KR102098772B1 - Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR - Google Patents

Abstract

The present invention relates to a detection composition which extracts nucleic acid of a sample, is amplified using real-time PCR, analyzes a fluorescence signal generated by hybridizing the amplified target nucleic acid with a PNA probe containing a fluorescent substance by temperature, and enables simultaneous and rapid detection of adenoviruses by confirming that the same nucleotide sequence as specific gene markers for each of B, C, F, and G of adenovirus subtypes appears, to a kit, and to a detection method.

Description

Adenovirus subtypes B and C and adenovirus subtypes F and G screening detection primers and PNA probes and adenovirus real-time multiplex PCR detection methods using the same Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR}

The present invention relates to a composition, a kit for detecting adenovirus subtypes B, C, F and G using a gene marker for adenovirus detection, and a method for detecting the same.

The present invention is intended to detect the pathogen for each adenovirus subtype using Real-Time PCR from a specimen sample of a suspected adenovirus patient.

More specifically, the adenovirus gene is specifically amplified using primers that can be amplified to specifically detect adenovirus, a pathogen associated with acute respiratory infections, and adenovirus, a pathogen associated with intestinal infections. Then, a melting curve for each temperature is obtained through hybridization through temperature control with Peptide Nucleic Acid (PNA), which specifically recognizes the obtained amplification product for each pathogen. Using the obtained melting curve, a disease according to the subtype of the adenovirus can be specifically diagnosed in the corresponding sample.

In addition, the present invention requires rapid detection due to the nature of the disease, and thus, it can help prevent disease spread by presenting Fast PCR conditions that can shorten the detection time when performing conventional PCR.

Adenovirus (Adenovirus) is a medium-sized virus of the Adenovirus family with double-stranded DNA. It is a pathogen that causes 5 to 10% of the infant's upper respiratory tract diseases, but the symptoms are similar to those of other diseases. Adenovirus has various subtypes, which are divided into B and C subtypes that cause diseases in the upper airways or conjunctiva and can cause acute respiratory infections, and F and G subtypes that can cause intestinal infections in the intestine. In case of infection by adenovirus related to acute respiratory infections, high fever and throat of 39 degrees or higher are expressed, and in severe cases, complications such as pneumonia, otitis media and conjunctivitis may occur, and diarrhea, vomiting, and abdominal pain when infected by adenovirus related to intestinal infection You may suffer from high fever. In particular, the immunity is weak and it is easy to spread to infants and toddlers who live in a group life, and in some cases, it can cause fatal results. Since the pathology and the path of infection differ according to the subtype of these adenoviruses, the treatment method and the prevention method should be handled differently. For this reason, screening capable of specific distinction by subtype of adenovirus is essential.

As a method for diagnosing viruses, the medium detection method, which has been traditionally performed, was known only after a relatively long time was spent. As rapid detection and initial response are important for highly contagious pathogens, traditional methods have been somewhat inconsistent. Recently, various molecular diagnostic methods have been developed as a method for diagnosing pathogens, and generally, a serological method (ELISA) or a polymerase chain reaction (PCR) method is used. The serological method is an enzyme-linked immunosorbent assay (ELISA), which is a detection method using an antigen-antibody reaction, and ELISA generally has a shorter detection frequency and a longer analysis time than a PCR method. The polymerase chain reaction (PCR) amplifies the specific gene region of adenovirus and confirms the size by electrophoresis. If the confirmation is not clear (gray zone), verify the amplified PCR product by performing sequencing analysis. You have to go through the steps. This verification has the problem of additional analysis and additional time and manpower, and in the case of diseases requiring rapid drug prescription due to rapid diagnosis of pathogens, the application of general serological methods or traditional PCR methods can bring many disadvantages. .

In order to compensate for such shortcomings such as detection time and low sensitivity, real-time PCR has recently been introduced as a new molecular diagnostic method, and this technique should also be applied to a diagnostic method for detecting the pathogen virus at a time when it is applied in many fields. do. Based on these technological advances, the developers have newly discovered adenovirus detection genes for each subtype and use a peptide nucleic acid (PNA) and primer specific for the gene marker to display a real-time amplification curve and fusion curve. By completing the present invention, it was confirmed that there is an effect capable of quickly and accurately discriminating adenovirus.

The present invention proposes a method for detecting each type of adenovirus according to the above object, and includes a gene marker, a PNA probe for fluorescence measurement, a set of primers for amplification, and those necessary for detecting the pathogen virus. In providing a kit.

