KR20220129774A - Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe - Google Patents

Abstract

The present invention relates to a serotype diagnosis method of porcine pleuropneumoniae causing enormous damage to pig productivity and to a kit for diagnosis and, more specifically, to a PNA probe and primers for detecting a capsular polysaccharide (cps) gene of porcine pleuropneumoniae, and a diagnostic method and kit for serotypes 9 to 15 of porcine pleuropneumoniae using the same. The PNA probe, according to the present invention, can differentiate the serotype of porcine pleuropneumoniae with high sensitivity and high accuracy compared to conventional PCR methods, and is also easy to detect false positives. Thus, the PNA probe can be useful for pleural pneumonia diagnosis and vaccine development in pig farms. The method comprises the steps of: (a) isolating DNA from a sample; (b) obtaining an amplification product by amplifying the porcine pleuropneumoniae capsular gene using the primer pair; (c) hybridizing the amplification product with the PNA probe; and (d) determining the serotype of porcine pleuropneumoniae by analyzing the melting curve of the hybridized reactant in step (c).

Description

Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe}

The present invention relates to a method and kit for diagnosing a porcine pleural pneumococcus serotype that causes great damage to pig productivity, and more specifically, to a PNA probe and primer for detecting the porcine pleural pneumococcus serotype capsule gene (capsular polysaccharide, cps), and It relates to a diagnostic method and kit for serotypes 9 to 15 of porcine pleurisy using the same.

Porcine pleuropneumoniae is an acute, febrile infectious disease that is highly contagious, and causes enormous economic damage to the global pig industry. The causative agent of this disease, Actinobacillus pleuropneumoniae ( A. pleuropneumonia e, App), is mainly transmitted through air (aerosol) or direct contact, and infected pigs are exposed to open abdominal respiration due to high fever, depression, anorexia, and dyspnea. show coughing symptoms In addition, swelling of the pulmonary lobe, precipitation of fibrin, thickening of the pulmonary pleura, and liver changes in the lungs can be observed at autopsy. Microscopic findings are characterized by alveolar hypertrophy and neutrophil infiltration, purulent exudate and fibrin in the alveoli. Pig pleural pneumonia is susceptible to infection in pigs of all ages, but is known to show serious clinical symptoms in pigs over 12 weeks of age. However, domestic outbreaks occur in all age groups except for sows and piglets in the lactation period, causing enormous economic damage to the domestic pig industry.

Pneumoconiosis of pigs is classified into 15 types according to the difference between two biovars and polysaccharides constituting the capsular membrane according to the NAD (nicotine adenine dinucleotide)-dependent type as a growth factor. Some of these are non-pathogenic that do not cause disease, while others cause very serious disease. Strains 1, 5, 9, 11 and 12 are highly lethal, and strains 3 and 6 are very docile. These pleural pneumococci are reported in various countries or regions. The main characteristic of pleural pneumonia is that even with the same serotype, the pathogenicity may be different depending on the region. Currently, commercially available vaccines have low cross-reactivity between serotypes, so autogeneous vaccines are also used that separate serotypes suitable for the country and region and use them as vaccine strains.

In the past, seroaggregation using a cross-reaction between common antigens, agar gel diffusion method, and indirect hemagglutination reaction were used as a method for identifying serotypes. Therefore, serotype identification was performed only in laboratories with standard serum, etc. Recently, with the development of genetic testing methods, genetic testing methods for various serotypes have been developed (Jessing, J Clin Microbiol, 2003, pp 4095-4100., Angen, O Vet Microbiol, 2008, pp. 312-318). Based on these diagnostic technologies, serotypes 1, 2, 3, 5, 6, 7, 10 and 12 have been reported in Korea.

However, genetic testing methods developed so far identify serotypes that perform 3-4 genetic tests to distinguish similar serotypes due to high similarity between serotypes, and some serotypes are difficult to distinguish.

Korean Patent No. 1527847 (215.06.04) relates to a primer set for identifying a causative agent of a porcine bacterial respiratory disease and a diagnostic kit including the same, and a primer set for detecting and discriminating a causative agent causing a porcine bacterial respiratory disease, the causative agent A composition comprising a composition and a method for detecting a causative agent of a porcine bacterial respiratory disease that can detect a causative agent of a porcine bacterial respiratory disease using the composition are described,

Korean Patent No. 1756736 (2015.06.30) relates to a method and device for rapidly detecting porcine pleural pneumonia from clinical samples through multiple real-time PCR, collecting clinical samples from pig lung tissue, and collecting the collected clinical samples. DNA is extracted from the sample, and the extracted DNA is used as a template to perform simultaneous species identification and serotype determination of porcine pleural pneumonia serotypes 1, 2, 7 and 12 in real time using specific primers that perform gene amplification Although a method for rapid detection of porcine pleurisy by performing multiple PCR and a device thereof have been described, there is a disadvantage in that the accuracy is low.

