleton is composed of polyamide. PNA has excellent affinity and selectivity, and has high stability against nucleases, so it is not degraded by the existing restriction enzymes. In addition, it has the advantage of easy storage and not easily decomposed due to its high thermal/chemical properties and stability. In addition, the PNA-DNA binding power is very superior to the DNA-DNA binding power, and the melting temperature (Tm) differs by about 10 to 15°C even for one nucleotide mismatch. Using this difference in binding force, it is possible to detect changes in single nucleotide polymorphism (SNP) and insertion/deletion (InDel) nucleic acids.

The Tm value also changes according to the difference between the nucleic acid of the PNA probe and the DNA complementarily bound thereto, making it easy to develop an application technology using this. The PNA probe is analyzed by using a hybridization reaction different from the hydrolysis reaction of the TaqMan probe, and probes that play a similar role include a molecular beacon probe and a scorpion probe.

Fluorescence Melting Curve Analysis (FMCA) is used to analyze the hybridization reaction, and the fluorescence melting curve analysis is performed by dividing the difference in binding strength between the product generated after the PCR reaction and the input probe by the melting temperature. . Unlike other SNP detection probes, the probe design is very simple, so it is manufactured using a nucleotide sequence of 11-18 mer containing SNP. Therefore, in order to design a probe having a desired melting temperature, the Tm value can be adjusted according to the length of the PNA probe, and the Tm value can be adjusted by changing the probe even with a PNA probe of the same length. Since PNA has better binding power than DNA and has a high basic Tm value, it is possible to design with a shorter length than DNA, so that even close neighboring SNPs can be detected. Existing HRM method has a very small Tm difference of about 0.5°C, requiring additional analysis programs or detailed temperature changes, making it difficult to analyze when two or more SNPs appear, whereas PNA probes affect SNPs other than the probe sequence. Fast and accurate analysis is possible because it is not received

In the present invention, the PNA probe is not limited, but hybridization with any one or more genes selected from the group consisting of 23s rRNA gene wild type, A2142G mutant, and A2143G mutant may be characterized.

In the present invention, the PNA probe is not limited, but a reporter or quencher may be combined. The PNA probe containing the reporter and quencher of the present invention generates a fluorescence signal after hybridization with the target nucleic acid, and as the temperature rises, the fluorescence signal is quenched by rapidly melting with the target nucleic acid at the appropriate melting temperature of the probe. The presence or absence of a target nucleic acid can be detected through high-resolution melting curve analysis obtained from the fluorescence signal according to

In the present invention, the "PNA probe" shows an expected melting temperature (Tm) value by preferentially binding to the target nucleic acid when the target nucleic acid is present, and binding to the internal control when the target nucleic acid is present and lower than the expected melting temperature It can be characterized by showing a (Tm) value, and can distinguish false positive and false negative signals by using the difference between the internal control and the target nucleic acid melting curve. The PNA probe is analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe, and probes that play a similar role include a molecular beacon probe and a Scorpion probe. There is a scorpion probe.

In the probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence may be combined at both ends, and may include an intercalating fluorescent material. The reporter may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), HEX, Texas red, JOE, TAMRA, CY5, CY3, Alexa680, and the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, It is preferable to use BHQ2 or Dabcyl, but is not limited thereto. The intercalating fluorescent material is acridine homodimer and derivatives thereof, acridine orange and derivatives thereof, 7-aminoactinomycin D (7-AAD) and Derivatives thereof, Actinomycin D (Actinomycin D) and derivatives thereof, ACMA (9-amino-6-chloro-2-methoxyacridine) and derivatives thereof, DAPI and derivatives thereof, dihydroethidium (Dihydroethidium) and derivatives thereof, ethidium bromide and derivatives thereof, ethidium homodimer-1 (EthD-1) and derivatives thereof, ethidium homodimer-2 (EthD-2) and derivatives thereof, ethidium Monoazide (Ethidium monoazide) and derivatives thereof, Hexidium iodide and derivatives thereof, bisbenzimide (Hoechst 33258) and derivatives thereof, Hoechst 33342 (Hoechst 33342) and derivatives thereof, No. Hoechst 34580 (Hoechst 34580) and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 (LDS 751) and derivatives thereof, Propidium Iodide (PI) and derivatives thereof and between It may be selected from the group consisting of Cy-dyes derivatives.

