KR102096025B1 - Primer set for loop-mediated isothemal amplification for toxin detecting of actinobacilus pleuropneumoniae and toxin detecting method of actinobacilus pleuropneumoniae using the same - Google Patents

Abstract

The present invention relates to a loop-based isothermal amplification primer set for detecting a porcine Actinobacillus pleuropneumoniae toxin, and a porcine Actinobacillus pleuropneumoniae toxin detection method using the same. More specifically, the present invention relates to a loop-based isothermal amplification method primer for detecting a porcine Actinobacillus pleuropneumoniae toxin Apx IA, and a method for detecting a porcine Actinobacillus pleuropneumoniae toxin Apx IA by using the same. The loop-based amplification method utilizing a primer of the present invention forms a loop-based amplification product by using six primer sets, and can thus obtain an amplification product in a much faster time compared to other nucleic acid amplification methods. A primer and an Apx IA toxin gene diagnostic method utilizing a loop-based isothermal amplification method using the primer according to the present can be used as important methods enabling early diagnosis and treatment of porcine pleuropneumonia.

Description

Primer set for ring-based isothermal amplification for detection of porcine pleural pneumococcal toxin and method for detecting porcine pleural pneumococcal toxin using the same

The present invention relates to a ring-based isothermal amplification primer set for detection of porcine pleural pneumococcal toxin and a method for detecting porcine pleural pneumococcal toxin using the same, more specifically, a ring-based isothermal amplification primer for detection of porcine pleural pneumococcal toxin Apx IA, and using the same Porcine pleural pneumococcal toxin Apx IA detection method.

Porcine pleural pneumonia is a disease caused by Apx toxin secreted by A. pleuropneumoniae , which causes symptoms such as high fever, vomiting, and edema, and in severe cases, most pigs die.

The causative microorganism of porcine pleural pneumonia (or causal factor, etiologic agent) affects weaning and slaughtering of pigs in weaning, but usually between 8 and 16 weeks of age. The incubation period is very short, 12 hours. The disease is so contagious that it can seriously damage the lungs and cause death. It spreads over short distances through droplet infection and lives only a few days outside the pig. Pig pleural pneumonia occurs frequently in individuals between 8 weeks and 24 weeks, and pig farms suffer huge losses when individuals from these nursing to fattening groups die in groups.

The pleural pneumonia in pigs progresses as quickly as possible after the onset of the disease, and causes mortality, and as it is a highly infectious disease, immediate detection and diagnosis are important. Pig pleural pneumonia has a vaccine for prevention, but is steadily developing, and serum Nucleic acid amplification methods such as PCR for classifying types exist, but diagnostic methods for classifying toxin types have not been developed.

As a method for diagnosing pleural pneumonia in pigs, there are bacterial methods and serological methods, but there are disadvantages that it is time consuming, expensive, and requires a professional manpower. Therefore, it is time to develop an early diagnosis method.

In addition, A. pleuropneumoniae , the causative agent of porcine pleural pneumonia, has a growing number of strains with antibiotic resistance. Therefore, it is necessary to accurately diagnose the type of toxin that is being secreted to avoid indiscriminate antibiotic prescription.

Apx toxin causes pleural pneumonia in pigs and causes enormous losses to pig farms and is an exotoxin secreted by Gram-negative bacteria called Actinobacillus pleuropneumoniae .

Apx toxin, the main cause of porcine pleural pneumonia, is classified into 4 types, I, II, III, and IV, and Apx toxin I is the most toxic. The Apx I toxin has strong hemolysis and cytotoxicity, and the Apx II toxin is characterized by weaker hemolysis and stronger cytotoxicity than the Apx I toxin. The Apx III toxin is a toxin that does not show hemolysis and shows cytotoxicity only. For these three toxins, different types of secretions appear depending on the serotype. The Apx IV toxin is a toxin secreted by all serotypes, has no hemolysis and cytotoxicity, only cAMP action and is secreted last. The Apx I toxin consists of C, A, B and D parts. Of these, part A is substantially a toxic part.