On the other hand, PNA is an abbreviation of peptide nucleic acids, which is artificially synthesized as one of the gene recognition materials like LNA (Locked nucleic acid) and MNA (Morpholino nucleic acid), and its basic skeleton is composed of electrically neutral polyamide. In the case of PNA, it is a material that has national competitiveness with a domestic original patent. PNA has excellent affinity and selectivity, and has high stability against nucleolytic enzymes, so it is not degraded by existing restriction enzymes. There are features that do not. In addition, thermal/chemical properties and stability are high, so storage is easy and it is not easily decomposed. It has superior PNA-DNA binding power compared to DNA-DNA binding and has a melting temperature that is about twice as high. It is possible to effectively detect changes in the nucleic acid of SNPs and In/Del by using the difference in binding force.

Fluorescence Melting Curve Analysis (FMCA) is mainly used as an analysis method for the PNA probe hybridization method. In FMCA, after the PCR reaction is completed, the difference in binding force between the prepared product and the added probe is divided by Tm and analyzed. way to do it Unlike other SNP detection probes, the design of the probe is very simple, so it is manufactured using a 9~15 mer nucleotide sequence including SNP. Alternatively, the Tm value can be adjusted by linking amino acids such as Lysine, Glutamic acid, or Alanine to the gamma position of the PNA backbone.

Since PNA has a higher basic Tm value due to superior binding strength than DNA, it can be designed with a shorter length than DNA, and therefore has the advantage of detecting even closely adjacent SNPs. In addition, the existing HRM (High resolution melting) method has a very small difference in Tm value of about 0.5°C, which requires an additional analysis program or a detailed temperature change, making it difficult to analyze when two or more SNPs appear, whereas the PNA probe uses the probe sequence It has the advantage that it is not affected by other SNPs and enables precise analysis.

Accordingly, the present inventors solved the above problems, and as a result of earnest efforts to develop a method for distinguishing serotypes 9 to 15 using the capsular protein gene (cps) of porcine pleurisy, When the capsular gene was amplified with a primer and then the fusion curve was analyzed with a gene-specific PNA probe, it was confirmed that serotypes 9 to 15 of pleural pneumonia can be quickly and accurately distinguished, and the present invention was completed.

It is an object of the present invention to provide a probe and primer pair capable of detecting the capsular gene (cps) of porcine pleurisy.

Another object of the present invention is to provide a method and kit for diagnosing porcine pleural pneumonia by detecting a porcine pleural pneumococcal capsular gene using the probe and primer pair.

In order to achieve the above object, the present invention provides a PNA probe for detecting porcine pleural pneumonia capsular gene (capsular polysaccharide, cps) comprising at least one sequence selected from the group consisting of SEQ ID NOs: 1 to 4.

The present invention also provides (i) a primer pair consisting of a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7; (ii) a primer pair consisting of a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 9; (iii) a primer pair consisting of a forward primer of SEQ ID NO: 10 and a reverse primer of SEQ ID NO: 11; (iv) a primer pair consisting of a forward primer of SEQ ID NO: 12 and a reverse primer of SEQ ID NO: 13; (v) a primer pair consisting of a forward primer of SEQ ID NO: 14 and a reverse primer of SEQ ID NO: 15; (vi) a primer pair consisting of a forward primer of SEQ ID NO: 16 and a reverse primer of SEQ ID NO: 17; or (vii) a primer pair consisting of a forward primer of SEQ ID NO: 18 and a reverse primer of SEQ ID NO: 19; It provides a porcine pneumococcal capsular gene amplification (primer pair) comprising a.

The present invention also provides a composition for detecting a porcine pleural pneumococcal capsular gene comprising the PNA probe and the primer pair.

The present invention also provides a kit for diagnosing porcine pleural pneumonia serotypes comprising the composition.

The present invention also provides a method for diagnosing a porcine pleurisy serotype serotype comprising the following steps:

(a) isolating DNA from the specimen sample;

(b) amplifying the porcine pleurisy capsular gene using the primer pair to obtain an amplification product;

(c) hybridizing the amplification product with the PNA probe;

(d) determining the serotype of porcine pleurisy by analyzing the melting curve of the reactant hybridized in step (c).

The PNA probe according to the present invention can discriminate the serotype of porcine pleural pneumococci with high sensitivity and high accuracy compared to the existing PCR method, as well as facilitate false-positive identification, so it is useful for diagnosing pleural pneumonia in pig farms and developing vaccines can be utilized.

1 is a schematic diagram showing the concept of a serotype diagnosis method of porcine pleural pneumonia using the PNA probe of the present invention.
Figure 2 is a schematic diagram showing the binding position of the primer and PNA probe of the internal control according to the present invention.
3 is a graph showing amplification conditions and melting curve analysis conditions of the capsular gene of porcine pleurisy according to the present invention.
4 is a graph in which a standard strain of pig pleural pneumonia according to the present invention, an internal control group, and a fusion curve for each serotype are arranged based on a fluorescent label.
5 is a graph showing the results of analysis of the melting curve according to the serotype of porcine pleurisy according to the present invention.
6 is a graph arranged by grouping with a fluorescent label common to the result of analysis of the fusion curve of porcine pleural pneumococcus according to the present invention.
7 is a graph evaluating the analytical sensitivity of the PNA probe according to the present invention using a standard strain.
Figure 8 (A) is a list of strains for confirming specificity according to an embodiment of the present invention, (B) is the confirmation result.
9 is a comparison result of a diagnostic method using a PNA probe according to an embodiment of the present invention and a conventional PCR method.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

In the present invention, when detecting the capsular gene (cps) of porcine pleurisy using a PNA probe, it was attempted to confirm that the serotype of porcine pleurisy could be identified only by analyzing the fusion curve without going through a complicated process.