In the present invention, the PNA probe is characterized in that the melting temperature with the target gene is 56 to 72°C when the wild type is, 48 to 68°C when the A2142G variant, and 56 to 77°C when the A2143G variant is However, it is not limited thereto.

In another aspect of the present invention, SEQ ID NO: 1, the nucleotide sequence of SEQ ID NO: 3 as a reverse primer; The base sequence of SEQ ID NO: 2 as a forward primer and SEQ ID NO: 3 as a reverse primer; The nucleotide sequence of SEQ ID NO: 4 as a forward primer and SEQ ID NO: 5 as a reverse primer; SEQ ID NO: 4 as a forward primer and a nucleotide sequence of SEQ ID NO: 6 as a reverse primer; SEQ ID NO: 7, as a forward primer, the base sequence of SEQ ID NO: 8 as a reverse primer; And it relates to a Helicobacter pylori 23s rRNA gene amplification primer pair selected from the group consisting of the nucleotide sequence of SEQ ID NO: 9 as a forward primer and SEQ ID NO: 10 as a reverse primer.

In another aspect, the present invention relates to a composition for determining the genotype of Helicobacter pylori comprising the PNA probe and the primer pair.

In the present invention, the composition is an internal control material; A pair of primers of SEQ ID NOs: 11 and 12 for detecting this; And it may be characterized in that it further comprises a PNA probe of SEQ ID NO: 23, but is not limited thereto.

In the present invention, the internal control material may be used without limitation as long as it is a gene capable of determining the success or absence of real-time PCR regardless of the presence or absence of Helicobacter pylori, but preferably, when the plant species symbidium It may be characterized in that it is a 158 bp site between the gene psbA and trnH of Cymbidium sinense .

In another aspect, the present invention relates to a kit for determining the genotype of Helicobacter pylori comprising the composition.

In the present invention, the kit may further include DNA synthase, dNTPs, buffer, etc., and may further include a user's manual describing optimal reaction conditions.

In another aspect of the present invention, a) extracting gDNA from a sample sample; b) amplifying the Helicobacter pylori 23s rRNA gene using the primer pair, and hybridizing the amplified product with the PNA probe; And c) analyzing the melting curve of the reactants hybridized in step b) to determine the genotype of the gene. It relates to a method for determining genotype of Helicobacter pylori .

In the present invention, the specimen is a DNA or RNA molecule, and the molecule may be a double-stranded or single-stranded form. When the nucleic acid as an initial material is double-stranded, it is preferable to make the two strands single-stranded or partially single-stranded. Methods known to separate strands include, but are not limited to, heat, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg, helicase action), and binding proteins. For example, strand separation may be achieved by heat treatment at a temperature of 80 to 105°C.

In the present invention, the mutant of the gene is not limited, but may be A2142G or A2143G.

In the present invention, the sample sample is not limited, but may be a DNA sample derived from human tissue, hair, oral epithelial cells, sputum, blood, saliva, or urine.

In the present invention, the'sample sample' includes various samples, and preferably, a bio-sample is analyzed using the method of the present invention. Biosamples of plant, animal, human, fungal, bacterial and viral origin can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissue include connective, skin, muscle or nervous tissue. Representative examples of organs include eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testicle, ovary, uterus, rectum, nervous system, Includes glandular and internal blood vessels. The biological sample to be analyzed includes any cells, tissues, fluids from biological sources, or any other medium that can be well analyzed by the present invention, which is human, animal, human or animal consumption. Samples obtained from food prepared for use are included. In addition, biological samples to be analyzed include bodily fluid samples, which include blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extract (e.g., brain crush), spinal fluid, appendix, spleen. And tonsil tissue extracts are included, but are not limited thereto.

In the present invention, the melting curve analysis method is not limited thereto, but may be characterized in that it is performed by a fluorescence melting curve analysis (FMCA) method.

In the present invention, step b) may be characterized in that it further includes an internal control material.

In the present invention, the internal control material may be used without limitation as long as it is a gene capable of determining the success or absence of real-time PCR regardless of the presence or absence of Helicobacter pylori, but preferably, when the plant species symbidium It may be characterized in that it is a 158 bp site between the gene psbA and trnH of Cymbidium sinense .

