KR20170037095A - Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same - Google Patents

Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same Download PDF

Info

Publication number
KR20170037095A
KR20170037095A KR1020150136204A KR20150136204A KR20170037095A KR 20170037095 A KR20170037095 A KR 20170037095A KR 1020150136204 A KR1020150136204 A KR 1020150136204A KR 20150136204 A KR20150136204 A KR 20150136204A KR 20170037095 A KR20170037095 A KR 20170037095A
Authority
KR
South Korea
Prior art keywords
seq
target nucleic
nucleic acid
pna probe
base
Prior art date
Application number
KR1020150136204A
Other languages
Korean (ko)
Inventor
이한우
유미진
허덕회
박희경
조군호
Original Assignee
주식회사 시선바이오머티리얼스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 시선바이오머티리얼스 filed Critical 주식회사 시선바이오머티리얼스
Priority to KR1020150136204A priority Critical patent/KR20170037095A/en
Publication of KR20170037095A publication Critical patent/KR20170037095A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/107—Modifications characterised by incorporating a peptide nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/107—Temperature of melting, i.e. Tm
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method of analyzing a melting curve using a PNA probe for diagnosing brownish subarachnoid instability, a method for diagnosing a brownish anomaly instability using the same, and a kit for diagnosing brownish anxiety instability, more particularly, A method of analyzing a melting curve according to the structure of a fluorescent PNA probe that specifically binds according to the number of base mutations deleted using a fluorescent PNA probe capable of specifically binding to the site The present invention relates to a diagnostic method capable of promptly and accurately discriminating the micro-organism instability by detecting the gene mutation of the microsatellite markers generated by base deletion at the repeated sites of the base and analyzing the number of base mutations.
The present invention relates to a diagnostic method and a kit for diagnosing microsatellite instability (MSI) according to analysis of number of deletion base mutations by a melting curve analysis using a PNA probe combined with a reporter and a quencher Based on the statistical database, the sensitivity and specificity of the five brown spot markers of Quasi loci were used to determine the genetic variation of the chromosomal marker caused by the base deletion of the same base repeat And the number of base mutations can be analyzed. Therefore, it is possible to reduce the cost of medical treatment compared to the conventional MSI diagnosis method, and it is advantageous to learn from the viewpoint that the test result is short and the test result is quick.

Description

Technical Field [0001] The present invention relates to a method of analyzing a melting curve using a PNA probe for diagnosing a brownish subarachnoid instability, a method for diagnosing a brownish anomalous instability and a kit for diagnosing a brownish anxiety instability, and Method and Kit of Microsatellite Instability Diagnosis Using the Same}

The present invention relates to a method of analyzing a melting curve using a PNA probe for diagnosing brownish subarachnoid instability, a method for diagnosing a brownish anomaly instability using the same, and a kit for diagnosing brownish anxiety instability, more particularly, A method of analyzing a melting curve according to the structure of a fluorescent PNA probe that specifically binds according to the number of base mutations deleted using a fluorescent PNA probe capable of specifically binding to the site The present invention relates to a diagnostic method capable of promptly and accurately discriminating the micro-organism instability by detecting the gene mutation of the microsatellite markers generated by base deletion at the repeated sites of the base and analyzing the number of base mutations.

Microsatellite refers to a form in which six or less short DNA sequences are repeatedly arranged in sequence throughout the body of a human body, which are scattered on each chromosome with a different number of repeats.

Microsatellite instability (MSI) is a variation of the length of a short repeated tandem repeat sequence that increases or decreases in a brownish submucosa. This is a mismatch repair gene. It is known that MMR gene mutation (germline mutation) or replication error caused by promoter methylation causes a change in length and inactivates the gene, thereby increasing the incidence of specific tumors. These MSIs were first found in patients with hereditary nonpolyposis colorectal cancer (HNPCC) syndrome. About 90% of patients with hereditary nonpolyposis colorectal cancer are reported to have this MSI and are found in a variety of other tumors In particular, MSI (+) is expressed in more than 75% of cases in endometrial cancer, which is most frequently associated with hereditary pulmonary fibrosarcoma syndrome, and sporadic colorectal cancer and sporadic endometrial cancer It was found that MSI (+) also exists in cancer. Especially in foreign countries, MSI (+) has been reported in sporadic endometrial cancer with a frequency of about 10-40%. Recently, 20-24% of sporadic endometrial carcinoma in Korea has also been reported.

According to international standards, MSIs are generally divided into two types: the National Cancer Institute (NCI), in 1997, five mononucleotides (mononucleotides) and three brown rice bundles (three dinucleotides) (BAT-25, BAT-26, D2S123, D17S250, and D5S346). When two or more markers were unstable, the high-level MSI (MSI-H) (40%) of the markers have been classified as low-level MSI (MSI-L) if they show instability only in one marker. In the case of less than 40% of the measured brownish submucosal markers, there is a case where the brownish-grayish submergence is stable. If the brownish- Stability (microsatellite stable, MSS) that was defined (Boland et al, Cancer Res, 58:.. 5248-57, 1998; gimdeokwoo, Journal of Genetic Medicine 7: 24-36 , 2010).