That is, in one embodiment of the present invention, when a PNA probe that specifically binds to the capsular gene (cps) of porcine pleural pneumonia is designed, and the melting curve is analyzed using this, the fusion curve is analyzed only by analyzing the fusion curve without additional analysis work. It was confirmed that the serotype of pleurisy can be identified (FIG. 5).

Accordingly, the present invention in one aspect,

It relates to a PNA probe for detecting porcine pleural pneumonia capsular gene (capsular polysaccharide, cps) comprising at least one sequence selected from the group consisting of SEQ ID NOs: 1 to 4.

In the present invention, the PNA probe may include a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence at both ends, and may include an intercalating fluorescent material. The reporter may be at least one selected from the group consisting of FAM (6-carboxyfluorescein), HEX, Texas red, JOE, TAMRA, CY5, CY3, or Alexa680, and the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, It may be one or more selected from the group consisting of BHQ2, BHQ3 and Dabcyl, but is not limited thereto.

The intercalating fluorescent material is acridine homodimer and its derivatives, acridine orange and its derivatives, 7-aminoactinomycin D (7-AAD) and its derivatives, Actinomycin D and its derivatives, ACMA (9-amino-6-chloro-2-methoxyacridine) and its derivatives, DAPI and its derivatives, dihydroethidium (Dihydroethidium) and its derivatives, ethidium bromide and its derivatives, ethidium homodimer-1 (EthD-1) and its derivatives, ethidium homodimer-2 (EthD-2) and its derivatives, ethidium Ethidium monoazide and its derivatives, Hexidium iodide and its derivatives, bisbenzimide (Hoechst 33258) and its derivatives, Hoechst 33342 and its derivatives, ho Hoechst 34580 and its derivatives, hydroxystilbamidine and its derivatives, LDS 751 and its derivatives, propidium iodide (PI) and its derivatives and between It may be selected from the group consisting of dyes (Cy-dyes) derivatives.

In the present invention, the PNA probe containing a reporter and a quencher generates a fluorescence signal after hybridization with the target nucleic acid, and as the temperature rises, the PNA probe rapidly melts with the target nucleic acid at the appropriate melting temperature of the probe to quench the fluorescence signal. The presence or absence of a target nucleic acid can be detected through high-resolution melting curve analysis obtained from the fluorescence signal according to

PNA (Peptide Nucleic Acid) is one of the gene recognition materials like LNA (Locked nucleic acid) and MNA (Mopholino nucleic acid). It is artificially synthesized and its basic skeleton is composed of polyamide. PNA has excellent affinity and selectivity, and is not degraded by existing restriction enzymes because of its high stability to nucleases. In addition, thermal/chemical properties and stability are high, so storage is easy and it is not easily decomposed. In addition, compared to DNA-DNA binding, PNA-DNA binding power is excellent and the melting temperature is about twice as high, so there is a difference in melting temperature (Tm) of about 10 to 15 ° C even for one nucleotide mismatch. It is possible to detect changes in single nucleotide polymorphism (SNP) and insertion/deletion (InDel) nucleic acids by using this difference in binding force.

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several bases to several hundred bases as short as possible to achieve specific binding to a gene or mRNA, oligonucleotide probes, single stranded DNA ) may be prepared in the form of a probe, a double stranded DNA probe, an RNA probe, a PNA probe, an LNA probe, etc., and may be labeled for easier detection, but is not particularly limited thereto.

As used herein, the term “hybridization” means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization may occur when complementarity between two nucleic acid strands is perfect (perfect match) or even in the presence of some mismatched bases. Because PNA has a large degree of double-stranded instability due to a single base mismatch, the ability to detect SNPs is superior to that of natural nucleic acids. The degree of complementarity required for hybridization may vary depending on hybridization conditions, and in particular may be controlled by temperature.

In the present invention, the target nucleic acid refers to a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.

The Tm value also changes depending on the difference between the nucleic acid of the PNA probe and the DNA complementary thereto, so it is easy to develop an application technology using the change. PNA probes are analyzed using a hybridization reaction different from the hydrolysis reaction of TaqMan probes, and probes that perform similar roles include molecular beacon probes and scorpion probes.

Fluorescence Melting Curve Analysis (FMCA) is used as an analysis method for the hybridization reaction, and the difference in binding strength between the product generated after the PCR reaction and the input probe is classified by melting temperature and analyzed. . Unlike other SNP detection probes, the design of the probe is very simple, so it is manufactured using the nucleotide sequence of 11 to 18 mer including SNP. Therefore, in order to design a probe having a desired melting temperature, the Tm value can be adjusted according to the length of the PNA probe, and the Tm value can be adjusted by linking amino acids such as Lysine, Glutamic acid, or Alanine to the gamma position of the PNA backbone. Because PNA has a higher basic Tm value due to superior binding power than DNA, it can be designed with a shorter length than DNA, enabling detection of SNPs that are close to each other. In the existing HRM method, the difference in Tm value is very small, about 0.5°C, so additional analysis programs or detailed temperature changes are required, and analysis becomes difficult when two or more SNPs appear. Fast and accurate analysis is possible.