In the present invention, the internal control material may be amplified with a primer represented by the nucleotide sequence of SEQ ID NO: 11 and 12, and may be detected with a probe of SEQ ID NO: 23, but is not limited thereto.

The melting curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed of a target DNA or RNA and a probe. Since such a method is performed by, for example, Tm analysis or analysis of the melting curve of the double chain, it is called a melting curve analysis. After forming a hybrid (double-stranded DNA) between the target single-stranded DNA of the detection sample and the probe using a probe complementary to the detection target sequence containing the mutation for detection, the hybrid-formed body is subjected to heat treatment. A method of determining the presence or absence of a point mutation by performing and detecting the dissociation (fusion) of the hybrid according to the temperature increase by fluctuations in signals such as absorbance, and then determining the Tm value based on the detection result. to be.

The Tm value is higher as the homology of the hybrid formed body is higher and lower as the homology is lower. For this reason, a Tm value (evaluation reference value) is obtained in advance for a hybrid formed body of a detection target sequence containing a point mutation and a probe complementary thereto, and the Tm value (measurement) between the target single-stranded DNA of the detection sample and the probe (measurement Value), and if the measured value is the same as the evaluation reference value, it can be determined that a match, that is, a mutation exists in the target DNA, and if the measured value is lower than the evaluation reference value, a mismatch, that is, a mutation in the target DNA. It can be determined that it does not exist.

The fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent material, and more specifically, the melting curve may be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In the present invention, the amplification is not limited, but may be performed by a real-time PCR method.

In the real-time PCR method of the present invention, a fluorescent substance is interchelated to a double-stranded DNA chain in the PCR process, and the temperature is raised to release the double-stranded DNA by amplifying the PCR product. By analyzing the pattern of the melting curve at which the amount of the fluorescent substance present in is decreased, in particular, the temperature at which DNA is melted (denatured) (Tm), the presence or absence of a nucleotide sequence variation between the normal control and the mutant can be analyzed.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are only intended to aid understanding of the present invention, and the scope of the present invention is not limited to these examples in any sense.

Example 1: Preparation of target material

Three types of target substances (SEQ ID NOs: 24 to 26) were synthesized to simulate the case of different nucleotide sequence mutations within the same range of nucleotide sequences [Cosmo Genetech Co., Ltd.] The nucleotide sequence of each synthetic substance is shown below. As shown in Table 1, the vector map is disclosed in FIG. 1.

Target nucleic acid sequence information Target
Nucleic acid order
number Sequence information Helicobacter pylori wild type 24 TCCTTGTCGGTTAAATACCGACCTGCATGAATGGCGTAACGAGATGGGAGCTGTCTCAACCAGAGATTCAGTGAAATTGTAGTGGAGGTGAAAATTCCTCCTACCCGCGGCAAGACGGAAAGACCCCGTGGACCTTTACTACAACTTAGCACTGCTAATGGGAATATCATGCGCAGGATAGGTGGGAGGCTTTGAAGTAAGGGCTTTGGCTCTTATGGAGCCATCCTTGAGATACCACCCTTGATGTTTCTGTTAGCTAACTGGCCTGTGTTATCCACAGGCAGGACAATGCTTGGTGGG Helicobacter pylori A2142G 25 TCCTTGTCGGTTAAATACCGACCTGCATGAATGGCGTAACGAGATGGGAGCTGTCTCAACCAGAGATTCAGTGAAATTGTAGTGGAGGTGAAAATTCCTCCTACCCGCGGCAAGACGGGAAGACCCCGTGGACCTTTACTACAACTTAGCACTGCTAATGGGAATATCATGCGCAGGATAGGTGGGAGGCTTTGAAGTAAGGGCTTTGGCTCTTATGGAGCCATCCTTGAGATACCACCCTTGATGTTTCTGTTAGCTAACTGGCCTGTGTTATCCACAGGCAGGACAATGCTTGGTGGG Ter pylori A2143G 26 TCCTTGTCGGTTAAATACCGACCTGCATGAATGGCGTAACGAGATGGGAGCTGTCTCAACCAGAGATTCAGTGAAATTGTAGTGGAGGTGAAAATTCCTCCTACCCGCGGCAAGACGGAGAGACCCCGTGGACCTTTACTACAACTTAGCACTGCTAATGGGAATATCATGCGCAGGATAGGTGGGAGGCTTTGAAGTAAGGGCTTTGGCTCTTATGGAGCCATCCTTGAGATACCACCCTTGATGTTTCTGTTAGCTAACTGGCCTGTGTTATCCACAGGCAGGACAATGCTTGGTGGG

Example 2: Preparation of primers for amplifying target substances

Primers of SEQ ID NOs: 1 to 12 were prepared for real-time polymerase chain reaction (real-time PCR) for the target nucleic acid (Cosmo Genetech Co., Ltd.), and sequence information is shown in Table 2 below.