To date, DNA has been extracted from normal tissues and tumor tissues by the "Multiplex fluorescence PCR amplification and capillary electrophoresis" method for the diagnosis of MSI, followed by fluorescent marking polymerase The most widely known method is to amplify DNA through a chain reaction, and then to identify the sequence by detecting the fluorescence of the fluorescently labeled DNA by capillary electrophoresis. However, this requires an expensive capillary electrophoresis machine, which requires at least 7 days of inconvenience and two days of testing to be carried out after transferring the DNA to the capillary electrophoresis after amplification of the DNA by fluorescent labeling polymerase chain reaction, The sensitivity and specificity of the D2S123, D17S250, and D5S346 biomarkers, consisting of three of the five dinucleotide markers recommended by the US National Cancer Institute are BAT25 and BAT26 biosynthetically composed of two mononucleotides There is a limit of remarkable drop compared to the marker.

In recent years, BAT25, BAT26, D2S123, D17S250, and D5S346 have been used in the statistical database rather than the Bethesda loci (BAT25, BAT26, D5S346) (Bethesda et al. , 2002), and the use of the Bethesda loci in the MSI analysis (Buhard et al. , Disease Markers, 20: 251-7, 2004; Deschoolmeester et al. , J Mol Diagn . , 10: 154-159, 2008).

In recent years, PNA (Peptide Nucleic Acid) probes conjugated with a reporter and a quencher have been used to analyze a single base mutation of a target nucleic acid and a mutation caused by deletion or insertion of a base A technology capable of detecting is being spotlighted. PNA is more thermally and biologically stable than DNA, and has excellent recognition and binding ability to target DNA. Therefore, melting curve analysis using PNA probe can bind to target DNA faster and more strongly than DNA probe, Can be used to detect single nucleotide sequence mutations that are adjacent to each other. On the other hand, when the mutation due to deletion or insertion of a single base mutation and a base is compared with a normal target nucleic acid through a fusion curve analysis, There is a limit that can be done.

Under these technical backgrounds, the present inventors have found that the microsatellite instability (MSI) according to the analysis of the number of deletion base mutations by the melting curve analysis using a PNA probe combined with a reporter and a quencher As a result of intensive efforts to develop diagnostic methods and diagnostic kits, the number of deleted bases can be determined by solubility curve analysis based on the structure that specifically binds to base deletion of target nucleic acid using a reporter and a quencher-conjugated PNA probe Based on this method, the number of deleted base mutations and gene mutations in the selected Quasi-loci brown rice marker can be detected through database generated by base deletion of the same base repeated region And the present invention was completed.

An object of the present invention is to provide a method for detecting a mutation due to base deletion or insertion of a target nucleic acid, and a melting curve analysis method and a melting curve analysis using a PNA probe combined with a reporter and a quencher to confirm the genotype (Microsatellite instability (MSI) diagnosis method and kit for diagnosis.

In order to accomplish the above object, the present invention provides a PNA having a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 to which a reporter and a quencher are bound, The present invention provides a method of analyzing a melting curve for the diagnosis of microsatellite instability (MSI) by detecting a base mutation of a target nucleic acid using a peptide nucleic acid (peptide nucleic acid) probe.

(A) separating a target nucleic acid from a sample of a sample, and then subjecting the target nucleic acid to BAT-25, BAT-26, D2S123, D17S250 or D5S346, which is a brown color complementary marker contained in the target nucleic acid, , SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, a reporter and a quencher-conjugated PNA probe, SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, thereby hybridizing the PNA probe and the target nucleic acid; (b) melting the hybridized product while changing the temperature to obtain a melting curve; And (c) analyzing the obtained melting curve to detect the presence or absence of base mutations and the number of base mutations in the chromosome marker contained in the target nucleic acid, and detecting the base mutation of the target nucleic acid, instability, MSI) diagnostic method.

The present invention also relates to a PNA probe having a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 and comprising a reporter and a quencher; SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, and further comprising a primer for detecting microsatellite instability (MSI) according to the detection of a base mutation of a target nucleic acid using a melting curve analysis method Provide a kit.

The present invention relates to a diagnostic method and a kit for diagnosing microsatellite instability (MSI) according to analysis of number of deletion base mutations by a melting curve analysis using a PNA probe combined with a reporter and a quencher Based on the statistical database, the sensitivity and specificity of the five brown spot markers of Quasi loci were used to determine the genetic variation of the chromosomal marker caused by the base deletion of the same base repeat And the number of base mutations can be analyzed. Therefore, it is possible to reduce the cost of medical treatment compared to the conventional MSI diagnosis method, and it is advantageous to learn from the viewpoint that the test result is short and the test result is quick.