The present invention is to provide a method that can be applied to the optimal method in the field by developing each kit capable of real-time PCR and fast real-time PCR, including the primer and the PNA probe.

Accordingly, the final object of the present invention is to quickly identify and detect subtypes B, C, F, and G showing different pathologies among adenoviruses so that immediate response and appropriate treatment and prevention are possible.

In order to achieve the above object,

According to the disclosure of the present invention,

Primer set comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 ;,

A primer set comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; And

A primer set comprising the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6;

A primer composition comprising is provided.

In addition, according to the disclosure of the present invention,

(a) PNA probe for adenovirus subtype B specific detection comprising at least one nucleotide sequence of SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18

(b) a PNA probe for specific detection of adenovirus subtype C comprising at least one nucleotide sequence of SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21;

(c) PNA probes for adenovirus subtype F and G specific detection comprising at least one nucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24 are provided.

In addition, according to the disclosure of the present invention,

Provided is a composition and a kit for specific detection for each adenovirus subtype, wherein the primer composition further comprises at least one of the PNA probes of (a), (b) and (c).

In addition, according to the disclosure of the present invention,

A method for specifically detecting adenovirus for each subtype using the primer composition and the PNA probe is provided.

In addition, according to the disclosure of the present invention,

As the detection method, real-time analysis using real-time PCR and fast PCR conditions are provided for faster detection.

The present invention is the most common discovery of acute respiratory infections or intestinal infection viruses by selecting genes for adenovirus detection and detecting adenoviruses simply, quickly and accurately using primers and complementary PNA probes specific to the selected genes. There is an effect that can block the infection and spread of the virus that is being early.

1 is a conceptual diagram showing the cycle threshold (Ct) and Melt curve of the PNA probe operated by hybridization. When the temperature is increased in the hybrid forming body, hybrid dissociation occurs, resulting in fluctuations in signal of fluorescence, and analysis and display of fluorescence fluctuations according to changes in temperature (Tm).
2 is a conceptual diagram showing a method of generating the Melt peak Tm by the PNA probe.
Figure 3 shows the grouping by a subtype of adenovirus by analyzing the genes of adenovirus strains and constructing phylogenetic trees.
Figure 4 shows the location of specific primers and PNA probes identified by analyzing the genes of adenovirus strains.
5 shows PNA probe information for each subtype of adenovirus confirmed by analyzing genes of adenovirus strains.
Figure 6 confirms the melting peak (Tm) that occurs when the PNA probe binds to the selected genetic marker.
7, 8 and 9 are results obtained by using the adenovirus detection kit composition to obtain amplification curves and melting curve graphs according to the normal PCR condition method.
10, 11 and 12 are results obtained by using the adenovirus detection kit composition to obtain amplification curves and melting curve graphs according to the Fast PCR condition method.
13 is a representative diagram of detection of subtypes by normal PCR and fast PCR condition method using adenovirus detection kit composition.
14 is a sensitivity measurement result by the adenovirus detection kit composition.
15 is a specificity measurement result by the adenovirus detection kit composition.

The present invention may be achieved by the accompanying drawings and the following description. However, the following description should be understood as describing a preferred embodiment of the present invention, it should be understood that the present invention is not necessarily limited thereto.

All technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known in the art and commonly used.

Definitions of terms used in the specification of the present invention are as described below.

"Adenovirus subtype B or C" can be understood as an adenovirus that can cause acute respiratory infections and lead to complications such as high fever, pneumonia or otitis media.

"Adenovirus subtype F and G" can be understood as an adenovirus that can cause diarrhea, abdominal pain, high fever, or dehydration by intestinal infection. In the present invention, analysis results corresponding to subtype F and G will be derived. In this case, it can be understood that the detected adenovirus subtype is F or G is detected.

"Primer" can mean a short strand of DNA that provides 3'-OH so that the DNA polymerase can start synthesis during DNA synthesis, and in order to use this primer as a starting point during polymerase chain reaction (PCR) Can be used synthetically.

The term "Peptide nucleic acid probe (PNA probe)" is a similar DNA linked by a peptide bond rather than a phosphate bond. It is complementary to a gene to be amplified during a polymerase chain reaction to generate amplified gene in real time. It can be understood to be used for quantitative identification.

It can be understood that the term "gene marker" is a base sequence found only in a specific gene of adenovirus to be detected in the present invention, so that a subtype of each adenovirus can be specifically detected.

The term "complementary" means capable of hybridizing a base pair between nucleic acids, and can be said to be complementary with A and T (or U) or C and G.