The Apx toxin is known to be composed of CABD operon, and among them, the Apx C gene plays a role in activating the Apx A gene, which is an inactive toxin. The Apx BD gene plays a role in making the Apx toxin out of the cells of the A. pleuropneumoniae strain. The part that shows substantial toxicity is the Apx A gene activated by the Apx C gene.

Currently, a PCR technique has been developed for the classification of serotypes of 13 strains that cause pleural pneumonia in pigs, but there is no way to classify and diagnose 3 Apx toxins (I, II, III).

Republic of Korea Patent Publication No. 1993-0000116

An object of the present invention is to provide a primer for detecting porcine pleural pneumococcal toxin Apx IA by ring-based isothermal amplification.

Another object of the present invention is to provide a method for detecting porcine pleural pneumococcal toxin Apx IA using the primer according to the present invention.

In order to solve the above problems, the present invention provides a primer set for ring mediation isothermal amplification for detection of porcine pleural pneumococcal toxin, comprising a primer set consisting of a nucleotide sequence represented by SEQ ID NOs: 1 to 6.

While conventional polymerase chain reaction (PCR) requires three temperature changes in denaturation, conjugation, and elongation, loop-mediated isothermal gene amplification (LAMP) DNA amplification reaction at one temperature Because this happens, there is no need for a special special machine (PCR machine) like the polymerase chain reaction. The LAMP (Loop-mediated Isothermal Amplification) isothermal amplification method can amplify the target nucleic acid to 10 ⁹ copies at 60 to 65 ° C within 1 hour, so it can be measured with a constant temperature maintaining device at about 64 to 65 ° C and the test time is 30 It is as short as -60 minutes and can be observed with the naked eye. DNA can be amplified easily and easily.

Specifically, in the loop-mediated isothermal gene amplification (LAMP), the inner primer (Inner-primer, FIP / BIF) is first bound to the DNA and stretched, and then the outer primer (outer-) outwardly of each DNA helix. Primer, B3 / F3c) is bound and stretched, and strand displacement occurs, and the first formed strands are separated. A loop structure is formed from the 5′-end of a single strand, which is separated, and the same process is repeated at the 3′-end and the loop structure is extended.

In order to solve the above problems, the present invention provides a primer set for ring mediation isothermal amplification for detection of porcine pleural pneumococcal toxin, comprising a primer set consisting of a nucleotide sequence represented by SEQ ID NOs: 1 to 6.

The primer set for ring mediation isothermal amplification for detection of porcine pleural pneumococcal toxin according to the present invention is characterized by detecting porcine pleural pneumococcal toxin Apx IA.

The present invention also provides a composition for detecting pleural pneumococcal toxin in pigs comprising the primer set for ring-mediated isothermal amplification according to the present invention.

Pig pleural pneumococcal toxin detection composition according to the present invention is characterized in that it further comprises leuco crystal violet as a color change reagent. The leuco-type dye is a colorless or light-colored dye, and refers to a dye that exhibits color by changing its structure by reaction with a developer or physical stimulus such as light. Oxidizing agents, alcohols, and the like are known as leuco-type coloring agents, but in the detection method of the present invention, a multi-chain nucleic acid functions as a developing agent. The amount of the detection reagent added to the sample is not particularly limited as long as the color can be determined by visible light, but is usually 10% or less, preferably 1% or less, and more preferably 0.1% or less. The detection reagent may contain a leuco dye.

The present invention also

A clinical sample collection step of collecting clinical samples from the lung tissue of pigs;

Isolating DNA from the sample;

Performing the ring-mediated isothermal amplification reaction using the DNA as a template and using the primer set according to the present invention; And

It provides a method for detecting a pig pleural pneumococcal toxin comprising; detecting the amplification product.

In the method for detecting porcine pleural pneumococcal toxin according to the present invention, in the step of performing the ring-mediated isothermal amplification reaction, the amplification reaction is performed at 60 ° C to 70 ° C for 40 minutes.

The present invention provides a primer for a ring-based isothermal amplification method capable of diagnosing the most toxic Apx I toxin among Apx toxins secreted by A. pleuropneumoniae in a very short time. The ring-based amplification method utilizing the primer of the present invention can obtain amplification products in a much faster time than other nucleic acid amplification methods by forming a ring-based amplification product using a primer set of six.