Brief Description of the Drawings Fig. 1 shows the sensitivity and specificity of the five brown rice somatic markers (BAT25, BAT26, NR21, NR24, and NR27) of quasi-loci used in the present invention and the simplicity of the microsatellite stability (MSS) and instability (MSI) Fig.
FIG. 2 is a schematic diagram showing that the fluorescent PNA probe according to the present invention specifically binds to a site where the same base of the target nucleic acid is repeated and a deleted base mutation site.
FIG. 3 is a schematic diagram for explaining a hybridization step and a step of obtaining a fusion curve in the method of discriminating the number of base mutations of a brownish-blue marker by using a fluorescent PNA probe according to the present invention.
Fig. 4 shows the results of the temperature change of the melting curve according to the number of base mutations deleted while the fluorescent PNA probe specifically binds from artificial synthetic DNA.
FIG. 5 is a schematic illustrating real-time PCR and specific binding reaction conditions for determining the number and type of deleted base mutations that determine the genotype of a brownish solid marker according to the present invention.
FIG. 6 is a schematic diagram of a single analysis and a multiple analysis capable of analyzing the number of defective base mutations and genotypes of a brown color marker in the example of the present invention. FIG.
FIG. 7 shows the results of analysis of the number and genotype of base mutations deleted by a single analysis method using MSI and MSS cell lines for BAT25, one of the five brown rice somatic markers of Quasi loci according to the present invention.
Figure 8 shows the results of analysis of the number and genotype of the base mutations deleted by a single analysis method using MSI and MSS cell lines for BAT26, one of the five brown rice somatic markers of Quasi loci according to the present invention.
FIG. 9 shows the results of analysis of the number and genotype of base mutations deleted by a single analysis method using MSI and MSS cell lines for NR21, one of the five brown rice somatic markers of Quasi loci according to the present invention.
FIG. 10 shows the results of analysis of the number and genotype of base mutations deleted by a single analysis method using MSI and MSS cell lines for NR24, one of the five brown rice somatic markers of Quasi loci according to the present invention.
Figure 11 shows the results of analysis of the number and genotype of base mutations deleted by a single analysis method using MSI and MSS cell lines for NR27, one of the five brown rice somatic markers of Quasi loci according to the present invention.
Figure 12 shows the number and genotype of the base mutations deleted by the multiplex assay using the MSI and MSS cell lines for the five brown rice somatic markers BAT25, BAT26, NR21, NR24, and NR27 of Quasi loci according to the present invention .

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present invention analyzes the number of deletion base mutations by melting curve analysis using a PNA (Peptide Nucleic Acid) probe coupled with a reporter and a quencher, and confirms the genotype of the mutation It provides a method for examining brownish instability (MSI).

In one embodiment of the present invention, an artificial synthetic oligo capable of analyzing the number of deletion base mutations by the melting curve analysis using the fluorescent PNA probe was prepared so that 2 to 14 bases could be deleted. Specifically, A fluorescent PNA probe was also prepared and screened so as to bind to the site of the base sequence (see FIG. 4).

The set of fluorescent PNAs for discrimination, which determine the number and genotype of deletion base mutations of the five brown rice somatic markers of Quasi loci according to the present invention, comprises two fluorescent PNAs, wherein said PNA comprises SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.

Accordingly, the present invention provides, in one aspect, a PNA (SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15) having a reporter and a quencher, The present invention relates to a method of analyzing a melting curve for the diagnosis of microsatellite instability (MSI) by detecting a base mutation of a target nucleic acid using a peptide nucleic acid probe.

The "base mutation" of the present invention is characterized by a mutation in the base sequence of the target nucleic acid, which includes not only a single nucleotide polymorphism (SNP) but also a nucleotide substitution, deletion or insertion, , Preferably the PNA probes of the invention can be analyzed by melting curve analysis in which 2 to 14 bases of the target nucleic acid have been deleted resulting in mutations.

In the present invention, the melting curve analysis may be performed by FMCA (Fluorescence Melting Curve Analysis) method, and the amplification may be performed using a Real-Time Polymerase Chain Reaction (PCR) . ≪ / RTI >

"Hybridization" of the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

The fluorescent peptide nucleic acid probe comprising the reporter and the quencher of the present invention hybridizes with the target nucleic acid and generates a fluorescence signal. As the temperature rises, the probe rapidly melts with the target nucleic acid at the optimal melting temperature of the probe, It is possible to detect the presence of base degeneration (including SNP) of the target nucleic acid through a high-resolution fluorescence microscopic curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change.

The 'target nucleic acid' of the present invention refers to a nucleic acid sequence (including SNP) of a genotype to be detected / discriminated and includes a specific region of a nucleic acid sequence of a 'target gene' encoding a protein having a physiological / biochemical function, Annealing or hybridizing with the primer or probe under hybridization, annealing or amplification conditions. The 'target nucleic acid' is not different from the terms 'target nucleic acid', 'synthetic DNA' or 'artificial synthetic oligo' as used herein, and is used interchangeably herein.

In the present invention, the target nucleic acid is DNA or RNA, and the molecule may be a double-stranded or single-stranded form. When the nucleic acid as the starting material is a double strand, it is preferable to make the two strands into a single strand, or a partial single strand form. Methods known to separate strands include, but are not limited to, heat, alkaline, formamide, urea and glycocalse treatment, enzymatic methods such as helicase action, and binding proteins. For example, the strand separation can be achieved by heat treatment at a temperature of 80 to 105 ° C. A general method of treatment as described above is disclosed in Joseph Sambrook et al., Molecular Cloning, 2001.