“Hybridization” refers to a process in which double strands of complementary single-stranded nucleic acids form double strands. When the complementarity of both sequences is high, stable hybridization can be achieved. Hybridization is perfect when the complementarity between two nucleic acid strands is complete. match) or even in the presence of some mismatch base The degree of complementarity required for hybridization may vary depending on the hybridization conditions, and may be controlled in particular by temperature.

The term "Polymerase chain reaction (PCR)" may refer to a series of processes in which a large amount of identical DNA is amplified by repeating the initial template DNA (heating and cooling alternately). It requires (i) the template DNA to be amplified, (ii) a primer that serves as a starting point for replication, (i) DNA polymerase, an enzyme capable of synthesizing DNA, and (iii) dNTPs, which are materials for DNA.

The term "Real time PCR" can be understood as a PCR technique that enables real-time identification of quantitative information of the amplified gene. Here, the PNA probe combines with the amplified base sequence to generate fluorescence, which is dissociated and extinguished. Quantitative information can be obtained by measuring and analyzing phenomena.

"Fast PCR" is one of the PCR techniques, and can mean any PCR technique that can amplify a gene in a short time by simplifying the amplification process.

“Amplification” can refer to a series of reactions that occur repeatedly to form multiple copies of at least one segment of template DNA.

"Sample sample" includes a variety of samples and analyzes a biosample using the method of the present invention. More preferably, the culture sample from which the virus described in the present invention is isolated or infected with the pathogen (sputum, It can be a sample of whole blood, plasma, etc., and biological samples of human and bacterial origin can be analyzed, and the analyzed biological sample can be well analyzed by any cell, tissue, fluid, or the present invention from a biological source. Any other medium that can be included includes biological samples to be analyzed, including but not limited to blood, serum, plasma, lymph, ocular fluid, saliva and tissue extracts.

"Kit" can optionally include reagents typically required to perform target nucleic acid amplification reactions (such as PCR reactions) such as buffers, DNA polymerases and dNTPs. In addition, various polynucleotide molecules, reverse transcriptases, various buffers And reagents, etc. In addition, in the kit, the optimum amount of reagents used in a specific reaction can be easily determined by those skilled in the art who have learned the disclosure herein. May be prepared in a separate package or a compartment containing the aforementioned components, wherein the DNA polymerase may be Taq polymerase, but is not limited thereto.

-Outline of the present invention

The present inventors tried to diagnose a method for diagnosing adenovirus infection, real-time gene amplification of genes, and strain related to pathogenicity. As a result, after obtaining a specific gene for each subtype of adenovirus and amplifying it using a primer for detection corresponding to the gene, the adeno is a Tm value obtained by hybridization using a peptide nucleic acid probe (PNA probe). Viruses can be detected simply, quickly, and accurately by subtype.

In detail,

(1) Gene markers capable of specifically determining each adenovirus subtype are amplified with specific detection primers;

(2) obtaining an amplification curve through fluctuation of fluorescence generated while hybridizing the PNA probe and the amplified gene marker;

(3) obtaining a melting curve for each temperature generated by the PNA probe in the process of denaturation and recombination of the amplified double-stranded base sequence;

(4) By analyzing the amplification curve and the melting curve, adenovirus can be distinguished by subtype.

Therefore, in order to practice the present invention, a gene marker capable of specifically distinguishing adenovirus subtypes B, C, F and G is required, and a primer capable of amplifying this gene marker must be prepared, and the amplified gene marker In order to obtain the amplification curve and the melting curve, it is necessary to construct a PNA probe capable of achieving perfectly complementary binding to a genetic marker.

-Base sequence of gene marker

In order to construct primers and PNA probes for specifically detecting adenovirus subtypes B, C, F and G, specific target genes according to each subtype are required. To this end, nucleotide sequences registered in the nucleotide database of the National Center for Biotechnology Information (NCBI) were collected. Accordingly, “L1 gene” of adenovirus was selected and genetic analysis was performed. Through this, the nucleotide sequence of SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 was secured as a gene marker of adenovirus subtype B. In addition, the nucleotide sequences of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 were secured as genetic markers of adenovirus subtype C. Similarly, the nucleotide sequences of SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 were combined with adenovirus subtype F. It was secured by a common gene marker of G.

-Primer for detection according to adenovirus subtype

The primer is a short strand of DNA that is the starting point for DNA synthesis, and provides 3′-OH to the DNA polymerase. When amplifying the target nucleic acid, it serves to designate a starting point to amplify only the target nucleic acid, and various primers will be present depending on the target nucleic acid. The primer set (conventional primer pair) means to include a forward primer and a reverse primer.