In the present invention, the "PNA probe (probe)" shows an expected melting temperature (Tm) value by preferentially binding to the target nucleic acid when the target nucleic acid is present, and binds to the internal control in the absence of the target nucleic acid and has a lower melting temperature than expected (Tm) value may be displayed, and false positive and false negative signals may be distinguished using the difference between the internal control and the target nucleic acid melting curve.

In another aspect, the present invention, (i) a primer pair consisting of a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7;

(ii) a primer pair consisting of a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 9;

(iii) a primer pair consisting of a forward primer of SEQ ID NO: 10 and a reverse primer of SEQ ID NO: 11;

(iv) a primer pair consisting of a forward primer of SEQ ID NO: 12 and a reverse primer of SEQ ID NO: 13;

(v) a primer pair consisting of a forward primer of SEQ ID NO: 14 and a reverse primer of SEQ ID NO: 15;

(vi) a primer pair consisting of a forward primer of SEQ ID NO: 16 and a reverse primer of SEQ ID NO: 17; or

(vii) a primer pair consisting of a forward primer of SEQ ID NO: 18 and a reverse primer of SEQ ID NO: 19;

It relates to a primer pair for amplifying the porcine pleural pneumococcal capsular gene comprising a.

In the present invention, the primer pair can specifically amplify the porcine pleural pneumococcal capsular gene (capsular polysaccharide, cps).

In another aspect, the present invention relates to a composition for detecting porcine pleural pneumococcus capsular gene (capsular polysaccharide, cps) comprising the PNA probe and the primer pair.

In the present invention, the composition comprises an internal control material; And it may be characterized in that it further comprises a pair of primers of SEQ ID NOs: 20 and 21, and a PNA probe of SEQ ID NO: 5 for detecting them. At this time, the primer pair represented by the nucleotide sequences of SEQ ID NO: 20 and SEQ ID NO: 21 amplifies the internal control material, and the PNA probe of SEQ ID NO: 5 hybridizes with the internal control material, regardless of the presence or absence of porcine pleurisy. It is possible to determine whether or not real-time PCR is successful. Therefore, the internal control material refers to a gene (eg, a housekeeping gene) generally included in the sample or a template nucleic acid to be separately injected, preferably a gene not present in porcine pleurisy (Cymbidium in the present invention). sinense psbA gene) region, more preferably, it may be characterized as a gene represented by the nucleotide sequence of SEQ ID NO: 34. In this context, a primer pair capable of amplifying a corresponding gene and a probe hybridized to the gene may be easily selected and applied by those skilled in the art in addition to the primer pair and PNA probe provided in the present invention.

In another aspect, the present invention relates to a kit for diagnosing porcine pleurisy serotypes comprising the composition.

In the present invention, the kit is a nucleic acid amplification reaction such as a buffer, a DNA polymerase (DNA polymerase), a DNA polymerase cofactor and deoxyribonucleotide-5-triphosphate (dNTP) (e.g., , polymerase chain reaction) may optionally include reagents necessary for carrying out. Optionally, the kit of the present invention may also include various oligonucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the optimal amount of the reagent used in a specific reaction of the kit can be easily determined by a person skilled in the art having the knowledge of the present specification. Typically, the equipment of the present invention may be manufactured as a separate package or compartment comprising the aforementioned components.

In one embodiment, the kit may comprise a compartmentalized carrier means containing a sample, a container containing a reagent, and a container containing a primer or probe.

The carrier means is suitable for containing one or more containers, such as bottles and tubes, each container containing independent components for use in the method of the present invention. In the context of the present invention, a person of ordinary skill in the art can readily dispense the required formulation in a container.

In another aspect, the present invention relates to a method for diagnosing a porcine pleural pneumonia serotype serotype comprising the following steps:

(a) isolating DNA from the specimen sample;

(b) amplifying the porcine pleurisy capsular gene using the primer pair to obtain an amplification product;

(c) hybridizing the amplification product with the PNA probe; and

(d) determining the serotype of porcine pleurisy by analyzing the melting curve of the reactant hybridized in step (c).

In the present invention, the sample is derived from a specimen for which the serotype of porcine pleural pneumonia is to be detected, and contains DNA or RNA molecules, and the molecules may be in double-stranded or single-stranded form. When the nucleic acid as a starting material is double-stranded, it is preferable to make the two strands into a single-stranded or partially single-stranded form. Methods known to separate strands include, but are not limited to, heat, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg, helicase action) and binding proteins. For example, strand separation can be achieved by heat treatment at a temperature of 80 to 105°C.

In the present invention, the sample may be feces or small intestine contents of piglets, but is not limited thereto.