For the fluorescence PNA probe of the present invention, it is preferable to design such that the base mutation position of the target nucleic acid is located at the center position of the fluorescent PNA probe for the difference in the melting temperature (Tm) between the target nucleic acid and the target nucleic acid having the base mutation . When the base mutation part is located in the middle part of the probe, the probe makes a structural difference, and the fluorescent PNA probe binds while forming a loop, and the difference in the fusion temperature (Tm) is large due to such a structural difference.

In the present invention, the fluorescent PNA probe is analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe, and the probe having a similar role is a molecular beacon probe, A scorpion probe, and the like.

In the present invention, it is preferable that the fluorescent PNA probe has a reporter and a quencher at both ends thereof. That is, in the PNA probe according to the present invention, a reporter and a quencher capable of quenching the reporter fluorescence may be combined at both ends. The reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', -tetrachloro-6-carboxy-4,7-dichlorofluorescein) And the quencher may be at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto. Preferably, Dabcyl is used .

In the present invention, the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm) value, and mismatches with the target nucleic acid in which the base mutation is present, And has a low melting temperature (Tm) value.

In another embodiment of the present invention, in order to analyze the MSI and MSS using Quasi-loci high sensitivity and specificity, five brown rice somatosensory markers were used, Analysis was performed using cell lines of unstable (MSI) status and cell lines of five brownish solid state (MSS) states (see Figures 1 and 3), and in another embodiment of the invention three MSI (BAT25, BAT26, NR21, and NF2) in Quasi loci in cell lines consisting of 5 MSS (SW48, HCT116, and LoVo cell lines) and 5 MSS (Colo205, PC-9, SNU601, MCF7, and HELA cell lines) NR24, and NR27), the present invention provides a method for detecting the number of deleted base mutations of a biomarker related to brown rice somatic instability (MSI) from a single cell line And genotype analysis It was identified from a rice cell line break body indicator number and genotype analysis of the deletion mutation of the base at the same time diagnostic method possible.

Accordingly, the present invention provides, in another aspect, (a) a method of separating a target nucleic acid from a sample of a sample and then detecting the presence or absence of the target nucleic acid in the BAT-25, BAT-26, D2S123, D17S250 or D5S346, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, a PNA probe conjugated with a reporter and a dimer, SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, thereby hybridizing the PNA probe and the target nucleic acid; (b) melting the hybridized product while changing the temperature to obtain a melting curve; And (c) analyzing the obtained melting curve to detect the presence or absence of base mutations and the number of base mutations in the chromosome marker contained in the target nucleic acid, and detecting the base mutation of the target nucleic acid, instability (MSI) diagnosis method.

Here, using this diagnostic method, it is possible to confirm genotype and number of deleted base mutations of the chromosomal markers (BAT25, BAT26, NR21, NR24, and NR27) of Quasi loci of the target nucleic acid.

In the present invention, the specimen sample can be derived from a specific tissue or organ of an animal including a human. Representative examples of such tissues include binding, skin, muscle or nervous tissue. Representative examples of the above-mentioned organs include, but are not limited to, eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testis, , Lines and inner blood vessels.

The sample of specimen includes any cell, tissue, fluid, or any other medium that can be well analyzed by the present invention from a biological source, which can be used to determine the consumption of human, animal, human or animal Samples from food prepared for this purpose are included. In addition, the sample to be analyzed includes a body fluid sample, which may be a sputum, blood, serum, plasma, lymph, milk, urine, feces, eye milk, saliva, semen, brain extract Spleen and tonsil tissue extracts.

In the present invention, the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm) value, and is incompletely hybridized with the target nucleic acid having a base mutation And exhibits a lower melting temperature (Tm) value.

In the present invention, the base mutation may be characterized in that 2 to 14 bases of the target nucleic acid are deleted and mutation occurs.

In the present invention, it is preferable that the fluorescent PNA probe has a reporter and a quencher at both ends thereof. That is, in the PNA probe according to the present invention, a reporter and a quencher capable of quenching the reporter fluorescence may be combined at both ends. The reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', -tetrachloro-6-carboxy-4,7-dichlorofluorescein) And the quencher may be at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto. Preferably, Dabcyl is used .

In the present invention, the method may be characterized in that two or more target nucleic acids are used, and the reporter labeled on the PNA probe is different for each target nucleic acid, thereby detecting base mutation of two or more target nucleic acids. Thus, the method can be used to analyze base mutations of multiple target nucleic acids or single target nucleic acids.

 In another aspect, the present invention provides a PNA probe having a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, ; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, and further comprising a primer for detecting microsatellite instability (MSI) according to the detection of a base mutation of a target nucleic acid using a melting curve analysis method Kit.

In the present invention, the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm) value, and is incompletely hybridized with the target nucleic acid having a base mutation And exhibits a lower melting temperature (Tm) value.

In the present invention, the base mutation may be characterized in that 2 to 14 bases of the target nucleic acid are deleted and mutation occurs.

In the present invention, the kit may be characterized in that two or more target nucleic acids are used, and the reporter labeled on the PNA probe is different for each target nucleic acid, thereby detecting base mutation of two or more target nucleic acids. Thus, the kit can be used to analyze base mutations of multiple target nucleic acids or single target nucleic acids.