The Apx IA toxin gene diagnostic method using the primer according to the present invention and the ring-based isothermal amplification method using the same can be used as an important method for early diagnosis and treatment of porcine pleural pneumonia.

1 is a diagram showing a section used to construct a primer among the common nucleotide sequences using the Megalign program of the collected Apx IA toxins.
2 shows the location of primers constructed based on the sequence of the Apx IA toxin.
Figure 3 shows the results of the experiment to optimize the temperature conditions and primer concentration conditions of the ring-based isothermal amplification according to an embodiment of the present invention.
4 is a result of performing the experiment of the concentration condition of the inner primer of the ring-based isothermal amplification of the Apx IA gene according to an embodiment of the present invention. The lanes 1, 3, 5, 7, 9, and 11 are not added to the template, and the lanes 2, 4, 6, 8, 10, and 12 are added to the template. The experimental results were confirmed by 2.5% agarose gel electrophoresis, and showed good amplification efficiency without showing non-specific amplification in the experimental group using 0.2 uM of both Inner primer and Loop primer at 65 ° C.
5 is a result of the experiment for the time reduction of the ring-based isothermal amplification of the Apx IA gene according to an embodiment of the present invention. The lanes 1, 3, 5, and 7 have no template added, and the lanes 2, 4, 6, and 8 have added a template. The experimental results were confirmed through a 2.5% agarose gel electrophoresis, and when amplified for more than 40 minutes, showed a sufficient amount of amplification, and the time condition was set to 40 minutes.
6 is a result of performing an experiment for confirming the specificity of the ring-based isothermal amplification of the Apx IA gene according to an embodiment of the present invention. The lanes 1, 3, and 5 were not added to the template, and the lanes 2, 4, and 6 were added to the template. The experimental results were confirmed by 2.5% agarose gel electrophoresis, and the specificity for the Apx IA gene was verified because it showed no amplification for genes other than the ApxIA gene.
7 is a result of performing an experiment to confirm the sensitivity of the ring-based isothermal amplification of the Apx IA gene according to an embodiment of the present invention. Among the lanes, NC is an experimental group without a mold. The experimental results were confirmed through 2.5% agarose gel electrophoresis, and amplified to 2x10 ⁷ by diluting 2x10 ⁰ to 10x multiples of lane 1, and it was confirmed that amplification up to 2x10 ^-3 ng / ul template concentration was observed. .
8 is a result of performing a ring-based isothermal amplification experiment using DNA samples extracted from three strains obtained in the field of the Apx IA gene according to an embodiment of the present invention. The lanes 1, 3, and 5 of the lane do not add a template, and the lanes 2, 4, and 6 indicate that a template is added. The experimental results were confirmed through 2.5% agarose gel electrophoresis, and it was confirmed that the amplification appeared only for strains 1 and 2 having the ApxIA gene.
9 is a result of confirming whether or not amplification of an on-site strain DNA sample is amplified using a leuco crystal violet reagent according to an embodiment of the present invention. Strain samples 1 and 2 contain the ApxIA gene, and strain sample 3 does not contain the Apx IA gene. Lanes 1, 3, and-of 5 are amplification products without a template, and lanes 2, 4, and 6 are amplification products with a template addition. As a result of the experiment, it was confirmed that the color change appeared only for the amplified sample.

Hereinafter, the present invention will be described in more detail by examples. However, the present invention is not limited by the following examples.

<Example 1> Common nucleotide sequence construction of Apx IA toxin and ring-based isothermal amplification primer design

The Apx IA toxin sequence was collected through the NCBI to construct a common nucleotide sequence to “create” a “target” material for “detecting” the “gene of Apx IA” toxin. The most toxic Apx toxin, the main cause of porcine pleural pneumonitis, is the Apx I toxin, and the Apx I toxin consists of C, A, B, and D parts. Of these, part A is substantially a toxic part.

The collected 25 Apx IA toxin sequences were analyzed using the Megalign program and the results are shown in FIG. 1. The consensus nucleotide sequence of the “encoding” Apx IA toxin obtained was used as a template for performing ring-based isothermal amplification.