Primer sequence information Sequence number Sequence (5'-3') SEQ ID NO: 1 AGCCCTTACTTCAAAGCCTCCC SEQ ID NO: 2 ATGGCTCCATAAGAGCCAAAGC SEQ ID NO: 3 TGTCTCAACCAGAGATTCAGTG SEQ ID NO: 4 GGGTGGTATCTCAAGGATGGCTCC SEQ ID NO: 5 TCAGTGAAATTGTAGTGGAGGTGA SEQ ID NO: 6 GTGAAAATTCCTCCTACCCGCGG SEQ ID NO: 7 CAAGGGTGGTATCTCAAGGATGGC SEQ ID NO: 8 AGTGGAGGTGAAAATTCCTCCTA SEQ ID NO: 9 TAAGAGCCAAAGCCCTTACTTCA SEQ ID NO: 10 CGAGATGGGAGCTGTCTCAACCAGA SEQ ID NO: 11 AAGATATTGGGGGATTGCTATCT SEQ ID NO: 12 TCATAAGACTTAGACTTTTCTGAC

Example 3: Fluorescent PNA Probe Fabrication

A PNA probe was prepared for specific amplification and analysis of the melting temperature of the target material (Panagene Co., Ltd.), and fluorescence and quenching were combined at both ends of the probe sequence for analysis of the melting temperature (Table 3).

Probe sequence information Sequence number order Neon SEQ ID NO: 13 Dabcyl-AAGACGGAAAGACCCCG-O-K FAM SEQ ID NO: 14 Dabcyl-CGGGGTCTTTCCGTCTTG-O-K FAM SEQ ID NO: 15 Dabcyl-AAGACGGGAAGACCC C-O-K FAM SEQ ID NO: 16 Dabcyl-CGGAGAGACC-O-K FAM SEQ ID NO: 17 Dabcyl-GACGGAGAGACCC-O-K FAM SEQ ID NO: 18 Dabcyl-AAGACGGAGAGACCCC-O-K FAM SEQ ID NO: 19 Dabcyl-GGGTCTTTCCGTC-O-K FAM SEQ ID NO: 20 Dabcyl-GGGTCTCTCCGTC-O-K FAM SEQ ID NO: 21 Dabcyl-GACGGAAAGACCCC G-O-K FAM SEQ ID NO: 22 Dabcyl-GGTCTCTCCG-O-K FAM SEQ ID NO: 23 Dabcyl-ATCCGAATTCTCGTT C-O-K Cy5 * In Table 3, O- means linker and K means lysine.

Example 4: Verification using target material

4-1. First verification

CFX96™ Real-Time after mixing the three types of target substances synthesized in Example 1 (SEQ ID NOs: 24 to 26) with a primer pair of SEQ ID NOs: 1 and 3 and one PNA probe selected from SEQ ID NOs: 13 to 14 After performing PCR using the system (BIO-RAD, USA), the dissolution curve was analyzed. PCR was performed using asymmetric PCR to generate single-stranded target nucleic acids, and the PCR reaction solution was 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio, Korea), 2.5mM MgCl2 , 200μM dNTPs, 1.0U Taq polymerase, 0.05μM forward primer and 0.5μM reverse primer, 1 μl target material DNA, and 0.5 μM fluorescent PNA probe were mixed, and the final volume was adjusted to 20 μl with DW, followed by real-time PCR (Table 3) was carried out to perform amplification and melting curve analysis.

As a result, as shown in FIG. 3, the Tm value of the Helicobacter pylori wild type was 72°C, the Tm value of the mutant A2142G was 55°C, and the Tm value of the A2143G was 56°C, and the Tm difference between the wild type and the mutant was confirmed.