According to an embodiment, the present invention specifically detects the adenovirus by aligning 208 genes representing Adenovirus subtype B and 87 genes representing Adenovirus subtype C, Influenzavirua known as a type of other respiratory virus A, Influenzavirus B, Parainfluenza virus 1, Parainfluenza virus 2, Parainfluenza virus 3, Parainfluenza virus 4a, Parainfluenza virus 4b, Respiratory syncytial virus A, Respiratory syncytial virus B, Metapneumovirus, Coronavirus OC43, Coronavirus 229E, Coronavirus NL63virus, Bocavirus And PNA probes in which strains or viruses such as Rhinovirus B are not detected.

In addition, by aligning 502 genes representing Adenovirus subtypes F and G, the adenovirus is specifically detected, but Salmonella spp., Shigella spp., E.coli spp. Vibrio spp. PNA probes that did not detect strains or viruses such as Norovirus GI, Norovirus GII, Rotavirus, Sapovirus GI, Sapovirus GII, and Sapovirus GIV were selected.

The base sequence represented by SEQ ID NO: 1 is a forward primer of adenovirus subtype B, and the base sequence represented by SEQ ID NO: 2 is a reverse primer of adenovirus subtype B. The base sequence represented by SEQ ID NO: 3 is a forward primer of adenovirus subtype C, and the base sequence represented by SEQ ID NO: 4 is a reverse primer of adenovirus subtype C. The base sequence represented by SEQ ID NO: 5 is a forward primer of adenovirus subtypes F and G, and the base sequence represented by SEQ ID NO: 6 is a reverse primer of adenovirus subtypes F and G. Accordingly, the present invention relates to a primer composition comprising a primer set for detecting adenovirus subtype B, a primer set for detecting subtype C, and a primer set for simultaneous detection of subtype F and G.

The base sequence of the primer provided in the present invention is a substantially identical base capable of adding, deleting, and replacing the base sequence within a range in which the amplification step conforms to the intention of the present invention in more detail in performing the present invention. It will include up to the sequence.

-PNA probe

Peptide nucleic acid (PNA) is a similar DNA in which nucleic acid bases are linked by peptide bonds rather than phosphate bonds. It was first synthesized by Nielsen et al. In 1991 and can be synthesized and used by artificial chemical methods since it is not found in nature.

PNA is a kind of DNA similar to LNA, and the basic skeleton is composed of polyamide. PNA has the advantage of being excellent in binding affinity and selectivity, and not being degraded by existing restriction enzymes due to its high stability to nucleic acid degrading enzymes. In addition, it is not easily decomposed due to its high thermal / chemical stability and easy storage, and the complementary base sequence forms double strands through a hybridization reaction with natural nucleic acids. The binding affinity of PNA is high, so the binding strength of PNA-DNA is high, and due to one nucleotide mismatch, the melting temperature (Tm) value differs by about 5 to 10 ° C. The difference in the binding force can be analyzed by the Tm value, and it is possible to detect a change in SNP and nucleotide of Insertion / Deletion using this.

The length of the PNA base sequence is not limited, but the Tm value is basically high due to the high binding force, and thus it can be produced in a short length. In the present invention, the adenovirus-specific base sequence was constructed to be 11 to 16mer long. At this time, since the Tm value of the PNA probe appears differently according to the sequence of the probe, it can be adjusted to have a desired Tm value, and the present invention is also designed to have a desired Tm value.

The PNA probe may bind a reporter and a quencher at both ends, fluorescence is generated by the reporter, and fluorescence is quenched by the quencher. In more detail, the PNA probe containing the reporter and the quencher of the present invention is hybridized with the target nucleic acid and then generates a fluorescence signal by the reporter. As the temperature rises, the target nucleic acid dissociates with the target nucleic acid at the proper melting temperature of the probe, thereby causing the quencher. The fluorescence signal is extinguished. The presence or absence of the base of the target nucleic acid can be detected through a high-resolution melting curve analysis obtained from the fluorescence fluctuation signal according to the temperature change. The PNA probe is characterized by exhibiting an expected melting temperature (Tm) value when a perfect match with the target nucleic acid sequence is achieved.

Depending on the difference between the nucleotide of the PNA probe and the nucleotide of the DNA that complementarily binds to it, the Tm value is also changed to facilitate development of an application using the Tm value. The PNA probe is analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe. Probes that play similar roles include molecular beacon probes and scorpion probes. There is.