The ring-based isothermal amplification primer of the Apx IA gene was designed based on the 공통 constructed common nucleotide sequence, and the results are shown in FIG. 2.

The Apx IA sequence size is 3132 bp, of which the portion amplified with the outer primer of the primer set is 2334 bp to 2561 bp, and the size is 227 bp.

As shown in FIG. 2 and Table 1 below, a total of 6 primers are set with a pair of inner primers (FIP, BIP), a pair of outer primers (F3, B3), and a pair of loop primers (LF, LB). It was designed as.

Primer name Sequence number Sequence (5 '→ 3') ApxIA_F3 SEQ ID NO: 1 CGGTAACGACCATCTTGTTG ApxIA_B3 SEQ ID NO: 2 CCTTACCTAAACCACCGTAGA ApxIA_FIP SEQ ID NO: 3 TCATCGTCACCATCACCGCTGGTAACGGAAACGACCGA ApxIA_BIP SEQ ID NO: 4 GGTGGTGCGGGTAATGACA-ATTGCCTACACCACCGTCA ApxIA_LF SEQ ID NO: 5 AGGAAATTATTACCTTTTCCGCCGA ApxIA_LB SEQ ID NO: 6 TTCTGTATGGCAGCGATGGTAC

<Example 2> Apx IA gene ring-based template preparation for isothermal amplification

To obtain template DNA of the Apx IA toxin, PCR was performed using E. coli carrying the Apx IA gene inserted into the plasmid.

The composition of the reaction solution for the PCR reaction was 1X Ex taq buffer, 5 ul dNTP (2 mM each), F primer 1 ul, R primer 1 ul, template DNA 1 ul, taq polymerase 0.3 ul. PCR amplification was performed at 95 ° C for 4 minutes, followed by 30 cycles at 95 ° C for 30 seconds, 50 ° C for 30 seconds, and 72 ° C for 3 minutes and 30 seconds, followed by a 72 ° C 7-minute reaction.

As a template for the amplified Apx IA toxin, the purification of PCR products was carried out using a commercial PCR PCR kit (LaboPass ™ PCR Purification Kit; Cosmogenetech, Korea). The purified PCR product was used as template DNA for ring-based isothermal amplification.

<Example 3> Ring-based isothermal amplification reaction temperature conditions and primer concentration conditions

In order to set the temperature conditions and the primer concentration conditions of the isothermal amplification reaction, conditions experiments were conducted at various temperatures and primer concentrations.

The composition of the reactant was 2.5 ul of 10X isothermal buffer, 2.5 ul of dNTP (2 mM each), 1.5 ul of 100 mM MgSO ₄ , 4 ul of 5 M betaine, 1 ul of template DNA, and 1 ul of Bst 2.0 polymerase. For the primer, the concentration of the inner primer was fixed to 1.6 uM, and the experiment was conducted with only the concentrations of the outer primer and the loop primer as 0.2 uM, 0.4 uM, and 0.8 uM, respectively.

In order to confirm the presence or absence of non-specific amplification of the ring-based isothermal amplification method, amplified without a template was used as a control.

First, Bst 2.0 polymerase was excluded from the above composition, then mixed and heated at 95 ° C for 5 minutes to undergo template DNA denaturation. After cooling at room temperature for 5 minutes, Bst 2.0 polymerase was added to amplify for 1 hour at a total of 3 temperature conditions from 64 ℃ to 66 ℃, followed by an enzyme inactivation process at 85 ℃ for 1 minute.

The results of the amplification were confirmed through 2.5% agarose gel electrophoresis and are shown in FIG. 3. In FIG. 3,-in lanes 1, 3, 5, 7, 9, and 11 does not add a template, and + in lanes 2, 4, 6, 8, 10, and 12 means that a template is added. As shown in FIG. 3, as a result of the condition experiment, in the experimental group using 0.2 uM of both the Outer primer and the Loop primer at 65 ° C., it showed good amplification efficiency without showing non-specific amplification.