4-2. Second verification

In order to increase the Tm value difference between the two mutants A2142G and A2143G, the primers of SEQ ID NOs: 2 and 3 and the probe of SEQ ID NO: 15 were mixed, followed by a real-time polymerase reaction, and the reaction conditions are as follows; The PCR reaction solution is 1 in 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, SeaSun Bio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.06μM forward primer and 0.4μM reverse primer. After mixing µl target material DNA and 0.5µl fluorescent PNA probe and adjusting the final volume to 20µl with DW, real-time PCR (Table 3) was performed to perform amplification and melting curve analysis.

As a result, as disclosed in FIG. 4, the Tm value of the wild type of Helicobacter pylori was 59°C, the Tm value of the mutant A2142G was 68°C, and the Tm value of A2143G was 60°C, and it was confirmed that a significant difference appears in the Tm value between the two mutations. .

4-3. Third verification

Real-time polymerization after mixing one primer pair selected from SEQ ID NOs: 4 to 10 and one probe selected from SEQ ID NOs: 16 to 22 in order to clarify the distinction between the wild type and the two mutations to increase the Tm value difference between the wild type and the mutant The enzyme reaction was carried out, and the reaction conditions are as follows; PCR reaction solution is 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, SeaSunBio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.03μM forward primer and 0.4μM reverse primer. After mixing µl target material DNA and 0.5µl fluorescent PNA probe and adjusting the final volume to 20µl with DW, real-time PCR (Table 3) was performed to perform amplification and melting curve analysis.

The combinations of primers and probes used in each experiment are as follows:

Primer 4 (SEQ ID NO: 4) + Primer 5 (SEQ ID NO: 5) + SEQ ID NO: 16

Primer 4 (SEQ ID NO: 4) + Primer 5 (SEQ ID NO: 5) + SEQ ID NO: 17

Primer 4 (SEQ ID NO: 4) + Primer 5 (SEQ ID NO: 5) + SEQ ID NO: 18

Primer 4 (SEQ ID NO: 4) + Primer 6 (SEQ ID NO: 6) + SEQ ID NO: 19

Primer 4 (SEQ ID NO: 4) + Primer 6 (SEQ ID NO: 6) + SEQ ID NO: 20

Primer 7 (SEQ ID NO: 7) + Primer 8 (SEQ ID NO: 8) + SEQ ID NO: 21

Primer 9 (SEQ ID NO: 9) + Primer 10 (SEQ ID NO: 10) + SEQ ID NO: 22

The last sequence number in the combination refers to the probe used.

As a result, it was confirmed that there was a difference in Tm values of Helicobacter pylori wild type and mutants A2142G and A2143G as disclosed in FIG. 5.

4-4. Fourth verification

In order to clarify whether the wild type and the two mutations coexist, real-time polymerase reaction was carried out by mixing the primers of SEQ ID NOs: 9 and 10 and the probe of SEQ ID NO: 22 in order to increase the Tm value difference between the wild type and the mutant. Same as; PCR reaction solution is 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, SeaSunBio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.03μM forward primer and 0.4μM reverse primer. After mixing µl target material DNA and 0.5µl fluorescent PNA probe and adjusting the final volume to 20µl with DW, real-time PCR (Table 3) was performed to perform amplification and melting curve analysis.

As a result, as disclosed in FIG. 6, it was confirmed that not only the Helicobacter pylori wild type and the mutants A2142G and A2143G are clearly distinguished by the Tm difference, but also both Tm values can be detected even when the wild type and the mutant exist at the same time.

Example 5: Verification of Helicobacter pylori diagnostic kit including internal control material

In order to introduce an internal control material (IPC, Internal Positive Control) in the Helicobacter pylori diagnostic kit, a PCR reaction independent of Helicobacter pylori detection by using the 158 bp site between the gene psbA and trnH of the plant species Cymbidium sinense as a target nucleic acid Was confirmed to be normal. The synthetic sequence and size of the internal control material are shown in Table 4 below.