The reporter (FAM) (6-carboxyfluorescein), HEX (2 ', 4', 5 ', 7'-tetra -chloro-6-carboxy-4,7-dichloro-fluorescein), Texas red, Alexa Fluoro Alexa Fluor, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, rhodamine red, TRITC (tetramethyl rhodamine isothiocyanate), FITC (fluorescein isothiocyanate), Oregon green, Cy5, JOE (6-carboxy-4 ＇, 5＇-dichloro-2＇, 7＇-dimethoxyfluorescein), ROX (6-carboxy-X -rhodamine), TAMRA (N, N, N ＇, N＇-tetramethyl-6-carboxyrhodamine) and TET (2＇, 7＇-dichloro-6-carboxy-4,7-dichloro -fluorescein) may be at least one selected from the composition, quenching The magnetic field may be at least one selected from the group consisting of BHQ1, BHQ3, Eclipse Deep Dark Quincher (DDQ), Iowa Black FQ, Iowa Black RQ, IRDye QC-1 and Dabcyl, but is not limited thereto. .

The present invention relates to a PNA probe that distinguishes adenovirus subtypes B, C, F and G represented by the nucleotide sequences of SEQ ID NOs: 16 to 24. According to an embodiment, the present invention specifically detects the adenovirus by aligning 208 genes representing Adenovirus subtype B and 87 genes representing Adenovirus subtype C, Influenzavirua known as a type of other respiratory virus A, Influenzavirus B, Parainfluenza virus 1, Parainfluenza virus 2, Parainfluenza virus 3, Parainfluenza virus 4a, Parainfluenza virus 4b, Respiratory syncytial virus A, Respiratory syncytial virus B, Metapneumovirus, Coronavirus OC43, Coronavirus 229E, Coronavirus NL63virus, Bocavirus And PNA probes in which strains or viruses such as Rhinovirus B are not detected.

In addition, by aligning 502 genes representing Adenovirus subtypes F and G, the adenovirus is specifically detected, but Salmonella spp., Shigella spp., E.coli spp. Vibrio spp. PNA probes that did not detect strains or viruses such as Norovirus GI, Norovirus GII, Rotavirus, Sapovirus GI, Sapovirus GII and Sapovirus GIV were selected. The PNA probe was prepared with the base sequence, reporter and quencher, and the PNA probe was synthesized by HPLC purification method in Panagene (Korea), and the purity of all synthesized probes was confirmed by mass spectrometry. The secondary structure of the probe was designed to avoid binding more effectively to the target nucleic acid.

The base sequence of the PNA probe provided in the present invention is practical in that the addition, deletion, and substitution of the base sequence can be performed within the scope in which the complementarity with the amplified target nucleic acid is more consistent with the intention of the present invention. It will include the same base sequence.

-Adenovirus subtype specific composition and kit

In another aspect, the present invention relates to a composition and a kit for specific detection for each adenovirus subtype including the primer and the PNA probe. The specific detection kit for each adenovirus subtype of the present invention includes a PNA probe containing a nucleotide sequence recognizing a specific nucleotide sequence, a forward / reverse primer set capable of amplifying a template template, and the primer set. It would be sufficient to have a template for the gene to be amplified, template sequencing, dNTPs, a DNA polymerase, and a PCR premix in which a series of PCR reactions can occur, but also include constructs that can be envisioned by those skilled in the art. will be.

The primer composition included in the kit of the present invention includes a primer set comprising the nucleotide sequence of SEQ ID NO: 1 and 2, a primer set comprising the nucleotide sequence of SEQ ID NO: 3 and 4, and a primer comprising the nucleotide sequence of SEQ ID NO: 5 and 6 Contains a set. In addition, in another kit of the present invention, the PNA probe for adenovirus subtype B specific detection represented by SEQ ID NOs: 16, 17 and 18, and the PNA probe for adenovirus subtype C specific detection represented by SEQ ID NOs: 19, 20 and 21 And it also includes a primer composition characterized in that it further comprises at least one of the PNA probe for adenovirus subtype F and G specific detection represented by SEQ ID NOs: 22, 23 and 24. When using a kit containing the PNA probe, the presence of the target nucleic acid can be effectively detected through amplification and melting curve analysis by the PNA probe, and it is easy to detect and diagnose diseases by subtype of adenovirus.