<Example 4> Setting the primer concentration conditions for the ring-based isothermal amplification reaction

According to the result of Example 3, the temperature condition was fixed at 65 ° C, and the following experiment was performed to set the primer concentration condition.

In order to set the concentration conditions of the inner primer, only the concentrations of the inner primer were 0.4 uM, 0.8 uM, and 1.6 uM. The Bst 2.0 polymerase was added for 5 minutes at 95 ° C and then 5 minutes at room temperature. 2.0 polymerase was added. After that, it was amplified at 65 ° C for 1 hour, and then subjected to an enzyme inactivation process at 85 ° C for 1 minute.

The results of the amplification were confirmed through 2.5% agarose gel electrophoresis, and are shown in FIG. 4. In FIG. 4,-of lanes 1, 3, 5, 7, 9, and 11 does not add a template, and + of lanes 2, 4, 6, 8, 10, and 12 means that a template is added.

As shown in Figure 4, the inner primer showed the highest amplification efficiency at a concentration of 0.8 uM. Accordingly, the concentration of the outer primer and the loop primer was set to 0.2 uM, and the concentration of the inner primer was set to 0.8 uM.

<Example 5> Ring-based isothermal amplification reaction time conditions set

In order to shorten the time of the isothermal amplification method based on the ApxIA gene ring, a total of four time condition experiments were conducted using the temperature and primer concentration conditions set above, and the result was shown in FIG. 5. It was confirmed through 2.5% agarose gel electrophoresis and is shown in FIG. 5.

In FIG. 5,-in lanes 1, 3, 5, and 7 does not add a template, and + in lanes 2, 4, 6, and 8 means that a template is added. The experimental results were confirmed by 2.5% agarose gel electrophoresis, and it was confirmed that sufficient amplification efficiency was exhibited at 40 minutes amplification, although not sufficient amplification at 30 minutes.

Through the above examples, the concentration of the “Inner primer for detection of“ gene ”of the Apx IA toxin was determined to be 0.8 uM, the outer primer and the loop primer were determined to be 0.2 uM, and the temperature condition for amplification was 65 ° C., and the amplification time was 40 minutes. Became.

<Example 6> Validity and specificity of Apx IA detection by ring-based isothermal amplification reaction

In order to confirm the specificity and sensitivity of the primer developed in the present invention, a ring-based isothermal amplification using real strain DNA was performed to confirm that it is amplified without over-amplification and “non-specific” reactions when amplified using a DNA sample of a real strain.

In order to confirm the specificity of the primer for detection of the Apx toxin IA gene of the present invention, the amplified product of the ApxIIA and ApxIIIA genes other than the ApxIA gene (IIA F primer (SEQ ID NO: 7): 5'-ACTCAAAAATCACTTTGTCATCAT-3 ', R primer ( SEQ ID NO: 8): PCR amplification using '5-AACACATCATCAAATTGGCTTC-3', IIIA F primer (SEQ ID NO: 9): 5'-ACAGTACTTGGTCAAGCATGT-3 ', R primer (SEQ ID NO: 10): 5'-AAAATATCTCTGAATTTACTACCT-3' Test). The composition and experimental conditions of the ring-based isothermal amplification method were carried out in the same manner as in Examples 2 to 6 above.

The results of the amplification were confirmed through 2.5% agarose gel electrophoresis and the results are shown in FIG. 6. As shown in Figure 6, as a result of the specificity experiment, when using the primers of the present invention, amplification was not observed in the experimental group using the ApxIIA and ApxIIIA genes as a template, and amplification was observed only in the experimental group using the ApxIA gene as a template. The specificity in the ring amplification reaction of the primers was confirmed.

In order to confirm the sensitivity of the primer of the present invention, a reaction was performed using a template in the range of 2x10 ⁰ ∼ 2x10 ^-6 ng / ul (diluted 10-fold). Amplification was confirmed by amplifying under the amplification conditions set in the above experiment. It can be seen from FIG. 7 that it is amplified to 2x10 ^-3 ng / ul.