The kit of the present invention can optionally include reagents necessary for conducting a target amplification PCR reaction (e. G., PCR reaction) such as a buffer, a DNA polymerase joiner and deoxyribonucleotide-5-triphosphate. In addition, the kit may include various polynucleotide molecules, reverse transcriptase, buffer and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the kit may be readily determined by those skilled in the art having the teachings herein to determine the optimal amount of reagent used in a particular reaction. Typically, the kit may be made in a separate package or compartment containing the aforementioned components.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example  1: Artificial synthetic oligo and fluorescent PNA Of the probe  making

In order to perform the melting curve analysis according to the number of base mutations deleted using the fluorescent PNA probes of artificial synthetic oligos having various repeating sequences, 2, -4, -6, -8, -10, -12, and 14 deletion base mutations were prepared. In addition, a fluorescent PNA probe capable of specifically binding artificially synthesized oligos of various repeating sequences was prepared, and "^ = Glu-gamma PNA" was added at the center so as to specifically bind to the deleted base mutation (Fig. 4).

Example  2: Dissolution curve analysis to identify the number of oligonucleotide deleted base mutations of artificial synthetic oligonucleotides of various repeat sequences

PNA probes for confirming the number of base mutations deleted with artificial synthetic oligo synthesized in Example 1 were mixed and PCR was performed to analyze the dissolution curve. PCR was performed using CFX96 ™ Real-Time system (BIO-RAD, USA) for melting curve analysis. Conditions for dissolution curve analysis were as follows; 2.5Xol of artificial synthetic oligo, 0.5μl / 10pmol of PNA probe, and sterilized (2X) were added to a total volume of 20 μl. And 8.5 μl of distilled water (DW) was added thereto to perform PCR. For the dissolution curve analysis, a dissolution curve analysis was performed to measure the fluorescence by decreasing the temperature from 95 ° C for 3 minutes to 90 ° C for 1 minute, and then decreasing the temperature from 80 ° C to 30 ° C by 0.5 ° C. The stationary state was maintained for 5 seconds between each step.

As a result, as shown in FIG. 4, it was confirmed that the melting temperature (Tm) decreased in 2 to 4 ° C intervals in proportion to the number of the deleted base sequences.

Example  3: Brown rice On the markers  About primer  And fluorescent PNA Probe  making

The primers for the polymerase chain reaction of the five brown rice subsequence markers (BAT25, BAT26, NR21, NR24, and NR27) of Quasi loci used in the present invention are NR21, SEQ ID NO: 1 and SEQ ID NO: 2; NR24, SEQ ID NO: 3 and SEQ ID NO: 4; NR27, SEQ ID NO: 5 and SEQ ID NO: 6; BAT25, SEQ ID NO: 7 and SEQ ID NO: 8; BAT27, SEQ ID NO: 9 and SEQ ID NO: 10 were used, and Haghighi et al. , Asian Pacific J Cancer Prev . 11: 1033-1036, 2010 (Table 1).

SEQ ID NO: Name of the primer Sequences (5 '-> 3') SEQ ID NO: 1 QNR21_F GAGTCGCTGGCACAGTTCTA SEQ ID NO: 2 QNR21_R CTGGTCACTCGCGTTTACAA SEQ ID NO: 3 QNR24_F GCTGAATTTTACCTCCTGAC SEQ ID NO: 4 QNR24_R ATTGTGCCATTGCATTCCAA SEQ ID NO: 5 QNR27_F AACCATGCTTGCAAACCACT SEQ ID NO: 6 QNR27_R CGATAATACTAGCAATGACC SEQ ID NO: 7 QBAT25_F TACCAGGTGGCAAAGGGCA SEQ ID NO: 8 QBAT25_R TCTGCATTTTAACTATGGCTC SEQ ID NO: 9 QBAT26_F CTGCGGTAATCAAGTTTTTAG SEQ ID NO: 10 QBAT26_F AACCATTCAACATTTTTAACCC

Fluorescent PNA probes that can specifically bind to the repeat sites of the same base for the five brown subpixel markers (BAT25, BAT26, NR21, NR24, and NR27) of Quasi-loci used in the present invention, (Fig. 2, Table 2), so that the repetitive site of the same base was shortened by the " -O- linker " All fluorescent PNA probes capable of specifically binding to the repeat sites of the same bases for the five brown rice somatic markers (BAT25, BAT26, NR21, NR24, and NR27) of Quasi loci used in the present invention are disclosed in GanBank And the specificity of the fluorescent PNA probes was confirmed by multiple alignment and BLAST search.