In the present invention, the amplification of the step (a) may be characterized in that it is performed by a real-time PCR method, but is not limited thereto. In the real-time polymerase chain reaction method of the present invention, the fluorescent material is interchelated to a double-stranded DNA chain in the PCR process, and the temperature is increased to amplify the PCR product and release the DNA double-strand. By analyzing the pattern of the melting curve, in which the amount of fluorescent material present between the double strands is reduced, in particular, the temperature (Tm) at which DNA is melted (denatured), it is possible to analyze whether there is a mutation in the base sequence between the normal control and the mutant.

In the present invention, the step (b) may be characterized in that it further comprises the amplification of the internal control material, the amplification of the internal control material is performed using the primer pair of SEQ ID NOs: 20 and 21, SEQ ID NO: It may be characterized by detection with a probe of 5.

In the present invention, the melting curve analysis of step (d) may be characterized in that it is performed by FMCA (Fluorescence Melting Curve Analysis) method, but is not limited thereto.

The melting curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed of a target DNA or RNA and a probe. Since this method is performed, for example, by Tm analysis or analysis of the melting curve of the double chain, it is called melting curve analysis. A hybrid (double-stranded DNA) of the target single-stranded DNA of a detection sample and the probe is formed using a probe complementary to the detection target sequence containing the nucleic acid to be detected, and then the hybridized product is subjected to heat treatment. In this method, the presence or absence of a target nucleic acid is determined by detecting dissociation (melting) of the hybrid according to the temperature rise by a change in a signal such as absorbance, and then determining the Tm value based on the detection result.

The Tm value is higher as the homology of the hybrid-formed body is higher, and lower as the homology is lower. For this reason, the Tm value (evaluation reference value) is obtained in advance for a hybrid formation of a detection target sequence containing a target nucleic acid and a probe complementary thereto, and the Tm value (measurement) between the target single-stranded DNA of the detection sample and the probe. value), if the measured value is the same as the evaluation reference value, it can be determined that a match, that is, the target DNA exists, and if the measured value is lower than the evaluation reference value, it is determined that there is a mismatch, that is, the target DNA does not exist can do.

Fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent material, and more specifically, the melting curve may be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Preparation of primers and probes for porcine pleural pneumonia serotype diagnosis

In the case of a pleural pneumonia detection primer (apxIV gene) and a serotype-sensitive probe to determine whether porcine pleural pneumonia (APP) infection is present, genes (capsular polysaccharide, cps, NCBI accession No.: S10_GU585379.1, S12_AY496881.1, S13_MG868947). 1, S14_AB810251.1, S15_LC507611.1), (outer membrane protein, NCBI accession No.: S1: AB007572, S9: AB007581, S11: AB007583) Through sequencing of the genes, the primers indicated in the announcement and the newly prepared primers were They were mixed and used, and a PNA probe capable of hybridizing in the amplification product using the primer was prepared (Table 1).

The primers indicated in the notice are as follows:

SEQ ID NO: 22: Serotype1, 9, 11_F_Ref: GTATAAGGAATTTTTTAATGAATATTGCAAC

SEQ ID NO:23: Serotype1, 9, 11_R_Ref: GCCACTACATGCGGTAAGCACT

SEQ ID NO: 24: Serotype10_F_Ref: GGTATGGTTGCCTTAGAGGTGGTGATGGAACAAGGTTATGG

SEQ ID NO: 25: Serotype10_R_Ref: TTGGAATAGCGACTCTCCTGATGGAA

SEQ ID NO: 26: Serotype12_F_Ref: GGTATGGTTGCATTAGAGAGTTAGGTTCTTCTCCCATCTGTTGT

SEQ ID NO: 27: Serotype12_R_Ref: CCTTGGTTAATGTATTTCGAAGGGAAAGC

SEQ ID NO: 28: Serotype13_F_Ref: GGTATAGTTGCATTAGAATGTAAAGGATCTAAGCCGTTGTGTATG

SEQ ID NO: 29: Serotype13_R_Ref: GTCAGATCAATTCTGAATTCGATTTAGCG

SEQ ID NO: 30: Serotype14_F_Ref: GGCGTCTGGAGTTCGATTCTCGCTTGGAAGCAATTCAAGATG

SEQ ID NO: 31: Serotype14_R_Ref: CCTATGTGGTTTATCGAAATGCAATGGG

SEQ ID NO:32: Serotype15_F_Ref: GGCATCTGGAGTTCGGGGATCGAAAGGCTATGGTAT

SEQ ID NO:33: Serotype15_R_Ref: GGAATTCAGACAACGGTGCATTTGATAC

Primer and probe sequences used to detect porcine pleurisy capsular genes SEQ ID NO: name Sequence (5'-3') note One App common Dabcyl-GCCACCACAGCCA-O-K (FAM) probe 2 Serotypes 1, 9, 11 Cy5-AATGGCTAGCTTAGTC-O-K (BHQ3) probe 3 Serotypes 10, 12, 13 Dabcyl-GGTATGGTTGCCTTAGA-O-K (HEX) probe 4 Serotype 14, 15 Alexa680-GGCGTCTGGAGTTC-O-K (BHQ3) probe 5 IPC Dabcyl-ATCCGAATTCTCGTTC-O-K (TxR) Internal contrast probe 6 Common F GCCACCACAGCCATTATCCGAACTTTGGTTTAGCCGAGA primer 7 Common R CATATTTGATAAAACCATCCGTC primer 8 Serotype 1, 9, 11_F GTATAAGGAATTTTTTAATGAATATTGCAAC primer 9 Serotype 1, 9, 11_R GCCACTACATGCGGTAAGCACT primer 10 Serotype 10_F GGTATGGTTGCCTTAGAGGTGGTGATGGAACAAGGTTATGG primer 11 Serotype 10_R TTGGAATAGCGACTCTCCTGATGGAA primer 12 Serotype 12_F GGTATGGTTGCATTAGAGAGTTAGGTTCTTCTCCCATCTGTTGT primer 13 Serotype 12_R CCTTGGTTAATGTATTTCGAAGGGAAAGC primer 14 Serotype 13_F GGTATAGTTGCATTAGAATGTAAAGGATCTAAGCCGTTGTGTATG primer 15 Serotype 13_R GTCAGATCAATTCTGAATTCGATTTAGCG primer 16 Serotype 14_F GGCGTCTGGAGTTCGATTCTCGCTTGGAAGCAATTCAAGATG primer 17 Serotype 14_R CCTATGTGGTTTATCGAAATGCAATGGG primer 18 Serotype 15_F GGCATCTGGAGTTCGGGGATCGAAAAGGCTATGGTAT primer 19 Serotype 15_R GGAATTCAGACAACGGTGCATTTGATAC primer 20 IPC_F GCTATCTTGTTGGGTTCAGGTGC Inner Contrast Primer 21 IPC_R GGCACTTATCATTCATTGGCGGG Inner Contrast Primer

The primers specified in the standard animal disease test method and newly prepared primers were synthesized by Cosmogenetech (Korea), and all PNA probes used in the present invention were synthesized by HPLC purification in Panagene (Panagene, Korea). . The purity of all synthesized probes was confirmed using mass spectrometry, and unnecessary secondary structures of the probes were avoided for more effective binding to the target nucleic acid. The PNA probe for serotype discrimination of porcine pleurisy was manufactured so that the melting temperature did not exceed 75° C. so as not to affect the polymerase chain reaction.

Example 2. Comparative analysis of test results of porcine pleurisy

For the diagnosis of porcine pleurisy serotype using PNA probe, the optimal primer and PNA probe position were selected in the capsular polysaccharide gene. In addition, an internal control was synthesized to determine whether false-positive was determined according to contamination during the experiment (FIG. 2).

As the experimental equipment, CFX96TM (Bio-Rad, USA) was used, and for the experimental composition, the composition shown in Table 2 below was used, and the real-time polymerase chain reaction test conditions were carried out as in FIG. 3 .

The standard strain was prepared by Dr. Montreal University of Veterinary Medicine, Canada. It was used after receiving from Gottschalk M, and the strain numbers of the standard strains are as follows:

A. pleuropneumoniae Serotype 1: Shope 4074

A. pleuropneumoniae Serotype 9: CVJ 13261

A. pleuropneumoniae Serotype 10: 22009

A. pleuropneumoniae Serotype 11: 56153

A. pleuropneumoniae Serotype 12: 1096

A. pleuropneumoniae Serotype 13: N-273

A. pleuropneumoniae Serotype 14: 3906

A. pleuropneumoniae Serotype 15: HS143

Experimental composition matter Amount (concentration) standard strain 3 ul (4x10 ⁵ copies) SEQ ID NO: 6, 7 primer (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NO: 8, 9 primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NO: 10, 11 primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NO: 12, 13 primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NO: 14, 15 primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NOs: 16, 17 Primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NOs: 18, 19 primers (Forward & Reverse) 0.5 ul each (6:60 pmol) SEQ ID NO: 20, 21 primers (Forward & Reverse) 0.5 ul each (2:10 pmol) SEQ ID NO: 1 probe 0.5 ul (5 pmol) SEQ ID NO: 2 probe 0.5 ul (5 pmol) SEQ ID NO: 3 probe 0.5 ul (5 pmol) SEQ ID NO: 4 probe 0.5 ul (5 pmol) SEQ ID NO: 5 probe 0.5 ul (1 pmol) 2X qPCR PreMix 14 ul SEQ ID NO: 34 (internal control DNA) 0.5 ul total volume 28 ul

As a result of the melting curve analysis, as shown in FIGS. 4 to 6, the Tm value of FAM was 67±2℃ in the case of the porcine pleural pneumonia standard strain, TxR 61±2℃ in the case of the internal control, and Serotypes 10, 12, 13 were in HEX. Each 68±2℃56±2℃47±2℃ Serotypes 14 and 15 showed a peak at 75±2℃66±2℃ in Quasar, respectively, and Serotypes 1, 9 and 11 showed a peak at 69±2℃ in Cy5. As a result, it was confirmed that the PNA probe according to the present invention can clearly discriminate between the internal control group and the standard strain.