<Example 7> Apx IA detection by ring-based isothermal amplification reaction for strain samples

Three types of A. pleuropneumoniae strains extracted from the actual field were cultured in chocolate agar. Of the three strains, 1 and 2 have Apx IA toxin, and 3 is a strain that does not have the Apx IA toxin gene.

Colonies were extracted with platinum before DNA extraction, suspended in 1X PBS and washed twice with PBS. Subsequently, the DNA of the strain was extracted using the Dokdo-Prep ™ Bacterial Genomic DNA Purification Kit (ElpisBiotech, Korea). DNA “extraction” was performed according to the “kit protocol” and using the “extracted” DNA as a template for amplification, it was confirmed whether the amplification in the strain DNA was performed using the composition and amplification conditions set in the above example.

The result of the amplification was confirmed by 2.5% agarose gel electrophoresis, and it was confirmed in FIG. 8 that the amplification was observed only in DNA samples of strains 1 and 2 having the ApxIA gene.

<Example 8> Apx IA detection by ring-based isothermal amplification reaction using color change reagent

To confirm the amplified product through the color change reagent, a leuco crystal violet reagent was used.

Leuco crystal violet was prepared by mixing a solution of 1.5 mM crystal violet, 180 mM sodium sulfite, and 15 mM b-cyclodextrin in a 1: 1: 1 ratio. 1 L of the leuco crystal violet solution was dispensed into the lid portion of the tube and dried in a heating block at 55 ° C. for 2 hours.

After dissolving the dried leuco crystal violet by dropping 5 L of the amplified product using the strain sample into the prepared leuco crystal violet tube, the color change was confirmed and shown in FIG. 8. As a result of the experiment in FIG. 9, it was confirmed that the color change appeared only for the amplified sample.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> PRIMER SET FOR LOOP-MEDIATED ISOTHEMAL AMPLIFICATION FOR TOXIN          DETECTING OF ACTINOBACILUS PLEUROPNEUMONIAE AND TOXIN DETECTING          METHOD OF ACTINOBACILUS PLEUROPNEUMONIAE USING THE SAME <130> DP-2018-0223-KR <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_F3 <400> 1 cggtaacgac catcttgttg 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_B3 <400> 2 ccttacctaa accaccgtag a 21 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_FIP <400> 3 tcatcgtcac catcaccgct ggtaacggaa acgaccga 38 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_BIP <400> 4 ggtggtgcgg gtaatgacaa ttgcctacac caccgtca 38 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_LF <400> 5 aggaaattat taccttttcc gccga 25 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ApxIA_LB <400> 6 ttctgtatgg cagcgatggt ac 22 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IIA F <400> 7 actcaaaaat cactttgtca tcat 24 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IIA R <400> 8 aacacatcat caaattggct tc 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IIIA F <400> 9 acagtacttg gtcaagcatg t 21 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IIIA R <400> 10 aaaatatctc tgaatttact acct 24

Claims (7)

Porcine pleural pneumococcal Apx I primer set for ring mediation isothermal amplification for detection of toxins comprising a primer set consisting of the nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 6.
According to claim 1,
The toxin is a porcine pleural pneumococcal toxin Apx IA
Pig pleural pneumococcal Apx I primer set for ring mediation isothermal amplification for toxin detection.
A composition for detecting a pleural pneumococcal Apx I toxin comprising the primer set for amplifying ring-mediated isotherm of claim 1.
A kit for detecting porcine pleural pneumococcal Apx I toxin, comprising the primer set for amplification of ring mediation of claim 1.
According to claim 4,
Kit for detecting pleural pneumococcal Apx I toxin, further comprising leuco crystal violet as a color change reagent.
A clinical sample collection step of collecting clinical samples from the lung tissue of pigs;
Isolating DNA from the clinical sample sample;
Using the DNA as a template, and performing a ring-mediated isothermal amplification reaction using the primer set according to claim 1; And
Detecting amplification products; Porcine pleural pneumococcal Apx I toxin detection method comprising a.
The method of claim 6,
In the step of performing the ring-mediated isothermal amplification reaction, the amplification reaction is performed at 60 ° C to 70 ° C for 40 minutes.
Porcine Pleural Pneumococcal Apx I toxin detection method.

Images