-Specific detection method for each adenovirus subtype

The present inventors compared and analyzed the gene sequence using NCBI blast data with respect to the subtype of the adenovirus, and secured the nucleotide sequence represented by SEQ ID NOs: 7 to 15 as a gene marker for each adenovirus subtype. Using the gene marker as template DNA, primers for detection for amplification by PCR were prepared, which were expressed as nucleotide sequences of SEQ ID NOs: 1-6. Using this, the melting temperature (Tm) of each adenovirus subtype was confirmed from the amplification curve and the melting curve obtained by hybridizing the PNA probe to the double-stranded PCR amplification product, to specifically detect each adenovirus and detect the pathogen Infection was confirmed.

Therefore, in the method for detecting each adenovirus subtype of the present invention,

(a) applying the target nucleic acid extracted from the sample sample to the experiment;

(b) Amplifying the nucleotide sequence of a specific gene marker using a primer represented by the nucleotide sequence of SEQ ID NO: 1 to 6 using the nucleotide sequence of the target nucleic acid as a template, and adeno represented by the nucleotide sequence of SEQ ID NO: 16 to 24 Determining a real-time amplification curve by measuring fluorescence generated by hybridization with a PNA probe for detection for each virus subtype;

(c) obtaining a melting curve for each temperature generated by the PNA probe in the process of denaturation and recombination of the amplified double-stranded base sequence;

(d) detecting the adenovirus subtype through analysis of the amplification curve and the melting curve obtained in step (a-c);

It relates to a specific detection method for each adenovirus subtype, including, (a)-(d) the conditions and time to perform the step can be selected in a range that is easy to those skilled in the art.

The PCR conditions can use the existing method, and after the PCR is completed, a melting process is required and the intensity of fluorescence is measured every 1 ° C to increase the Tm value. In particular, a general real-time PCR (real-time PCR) device is widely used and has an advantage of not requiring additional program purchase or detailed temperature change, such as high resolution melting (HRM).

Meanwhile, in the present invention, a Fast PCR detection method can be used in addition to the PCR conditions of the existing method. In the normal PCR condition, the time for (b) and (c) to be performed is 140 to 150 minutes, and for the fast PCR condition, the time for (b) and (c) to be performed does not exceed 70 to 90 minutes. More preferably, it is characterized in that it does not exceed 70 to 80 minutes under Fast PCR conditions. In this case, it is possible to shorten the detection time by 60 to 80 minutes than the kit using the conventional conventional PCR method, so that adenovirus can be rapidly detected with equal or superior specificity in a shorter time, and analyzed simultaneously to analyze adenovirus subtype B, Detection is possible by distinguishing C, F and G.

In the present invention, the melting curve analysis may be characterized in that it is performed by the FMCA (Fluorescence Melting Curve Analysis) method.

-Real-Time PCR

Real-time PCR (Real-Time Polymerase Chain Reaction) method of the present invention, in order to confirm the amplification process in real time, allows the fluorescent material to be hybridized to a single stranded DNA chain in the PCR process and the PCR product With amplification, it is confirmed in such a way that the intensity of fluorescence gradually increases. After the PCR is over, the temperature is increased to release the DNA-PNA hybridization strands, and the intensity of the existing fluorescence gradually decreases, resulting in a melting curve, and the temperature (Tm) at which the DNA-PNA, a pattern of the melting curve, melts (denaturs). By analyzing, it is possible to detect or discriminate a specific adenovirus subtype with or without a specific base sequence. The conventional PCR method can determine the target gene size and determine the amplification degree by electrophoresis, making it impossible to make a quantitative determination in real time. If the size of the target gene is not known, sequencing analysis of the amplified PCR product is performed. Additional verification steps, such as the need to do so, are required. When it is necessary to detect an infectious disease that requires rapidity, the existing method was inconsistent, and a real-time PCR method emerged.

-Fluorescence Melting Curve Analysis (FMCA)

The analysis of the melting curve of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed by a target nucleic acid DNA and a PNA probe. Since such a method is performed by, for example, Tm analysis or analysis of the melting curve of the double chain, it is called melting curve analysis. A probe complementary to a specific nucleotide sequence to be detected is used to form a hybrid of the target DNA of the detection sample and the probe. Subsequently, the hybrid forming body is subjected to a heat treatment, and dissociation (melting) of the hybrid according to an increase in temperature is detected by fluctuation of signals such as absorbance. And it is a method of determining presence or absence of a specific nucleotide sequence by determining a Tm value based on this detection result.