SEQ ID NO: Probe Name Sequences (5 '-> 3') SEQ ID NO: 11 QNR21-S Dabcyl-TTGCTAAAAAAAAAA-O-AAAAAAAAAAGGC-O-K (FAM) SEQ ID NO: 12 QNR24-S Dabcyl-CTCACAAAAAAAAAAAA-O-AAAAAAAAAAAAGCC-O-K (FAM) SEQ ID NO: 13 QNR27-S Dabcyl-TGGTAAAAAAAAAAAAA-O-AAAAAAAAAAAAAGCC-O-K (FAM) SEQ ID NO: 14 QBAT25-S Dabcyl-CTCAAAAAAAAAAAA-O-AAAAAAAAAAAAATCA-O-K (FAM) SEQ ID NO: 15 QBAT26-S Dabcyl-GGTAAAAAAAAAAAAA-O-AAAAAAAAAAAAAGGG-O-K (HEX)

* In Table 2, O- means linker and K means lysine.

Example  4: 5 of Quasi loci Brown rice To the markers  About MSI  Number and genotype analysis of deleted base mutations by single analysis method using MSS cell lines

For the number and genotypic analysis of deleted base mutations in quasi-loci for five brown marble markers using MSI or MSS cell lines (Table 3), the primers synthesized above and the fluorescent PNA probes PCR was performed on a CFX96 ™ Real-Time system (BIO-RAD, USA).

As shown in Table 3, SW48, HCT116, and LoVo cell lines and microsatellite stable (MSS) cell lines Colo205, PC-9, SNU601, MCF7, and HELA, the number and genotype of the deleted base mutations of the five brown rice subpopulations of Quasi loci (BAT25, BAT26, NR21, NR24, and NR27) were analyzed.

No. Cell line MSI state One SW48 MSI 2 HCT116 MSI 3 LoVo MSI 4 Colo205 MSS 5 PC-9 MSS 6 SNU601 MSS 7 MCF7 MSS 8 HELA MSS

All PCR conditions used asymmetric PCR to generate a single-stranded target nucleic acid. The conditions of asymmetric PCR are as follows; 2.5 mM MgCl 2, 200 μM dNTPs, 1.0 U Taq polymerase, and 0.05 μM forward primer (forward primer) were added to each well to give a total volume of 20 μl. 1 μl of standard cell line DNA (Table 3) was added to 0.5 μM reverse primer (asymmetric PCR) and then 0.5 μl of fluorescent PNA probe (Table 2) was performed after real-time PCR And a melting curve analysis was performed. Schematic of the experimental method is shown in FIG. 3 and FIG. 6A, and the analysis was carried out under the condition of FIG.

As a result, as shown in Table 3 and FIG. 7, in the MSI (SW48, HCT116, and Lovo) cell lines, the specificity for the number of deleted bases of BAT25 (SEQ ID NO: 7 and SEQ ID NO: 8) (SEQ ID NO: 14) bound with the fluorescent PNA probe to decrease the melting temperature.

In addition, as shown in Table 3 and FIG. 8, in the MSI (SW48, HCT116, and Lovo) cell line, the expression of BAT26 (SEQ ID NO: 9 and SEQ ID NO: 10) A fluorescent PNA probe (SEQ ID NO: 15) was bound and the melting temperature decreased.

In addition, as shown in Table 3 and FIG. 9, in the MSI (SW48, HCT116, and Lovo) cell lines, there was a specific increase in the number of deleted bases of NR21 (SEQ ID NO: 1 and SEQ ID NO: 2) The fluorescence PNA probe (SEQ ID NO: 11) was bound and the melting temperature decreased.

In addition, as shown in Table 3 and FIG. 10, in the MSI (SW48, HCT116, and Lovo) cell lines, the expression of NR24 (SEQ ID NO: 3 and SEQ ID NO: 4) The fluorescence PNA probe (SEQ ID NO: 12) was bound and the melting temperature decreased.

In addition, as shown in Table 3 and Fig. 11, in the MSI (SW48, HCT116, and Lovo) cell lines, the expression of NR27 (SEQ ID NO: 5 and SEQ ID NO: 6) A fluorescent PNA probe (SEQ ID NO: 13) was bound and the melting temperature decreased.

Example  5: 5 of Quasi loci Brown rice To the markers  About MSI  Number and genotype analysis of deleted base mutations by multiple assays using MSS cell lines

For the number and genotypic analysis of deletion of base mutants using the multiple analysis method for quasi-locus subunit of Quasi loci using MSI or MSS cell lines (Table 3), the primers synthesized above PCR was performed using a CFX96 ™ real-time system (BIO-RAD, USA). Asymmetric PCR (asymmetric PCR) was used to generate a single-stranded target nucleic acid. . The conditions of asymmetric PCR are as follows; 2.5 mM MgCl 2, 200 μM dNTPs, 1.0 U Taq polymerase, and 0.05 μM forward primer (forward primer) were added to a total volume of 20 μL to obtain a 2X visual BMC Real Time FMCA ™ buffer (SeaSunBio Real-Time FMCA ™ buffer, (Table 3) were added to 0.5 占 역 reverse primer (asymmetric PCR), followed by real-time PCR, and then 0.5 占 퐇 of fluorescent PNA probes (Table 2) Was added to perform a melting curve analysis.