The IPC sequence used is as shown in SEQ ID NO: 34

SEQ ID NO: 34 IPC:

TGTTCTTAGAACAAGATATTGGGGGATTGCTATCTTGTTGGGTTCAGGTGCTTTTTGCTTCTCTATCCGAATTCTCGTTCTTTATCATAAAAGTTCTCCCCCGCCAATGAATGATAAGTGCCTAGGTGAAGCATAGTATAAGATAAGTCAGAAAAGTCTAAGTCTTATGAAAAAGAAAATAAAT

Example 3. Production and performance verification of a new porcine pleural pneumonia diagnostic kit using PNA probes

To detect porcine pleuropneumoniae (Serotype 1-8, positive A. pleuropneumoniae ), a fryer and a PNA probe were used to manufacture a product. In the case of a general detection kit using real-time PCR equipment, the reaction is carried out by mixing IPC (Internal Positive Control) to confirm that there is no problem in the polymerase chain reaction of the reaction solution. . Therefore, when IPC was added in the actual product, it was attempted to check whether there was an abnormality in analytical specificity.

3-1 Sensitivity Check

In the case of the experimental method, the conditions were the same as in FIG. 3, and in the case of the composition, the analysis was carried out with the composition shown in Table 2.

As a result, as a result of confirming the analytical sensitivity by adding IPC in the positive A. pleuropneumoniae diagnostic kit, the amplification curve and fusion curve threshold values were calculated for Serotype 1, 9, 11, 13, and 15 was 100 fg/ul, Serotype 10, 12 was 1 fg/ul, and Serotype 14 was confirmed to be detectable up to 250 ag/μl (100 copies) (FIG. 7).

The IPC sequence used is as shown in SEQ ID NO:34.

3-2 Confirmation of specificity

In the case of standard animal disease testing using clinical samples, in addition to the causative bacteria, various bacteria and tissue DNA of the specimen are mixed during the DNA extraction process, so non-specific reactions frequently occur, which may result in false-positive results. Therefore, in order to confirm the specificity of the kit, 3ul of each strain described in (A) of FIG. 8 was added, and the conditions were the same as in FIG. 3, and in the case of composition, analysis was performed with the composition shown in Table 2 proceeded.

As a result, as shown in FIG. 8 , it was confirmed that significant TM values were not observed in all probes except for IPC in bacteria other than porcine pleurisy, and it was confirmed that the specificity of the kit prepared in the present invention was very high.

In addition, the existing known multiplex PCR method ((Jessing, J Clin Microbiol, 2003, pp 4095-4100; Angen, O Vet Microbiol, 2008, pp. 312-318) and the method of the present invention were performed using 30 strains of domestic and outdoor isolates. As a result of comparison with the target, as shown in FIG. 9, 100% agreement was obtained.

By synthesizing the above results, when a porcine pleuropneumoniae (positive A. pleuropneumoniae ) diagnostic kit including IPC is produced, it was confirmed that the porcine pleuropneumoniae (positive A. pleuropneumoniae ) as shown in Table 3 can be determined.

Type Fluor. Tm (℃) A.pp spp. FAM 67 ± 2 Serotypes 10, 12, 13 HEX 68/56/47 ± 2 Serotype 14, 15 Quasar 75/66 ± 2 Serotypes 1, 9, 11 Cy5 69 ± 2 IPC TxR 61 ± 2