Internal control material sequence information Target
Nucleic acid order
number Sequence information Internal control
matter 27 AAGATATTGGGGGATTGCTATCTTGTTGGGTTCAGGTGCTTTTTGCTTCTCTATCCGAATTCTCGTTCTTTATCATAAAAGTTCTCCCCCGCCAATGAATGATAAGTGCCTAGGTGAAGCATAGTATAAGATAAGTCAGAAAAGTCTAAGTCTTATGA

For the detection of the internal control material, a primer pair of SEQ ID NOs: 11 and 12 and a probe of SEQ ID NO: 23 were used, and a real-time polymerase reaction was performed by mixing with a primer pair and a probe for detecting a wild type and mutation of Helicobacter pylori, and reaction conditions Is as follows; PCR reaction solution is 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, SeaSunBio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.05μM forward primer (Table 2) And 0.5 μM reverse primer (Table 2), each 1 μl of target material DNA, and 0.5 μl fluorescent PNA probe were mixed, and the final volume was adjusted to 20 μl with DW, followed by real-time PCR (Table 3). Amplification and melting curve analysis were performed.

As a result, as disclosed in FIG. 8, in the case of a heterozygote in which the wild-type and point mutations exist at 67°C, mutant A2142G is 58°C, and mutant A2143G is 77°C, each melting temperature appears at the same time and Helicobacter pylori is present. If not, it was confirmed that only the melting temperature (59℃) of the internal control material appeared.

Example 6: Confirmation of specificity of Helicobacter pylori diagnostic kit through cross-reaction confirmation

To confirm the specificity of the Helicobacter pylori diagnostic kit, as disclosed in Table 5, DW was used as the NTC, and primers and PNAs prepared as in Examples 2 and 3 for 13 kinds of bacteria as other non-specific materials PCR was performed in a CFX96™ Real-Time system (BIO-RAD, USA) using a probe. The PCR reaction was performed so that the total volume was 20 μl, 2X SisunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, Sisunbio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.03μM forward primer and 0.4 After mixing 1 μl target material DNA and 0.5 μl fluorescent PNA probe in μM reverse primer and adjusting the final volume to 20 μl with DW, real-time PCR (Table 3) was performed to perform amplification and melting curve analysis. Each experiment was repeated three times.

As a result, it was confirmed that the detection of Helicobacter pylori as disclosed in FIG. 9 was confirmed, whereas the PCR reaction did not appear in NTC conditions and 13 bacterial species.

Classification table of substances used for specificity (cross reaction) test H. pylori
wild type Bacterial species NTC Target substance
(SEQ ID NO: 24) Enterobacter cloacae
Mycobacterium asiaticum
Mycobacterium chelonae subsp. chelonae
Mycobacterium gordonae
Gordonia polyisoprenivorans
Mycobacterium massiliense
Mycobacterium neoaurum
Enterococcus faecalis
Mycobacterium paraseoulense
Escherichia coli
Veillonella dispar
Streptococcus mitis
Staphylococcus aureus DW

Example 7: Confirmation of the minimum detection limit of Helicobacter pylori detection kit

Primers prepared as in Examples 2 and 3 targeting three types of target substances (SEQ ID NOs: 24 to 26), Helicobacter pylori wild type, point mutant A2142G, and point mutant A2143G to confirm the detection limit of the Helicobacter pylori diagnostic kit. PCR was performed in a CFX96™ Real-Time system (BIO-RAD, USA) using and a PNA probe. Each target material was diluted from 1X10 ⁶ copies to 1X10 ¹ copies, and the PCR reaction was performed with 2X SeaSunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, Korea) to a total volume of 20µl. , 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.03μM forward primer and 0.4μM reverse primer, mix 1µl target material DNA, and 0.5µl fluorescent PNA probe, and adjust the final volume to 20µl with DW. Time PCR (Table 3) was performed to perform amplification and melting curve analysis. The experiment was repeated 3 times each.

As a result, it was confirmed that Helicobacter pylori detection is possible up to 10 copies as disclosed in FIG. 10.

Example 8: Verification of Helicobacter pylori diagnostic kit using clinical specimens

After extracting DNA from clinical tissue suspected of infection with Helicobacter pylori, targeting the DNA of clinical samples 1-7 in which wild-type and two point mutations were confirmed through sanger sequencing analysis, primer pairs of SEQ ID NOs: 9 and 10 and probes of SEQ ID NO: 22 PCR was performed in a CFX96™ Real-Time system (BIO-RAD, USA).