As shown in FIG. 12, MSI (SW48, HCT116, and Lovo) cell lines and MSS (Colo205, PC-9, SNU601, MCF7, and HELA) cell lines were simultaneously MSI, the fusion temperature was decreased due to the specific binding of fluorescent PNA probes in proportion to the number of specific deletion bases in the cell line, It was confirmed that the fusion temperature was proportional to the specific target nucleic acid of the cell line.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Seasunbiomaterials <120> Melting Curve Analysis Using PNA probe for Microsatellite          Instability (MSI) Diagnosis, and Method and Kit of Microsatellite          Instability Diagnosis Using the Same &Lt; 130 > P15-B260 <160> 15 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR21_F <400> 1 gagtcgctgg cacagttcta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR21_R <400> 2 ctggtcactc gcgtttacaa 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR24_F <400> 3 gctgaatttt acctcctgac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR24_R <400> 4 attgtgccat tgcattccaa 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR27_F <400> 5 aaccatgctt gcaaaccact 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> QNR27_R <400> 6 cgataatact agcaatgacc 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> QBAT25_F <400> 7 taccaggtgg caaagggca 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> QBAT25_R <400> 8 tctgcatttt aactatggct c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> QBAT26_F <400> 9 ctgcggtaat caagttttta g 21 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> QBAT26_F <400> 10 aaccattcaa catttttaac cc 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> QNR21-S <400> 11 ttgctaaaaa aaaaaaaaaa aaaaaggc 28 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> QNR24-S <400> 12 ctcacaaaaa aaaaaaaaaa aaaaaaaaag cc 32 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> QNR27-S <400> 13 tggtaaaaaa aaaaaaaaaa aaaaaaaaaa gcc 33 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> QBAT25-S <400> 14 ctcaaaaaaa aaaaaaaaaa aaaaaaaatc a 31 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> QBAT26-S <400> 15 ggtaaaaaaa aaaaaaaaaa aaaaaaaaag gg 32

Claims (15)

(Peptide Nucleic Acid, peptide nucleic acid) probe having a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 and a reporter and a quencher, A method of analysis of melting curve for the diagnosis of microsatellite instability (MSI) according to detection of base mutation of a target nucleic acid used.
2. The PNA probe according to claim 1, wherein the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm), and is incompletely hybridized with a target nucleic acid having a base mutation And a lower melting temperature (Tm) value.
2. The method of claim 1, wherein the base mutation comprises deletion of two to fourteen bases of the target nucleic acid resulting in a mutation.
4. The method of claim 1 wherein the reporter is selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Lt; RTI ID = 0.0 &gt; CY5. &Lt; / RTI &gt;
The method according to claim 1, wherein the quencher is at least one selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2 and Dabcyl.
Diagnosis of microsatellite instability (MSI) by detection of base mutations of a target nucleic acid comprising the steps of:
(a) separating the target nucleic acid from the sample of the sample, and then subjecting the target nucleic acid to BAT-25, BAT-26, D2S123, D17S250 or D5S346, which is a chromosome marker, of SEQ ID NO: 11, SEQ ID NO: A PNA probe having a sequence represented by SEQ ID NO: 14 or SEQ ID NO: 15, a reporter and a quencher conjugated to SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, thereby hybridizing the PNA probe and the target nucleic acid;
(b) melting the hybridized product while changing the temperature to obtain a melting curve; And
(c) analyzing the obtained melting curve to detect the presence or absence of base mutation and the number of base mutations in the chromosome marker contained in the target nucleic acid.
[Claim 7] The PNA probe of claim 6, wherein the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits an expected melting temperature (Tm), and is incompletely hybridized with a target nucleic acid having a base mutation And a lower melting temperature (Tm) value.
7. The method of claim 6, wherein the base mutation comprises deletion of two to fourteen bases of the target nucleic acid resulting in a mutation.
7. The method of claim 6 wherein the reporter is selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Lt; RTI ID = 0.0 &gt; CY5. &Lt; / RTI &gt;
The method according to claim 6, wherein the quencher is one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl.
7. The method of claim 6, wherein two or more target nucleic acids are used and the reporter labeled with the PNA probe is different for each target nucleic acid to detect base mutations of two or more target nucleic acids.
A PNA probe having a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 with a reporter and a quencher; SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; And a primer having a sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10, and further comprising a primer for detecting microsatellite instability (MSI) according to the detection of a base mutation of a target nucleic acid using a melting curve analysis method Kits.
13. The PNA probe of claim 12, wherein the PNA probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm), and is incompletely hybridized with a target nucleic acid having a base mutation Lt; RTI ID = 0.0 &gt; (Tm). &Lt; / RTI &gt;
13. The kit of claim 12, wherein the base mutation comprises deletion of two to fourteen bases of the target nucleic acid resulting in mutation.
13. The kit according to claim 12, wherein two or more target nucleic acids are used and the reporter labeled with the PNA probe is different for each target nucleic acid to detect base mutation of two or more target nucleic acids.
KR1020150136204A 2015-09-25 2015-09-25 Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same KR20170037095A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150136204A KR20170037095A (en) 2015-09-25 2015-09-25 Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150136204A KR20170037095A (en) 2015-09-25 2015-09-25 Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same

Publications (1)

Publication Number Publication Date
KR20170037095A true KR20170037095A (en) 2017-04-04

Family

ID=58588458

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150136204A KR20170037095A (en) 2015-09-25 2015-09-25 Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same