The Tm value is higher as the homology of the hybrid formation is higher, and lower as the homology is lower. For this reason, the Tm value (evaluation reference value) is obtained in advance for the hybrid form of the specific base sequence to be detected and the probe complementary to it, and the Tm value (measured value) between the target single-stranded DNA of the detection sample and the probe is measured. By measuring, it can be determined that a specific nucleotide sequence is present in the target DNA if the measured value is the same as the evaluation reference value, and if the measured value is lower than the evaluation reference value, it may be determined that there is a mismatch, that is, a mutation in the target DNA. .

Fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent material, and more specifically, a melting curve can be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, or an intercalating fluorescent material.

Hereinafter, the present invention may be better understood by the following examples, and the following examples are for illustrative purposes of the present invention and are not intended to limit the protection scope defined by the appended claims. . From the detailed description and examples of the present invention, what can be easily inferred by experts in the technical field to which the present invention pertains is interpreted as belonging to the scope of the present invention.

Example 1: Gene marker for adenovirus detection, and primer and PNA probe specific for the virus

To produce a primer and PNA probe for detecting adenovirus, “L1 gene” was selected as the target gene, and the National Center for Biotechnology Information (NCBI) of the US National Center for Biotechnology Information (NCBI) The nucleotide sequences registered in the nucleotide database (nucleotide database) were collected and 208 genes representing Adenovirus subtype B (Table 1) and 87 genes representing Adenovirus subtype C (Table 2) and Adenovirus subtypes F and G were collected. Genetic analysis was performed on the representative 502 genes (Tables 3 and 4) to prepare a consensus base sequence, and the gene markers were selected by analysis.

Subtype Accession number Adenovirus B KY021432.1, KY021431.1, KY021430.1, KY021429.1, KY021428.1, KY021427.1, KY021426.1, JQ824845.1, JN032132.1, FJ822614.1, JX892927.2, KP896482.1, AY803294. 1, KY471323.1, KY471322.1, KY471321.1, KY471320.1, KY471319.1, KY471318.1, KX494979.1, JX491639.1, JX423384.1, JX123027.1, KP896484.1, KP896483.1, KP896478.1, KX289874.1, KY780933.1, KY780932.1, KY780931.1, KY070248.1, KC857701.1, KJ883522.1, KJ883521.1, JX423385.1, JX123029.1, JX123028.1, FJ597732. 1, FJ643676.1, KP279748.1, KJ883520.1, KF906413.1, LC177352.1, KF908851.1, KF268121.1, EF564600.1, EF011630.1, AY598970.1, AF532578.1, AY163756.1, KF268124.1, AY271307.1, AY128640.2, KF268196.1, AY737797.1, KT970442.1, KT970441.1, KF268328.1, KT970440.1, FJ025911.1, FJ025927.1, FJ025915.1, HQ292614. 1, FJ025929.1, FJ025928.1, FJ025913.1, KF633445.1, FJ025916.1, FJ025914.1, FJ025910.1, KT069550.1, MF502426.1, KY307858.1, KJ364590.1, KJ364589.1, KJ364587.1, KJ364584.1, KJ364582.1, KJ364581.1, KJ364579.1, KJ364577.1, KJ364576.1, KJ364573.1, KF52 8688.1, KF577595.1, FJ025930.1, FJ025912.1, FJ025909.1, FJ025908.1, AY601633.1, KY307859.1, KY307857.1, KJ364592.1, KJ364591.1, KJ364588.1, KJ364586.1, KJ364585.1, KJ364583.1, KJ364580.1, KJ364578.1, KJ364575.1, KJ364574.1, KF938575.1, KF802426.1, KF802425.1, KF577598.1, KF577597.1, KF577593.1, AY737798. 1, KY307860.1, JN860679.1, KP896481.1, KP896480.1, KP896479.1, KT069556.1, KF268210.1, MG736304.1, MG736303.1, MG696149.1, MG696148.1, MG696147.1, MG696146.1, MG696145.1, MG696144.1, MG696143.1, MG696142.1, MG696141.1, MG696140.1, MG696139.1, MG696138.1, MG696137.1, MG696136.1, MG696135.1, MG696134. 1, MG696133.1, MG696132.1, MG696131.1, MG696130.1, MG696129.1, MG696128.1, MG923582.1, MG923581.1, KX897164.1, KU361344.1, KT963081.1, KP670856.2, KP670855.2, KP670860.1, KP670858.1, KP670857.1, KJ019888.1, KJ019887.1, KJ019886.1, KJ019885.1, KJ019884.1, KJ019883.1, KJ019882.1, KJ019881.1, KJ019880. 1, KJ019879.1, KC440171.1, KC857700.1, KF268316.1, KF268314.1, KF268212.1, KF268202.1, KF268135 .1, KF268132.1, KF268131.1, KF268128.1, KF268126.1, KF268125.1, KF268117.1, JX625134.1, JX423388.1, JX423387.1, JX423386.1, JX423383.1, JF800905.1 , JN860677.1, JN860676.1, AY601634.1, AY599836.1, AY594255.1, KF268315.1, KF268134.1, JN860678.1, HQ659699.1, GQ478341.1, AY495969.1, EF564601.1, AY601636 .1, AY599834.1, AY594256.1, DQ086466.1, KY320276.1, KF268311.1, KF268123.1, KF268120.1, JX423382.1, JX423380.1, DQ105654.4, DQ099432.4, KX384958.1 , KF268133.1, JX423381.1, JN860680.1, KF268195.1