PCR conditions are 2X SisunBio Real-Time FMCA™ buffer (SeaSunBio Real-Time FMCA™ buffer, Sisunbio, Korea), 2.5mM MgCl2, 200μM dNTPs, 1.0U Taq polymerase, 0.03μM forward primer and 0.4 After mixing 1 μl target material DNA and 0.5 μl fluorescent PNA probe in μM reverse primer and adjusting the final volume to 20 μl with DW, real-time PCR (Table 3) was performed to perform amplification and melting curve analysis.

As a result, as disclosed in FIGS. 11 and 12, the melting temperatures of the wild type and two point mutations (A2142G and A2143G) of Helicobacter pylori were confirmed, which was confirmed to be consistent with the sanger sequencing results.

As described above, specific parts of the present invention have been described in detail, and it will be apparent to those of ordinary skill in the art that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> SeasunBio Materials <120> Pepetide nucleic acid probe for genotyping Helicobacter pylori and Method using the same <130> P19-B128 <160> 27 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 1 agcccttact tcaaagcctc cc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 2 atggctccat aagagccaaa gc 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 3 tgtctcaacc agagattcag tg 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 4 gggtggtatc tcaaggatgg ctcc 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer 5 <400> 5 tcagtgaaat tgtagtggag gtga 24 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer 6 <400> 6 gtgaaaattc ctcctacccg cgg 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer 7 <400> 7 caagggtggt atctcaagga tggc 24 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer 8 <400> 8 agtggaggtg aaaattcctc cta 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer 9 <400> 9 taagagccaa agcccttact tca 23 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 10 <400> 10 cgagatggga gctgtctcaa ccaga 25 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer 11 <400> 11 aagatattgg gggattgcta tct 23 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer 12 <400> 12 tcataagact tagacttttc tgac 24 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> probe 1 <400> 13 aagacggaaa gaccccg 17 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe 2 <400> 14 cggggtcttt ccgtcttg 18 <210> 15 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe 3 <400> 15 aagacgggaa gacccc 16 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> probe 4 <400> 16 cggagagacc 10 <210> 17 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> probe 5 <400> 17 gacggagaga ccc 13 <210> 18 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe 6 <400> 18 aagacggaga gacccc 16 <210> 19 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> probe 7 <400> 19 gggtctttcc gtc 13 <210> 20 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> probe 8 <400> 20 gggtctctcc gtc 13 <210> 21 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> probe 9 <400> 21 gacggaaaga ccccg 15 <210> 22 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> probe 10 <400> 22 ggtctctccg 10 <210> 23 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe 11 <400> 23 atccgaattc tcgttc 16 <210> 24 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> WT <400> 24 tccttgtcgg ttaaataccg acctgcatga atggcgtaac gagatgggag ctgtctcaac 60 cagagattca gtgaaattgt agtggaggtg aaaattcctc ctacccgcgg caagacggaa 120 agaccccgtg gacctttact acaacttagc actgctaatg ggaatatcat gcgcaggata 180 ggtgggaggc tttgaagtaa gggctttggc tcttatggag ccatccttga gataccaccc 240 ttgatgtttc tgttagctaa ctggcctgtg ttatccacag gcaggacaat gcttggtggg 300 300 <210> 25 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> A2142G <400> 25 tccttgtcgg ttaaataccg acctgcatga atggcgtaac gagatgggag ctgtctcaac 60 cagagattca gtgaaattgt agtggaggtg aaaattcctc ctacccgcgg caagacggga 120 agaccccgtg gacctttact acaacttagc actgctaatg ggaatatcat gcgcaggata 180 ggtgggaggc tttgaagtaa gggctttggc tcttatggag ccatccttga gataccaccc 240 ttgatgtttc tgttagctaa ctggcctgtg ttatccacag gcaggacaat gcttggtggg 300 300 <210> 26 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> A2143G <400> 26 tccttgtcgg ttaaataccg acctgcatga atggcgtaac gagatgggag ctgtctcaac 60 cagagattca gtgaaattgt agtggaggtg aaaattcctc ctacccgcgg caagacggag 120 agaccccgtg gacctttact acaacttagc actgctaatg ggaatatcat gcgcaggata 180 ggtgggaggc tttgaagtaa gggctttggc tcttatggag ccatccttga gataccaccc 240 ttgatgtttc tgttagctaa ctggcctgtg ttatccacag gcaggacaat gcttggtggg 300 300 <210> 27 <211> 158 <212> DNA <213> Artificial Sequence <220> <223> Internal Control <400> 27 aagatattgg gggattgcta tcttgttggg ttcaggtgct ttttgcttct ctatccgaat 60 tctcgttctt tatcataaaa gttctccccc gccaatgaat gataagtgcc taggtgaagc 120 atagtataag ataagtcaga aaagtctaag tcttatga 158