As a specific part of the present invention has been described in detail above, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe <130> P21-B035 <160> 34 <170> KoPatentIn 3.0 <210> 1 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> App common <400> 1 gccaccacag cca 13 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Serotype 1, 9, 11 <400> 2 aatggctagc ttagtc 16 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Serotype 10, 12, 13 <400> 3 ggtatggttg ccttaga 17 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Serotype 14, 15 <400> 4 ggcgtctgga gttc 14 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> IPC <400> 5 atccgaattc tcgttc 16 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Common F <400> 6 gccaccacag ccattatccg aactttggtt tagccgaga 39 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Common R <400> 7 catatttgat aaaaccatcc gtc 23 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Serotype 1, 9, 11_F <400> 8 gtataaggaa ttttttaatg aatattgcaa c 31 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Serotype 1, 9, 11_R <400> 9 gccactacat gcggtaagca ct 22 <210> 10 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Serotype 10_F <400> 10 ggtatggttg ccttagaggt ggtgatggaa caaggttatg g 41 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Serotype 10_R <400> 11 ttggaatagc gactctcctg atggaa 26 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Serotype 12_F <400> 12 ggtatggttg cattagagag ttaggttctt ctcccatctg ttgt 44 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Serotype 12_R <400> 13 ccttggttaa tgtatttcga agggaaagc 29 <210> 14 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Serotype 13_F <400> 14 ggtatagttg cattagaatg taaaggatct aagccgtgtg tatg 44 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Serotype 13_R <400> 15 gtcagatcaa ttctgaattc gatttagcg 29 <210> 16 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Serotype 14_F <400> 16 ggcgtctgga gttcgattct cgcttggaag caattcaaga tg 42 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Serotype 14_R <400> 17 cctatgtggt ttatcgaaat gcaatggg 28 <210> 18 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Serotype 15_F <400> 18 ggcatctgga gttcggggat cgaaaggcta tggtat 36 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Serotype 15_R <400> 19 ggaattcaga caacggtgca tttgatac 28 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IPC_F <400> 20 gctatcttgt tgggttcagg tgc 23 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IPC_R <400> 21 ggcacttatc attcattggc ggg 23 <210> 22 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Serotype1, 9, 11_F_Re <400> 22 gtataaggaa ttttttaatg aatattgcaa c 31 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Serotype1, 9, 11_R_Re <400> 23 gccactacat gcggtaagca ct 22 <210> 24 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Serotype10_F_Ref <400> 24 ggtatggttg ccttagaggt ggtgatggaa caaggttatg g 41 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Serotype10_R_Ref <400> 25 ttggaatagc gactctcctg atggaa 26 <210> 26 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Serotype12_F_Ref <400> 26 ggtatggttg cattagagag ttaggttctt ctcccatctg ttgt 44 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Serotype12_R_Ref <400> 27 ccttggttaa tgtatttcga agggaaagc 29 <210> 28 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Serotype13_F_Ref <400> 28 ggtatagttg cattagaatg taaaggatct aagccgtgtg tatg 44 <210> 29 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Serotype13_R_Ref <400> 29 gtcagatcaa ttctgaattc gatttagcg 29 <210> 30 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Serotype14_F_Ref <400> 30 ggcgtctgga gttcgattct cgcttggaag caattcaaga tg 42 <210> 31 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Serotype14_R_Ref <400> 31 cctatgtggt ttatcgaaat gcaatggg 28 <210> 32 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Serotype15_F_Ref <400> 32 ggcatctgga gttcggggat cgaaaggcta tggtat 36 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Serotype15_R_Ref <400> 33 ggaattcaga caacggtgca tttgatac 28 <210> 34 <211> 184 <212> DNA <213> Artificial Sequence <220> <223> IPC sequence <400> 34 tgttcttaga acaagatatt gggggattgc tatcttgttg ggttcaggtg ctttttgctt 60 ctctatccga attctcgttc tttatcataa aagttctccc ccgccaatga atgataagtg 120 cctaggtgaa gcatagtata agataagtca gaaaagtcta agtcttatga aaaagaaaat 180 aaat 184

Claims (11)

A PNA probe for detecting porcine pleural pneumonia capsular gene (capsular polysaccharide, cps) comprising at least one sequence selected from the group consisting of SEQ ID NOs: 1 to 4.
According to claim 1, wherein the PNA probe is a PNA probe for detecting the porcine pneumococcal capsular gene, characterized in that a reporter and a quencher are bound.
According to claim 2, wherein the reporter (reporter) is FAM (6-carboxyfluorescein), HEX, Texas red, JOE, TAMRA, CY5, CY3, or Alexa680 porcine pleurisy, characterized in that at least one selected from the group consisting of PNA probe for capsular gene detection.
The method according to claim 3, wherein the quencher is at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, BHQ3 and Dabcyl. PNA probe.
(i) a primer pair consisting of a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7;
(ii) a primer pair consisting of a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 9;
(iii) a primer pair consisting of a forward primer of SEQ ID NO: 10 and a reverse primer of SEQ ID NO: 11;
(iv) a primer pair consisting of a forward primer of SEQ ID NO: 12 and a reverse primer of SEQ ID NO: 13;
(v) a primer pair consisting of a forward primer of SEQ ID NO: 14 and a reverse primer of SEQ ID NO: 15;
(vi) a primer pair consisting of a forward primer of SEQ ID NO: 16 and a reverse primer of SEQ ID NO: 17; or
(vii) a primer pair consisting of a forward primer of SEQ ID NO: 18 and a reverse primer of SEQ ID NO: 19;
A pair of primers for amplifying the porcine pneumoconiosis capsular gene comprising a.
A composition for detecting a porcine pleural pneumococcal capsular gene comprising the PNA probe of any one of claims 1 to 4 and the primer pair of claim 5 .
According to claim 6, Internal control material; and a primer pair of SEQ ID NOs: 20 and 21, and a PNA probe of SEQ ID NO: 5 for detecting them.
A kit for diagnosing porcine pleurisy serotypes comprising the composition of claim 7.
A method for diagnosing porcine pleurisy serotypes comprising the following steps:
(a) isolating DNA from the specimen sample;
(b) amplifying the porcine pleural pneumococcal capsular gene using the primer pair of claim 5 to obtain an amplification product;
(c) hybridizing the amplification product with the PNA probe of any one of claims 1 to 4;
(d) determining the serotype of porcine pleurisy by analyzing the melting curve of the reactant hybridized in step (c).
[10] The method of claim 9, wherein step (b) further comprises amplifying an internal control material.
[11] The method of claim 10, wherein the amplification of the internal control material is performed using a pair of primers of SEQ ID NOs: 20 and 21, and detection is performed using a probe of SEQ ID NO: 5.

Images