Country Status (1)

Country Link
KR (1) KR20170037095A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107217103A (en) * 2017-07-14 2017-09-29 常州桐树生物科技有限公司 Detect the multiple fluorescence PCR amplifing reagent and kit of microsatellite instability
KR20180108137A (en) * 2017-03-24 2018-10-04 주식회사 시선바이오머티리얼스 Melting Curve Analysis Using bifunctional PNA probe for Microsatellite Instability (MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same
CN109830265A (en) * 2019-01-18 2019-05-31 臻悦生物科技江苏有限公司 Detect kit, reference database, preparation method and the application of MSI
WO2019162240A1 (en) * 2018-02-20 2019-08-29 F. Hoffmann-La Roche Ag Improved detection of microsatellite instability
WO2022124575A1 (en) * 2020-12-07 2022-06-16 (주)디엑솜 Method for diagnosing microsatellite instability using coefficient of variation of sequence lengths in microsatellite loci

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180108137A (en) * 2017-03-24 2018-10-04 주식회사 시선바이오머티리얼스 Melting Curve Analysis Using bifunctional PNA probe for Microsatellite Instability (MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same
CN107217103A (en) * 2017-07-14 2017-09-29 常州桐树生物科技有限公司 Detect the multiple fluorescence PCR amplifing reagent and kit of microsatellite instability
WO2019162240A1 (en) * 2018-02-20 2019-08-29 F. Hoffmann-La Roche Ag Improved detection of microsatellite instability
CN111670254A (en) * 2018-02-20 2020-09-15 豪夫迈·罗氏有限公司 Improved detection of microsatellite instability
JP2021513858A (en) * 2018-02-20 2021-06-03 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ Improved detection of microsatellite instability
CN109830265A (en) * 2019-01-18 2019-05-31 臻悦生物科技江苏有限公司 Detect kit, reference database, preparation method and the application of MSI
CN109830265B (en) * 2019-01-18 2022-11-25 臻悦生物科技江苏有限公司 Kit for detecting MSI, reference database, construction method and application thereof
WO2022124575A1 (en) * 2020-12-07 2022-06-16 (주)디엑솜 Method for diagnosing microsatellite instability using coefficient of variation of sequence lengths in microsatellite loci

Similar Documents

Publication Publication Date Title
KR101969971B1 (en) Melting Curve Analysis Using bifunctional PNA probe for Microsatellite Instability (MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same
ES2886923T3 (en) Methods and composition for generating single-sequence DNA probes, labeling of DNA probes, and the use of these probes
CN110964814B (en) Primers, compositions and methods for nucleic acid sequence variation detection
JP6968894B2 (en) Multiple detection method for methylated DNA
JP2018512878A (en) Methods to increase the sensitivity of next-generation sequencing
CN110541033B (en) Composition for EGFR gene mutation detection and detection method
KR20170037095A (en) Melting Curve Analysis Using PNA probe for Microsatellite Instability(MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same
JP2018522574A (en) Genetic marker for discrimination and detection of aquatic product infectious disease-causing virus, and method for discriminating and detecting the virus using the same
CN114277135B (en) Gastric cancer lymph node metastasis related methylation biomarker and combination and detection kit thereof
KR102044683B1 (en) Pepetide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same
KR20150054633A (en) Method for the detection of multiple target nucleic acids using clamping probes and detection probes
KR101642783B1 (en) Genetic Markers for Detection of Causative Virus of Red Sea Bream Iridoviral Disease(RSIVD), and Method for Detection of Causative Virus Using the Same
KR101644773B1 (en) Genetic Markers for Discrimination and Detection of Causative Bacteria of Edwardsiellosis and Streptococcosis, and Method of Discrimination and Detection of Causative Bacteria Using the Same
KR101782489B1 (en) Development of real-time PCR using PNA probe for detection of Viral Hemorrhagic Septicemia Virus (VHSV) and Uses Thereof
KR101695477B1 (en) Method for the Determination of Blood Typing Using PNA Probe and fluorscence melting curve analysis
KR101986193B1 (en) Peptide nucleic acid(PNA) probe for detecting hereditary hearing loss and detection method using the same
CN110468211B (en) Bladder cancer tumor mutant gene specific primer, kit and library construction method
KR101775953B1 (en) Detection methods of mutation and the kits
KR101727598B1 (en) Method for Analyzing SNP of Mitochondrial DNA Using PNA Probe and Melting curve analysis
JPWO2005021743A1 (en) Nucleic acid amplification primer and colorectal cancer inspection method using the same
KR101686438B1 (en) Black pig having enhanced fleshiness and stress tolerance and process for preparing the same
JP2019506151A (en) Method for detecting genetic mutations in viral hemorrhagic sepsis virus
KR20200129600A (en) Pepetide nucleic acid probe for genotyping Helicobacter pylori and Method using the same
CN113574180A (en) Single nucleic acid for real-time detection of genetic variation of single target gene and detection method using same
KR101728023B1 (en) Detection of mutations in ATP7B gene using PCR-LDR

Legal Events

Date Code Title Description
WITB Written withdrawal of application