Claims (16)

Helicobacter pylori genotype identification PNA probe comprising any one sequence selected from the group consisting of SEQ ID NO: 13 to SEQ ID NO: 22
The method of claim 1, wherein the PNA probe hybridizes with any one or more genes selected from the group consisting of 23s rRNA gene wild type, A2142G mutant, and A2143G mutant. Helicobacter pylori genotype identification PNA Probe.
According to claim 1, wherein said PNA probe is Helicobacter pylori (Helicobacter pylori) genotype PNA probe for determining such a manner that self-coupled reporter and quencher.
The method of claim 1, wherein the PNA probe has a melting temperature with a target gene of 56°C to 72°C when the wild type is, 48°C to 68°C when the A2142 mutation, and 56°C to 77 when the A2143 mutation Helicobacter pylori ( Helicobacter pylori ) genotype identification PNA probe, characterized in that the ℃.
The method of claim 3, wherein the reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein) and Helicobacter pylori, characterized in that at least one selected from the group consisting of Cy5 ( Helicobacter pylori ) PNA probe for genotyping.
Claim for according to 3, wherein the predetermined photon (quencher) is TAMRA (6-carboxytetramethyl-rhodamine) , Helicobacter pylori (Helicobacter pylori), characterized in that at least one selected from the group consisting of BHQ1, BHQ2 and Dabcyl genotype determination PNA probe.
The nucleotide sequence of SEQ ID NO: 1 as a forward primer and SEQ ID NO: 3 as a reverse primer; The base sequence of SEQ ID NO: 2 as a forward primer and SEQ ID NO: 3 as a reverse primer; The nucleotide sequence of SEQ ID NO: 4 as a forward primer and SEQ ID NO: 5 as a reverse primer; The nucleotide sequence of SEQ ID NO: 4 as a forward primer and SEQ ID NO: 6 as a reverse primer; And a nucleotide sequence of SEQ ID NO: 7, as a forward primer, and SEQ ID NO: 8 as a reverse primer; And SEQ ID NO: 9 as a forward primer, Helicobacter pylori (Helicobacter pylori) a pair of primers for gene amplification is selected from the group consisting of the nucleotide sequence of SEQ ID NO: 10 as a reverse primer (primer pair).
A composition for determining the genotype of Helicobacter pylori comprising the PNA probe of claim 1 and the primer pair of claim 7.
The method of claim 8, wherein the composition comprises an internal control material; A pair of primers of SEQ ID NOs: 11 and 12 for detecting this; And Helicobacter pylori ( Helicobacter pylori ) genotype determination composition, characterized in that it further comprises a PNA probe of SEQ ID NO: 23.
Helicobacter pylori comprising the composition of claim 9 ( Helicobacter pylori ) genotype determination kit.
a) extracting genomic DNA from the specimen;
b) amplifying the Helicobacter pylori 23s rRNA gene using the primer pair of claim 7, and hybridizing the amplified product with the PNA probe of claim 1; And
c) analyzing the melting curve of the reactants hybridized in step b) to determine the genotype of the gene;
Helicobacter pylori comprising a ( Helicobacter pylori ) genotype determination method.
The method of claim 11, wherein the specimen is a DNA sample derived from tissue, hair, sputum, blood, saliva, or urine.
12. The method of claim 11, wherein step b) further comprises an internal control material.
The method of claim 13, wherein the internal control material is amplified by a pair of primers represented by the nucleotide sequences of SEQ ID NOs: 11 and 12, and is detected with a probe of SEQ ID NO: 23.
The detection method according to claim 11, wherein the melting curve analysis is performed by a fluorescence melting curve analysis (FMCA) method.
The method of claim 11, wherein the amplification is performed by a real-time PCR method. It includes any one sequence selected from the group consisting of SEQ ID NOs: 13 to 22. PNA probe for genotyping of Helicobacter pylori

Images