Subtype Accession number Adenovirus C KX384959.1, J01917.1, MF681662.1, KF268310.1, JX173086.1, JX173085.1, JX173083.1, JX173078.1, MF315029.1, MF315028.1, LC068715.1, LC068714.1, LC068713. 1, LC068712.1, KR699642.1, KF951595.1, JX173079.1, JX173077.1, HQ003817.1, LC068720.1, LC068719.1, LC068718.1, LC068717.1, JX423389.1, JX173081.1, JX173080.1, HQ413315.1, JX173084.1, AF534906.1, KF268130.1, FJ349096.1, JX173082.1, KM190941.1, KF268199.1, KF429754.1, KF268127.1, AY339865.1, AY601635. 1, X02996.1, M73260.1, LC068716.1, KF268129.1, U52533.1, KC543426.1, U52532.1, KF999653.1, KC543431.1, KC543430.1, KC543429.1, KC543437.1, KC543427.1, KC543436.1, KC543432.1, KC543428.1, KF999651.1, KF999652.1, M10228.1, KJ364588.1, KF633445.1, KF633445.1, KJ364590.1, KJ364589.1, KJ364587. 1, KJ364586.1, KJ364584.1, KJ364582.1, KJ364581.1, KJ364579.1, KJ364578.1, KJ364577.1, KJ364576.1, KJ364574.1, KJ364573.1, KY307857.1, KJ364585.1, KJ364583.1, KJ364580.1, KJ364575.1, KF528688.1, KF528688.1, KF802425.1, KF577598.1, KF577597.1, AY601633.1, AY60 1633.1, KJ364591.1, KF938575.1

Subtype Accession number Adenovirus F and G MF962524.1, MF962523.1, MF962522.1, MF962521.1, MF962520.1, MF962519.1, MF962515.1, MF962511.1, MF962507.1, MF962500.1, MF962498.1, MF962496.1, MF962489. 1, HQ005283.1, MF962531.1, MF962529.1, MF962528.1, MF962527.1, MF962508.1, MF962505.1, MF962502.1, MF962501.1, MF962495.1, MF962493.1, GQ477376.1, MF962490.1, KR001862.1, KY969002.1, KF495154.1, KY969004.1, FJ167556.1, AH002308.2, AH002308.2, KF495163.1, KF495182.1, FJ167557.1, KF495169.1, KF495164. 1, JF699089.1, JF699085.1, JF699082.1, KF495170.1, MF962535.1, JF699088.1, MG517307.1, MF962532.1, KM099405.1, EF373531.1, GQ507425.1, EF397592.1, MF962534.1, MF962533.1, GU564473.1, KT832678.1, KX570632.1, KX570631.1, KX570630.1, HG976898.1, KT832674.1, AJ608280.2, AJ608284.1, LN612596.1, JN654710. 1, JN654703.1, KR001863.1, JN654712.1, JN654709.1, JN654707.1, JN654704.1, HQ268790.1, GU569847.1, DQ464892.1, KY969003.1, HQ268782.1, AY819810.1, JX412903.1, KM103666.1, AJ608281.1, AY819812.1, HQ268785.1, KP165516.1, AJ608283.2, KJ425121.1, HQ26 8788.1, JX412899.1, HQ268784.1, AY819813.1, DQ464891.1, AY819811.1, HQ268786.1, DQ464893.1, HQ268783.1, MH013442.1, MH013455.1, MH013448.1, JX412865.1, MH013457.1, MH013451.1, MH013450.1, MH013445.1, MH013443.1, MH013439.1, KC953653.1, KC953652.1, KC953631.1, LT628548.2, KC953654.1, JX412910.1, MH013454. 1, MH013438.1, KX570635.1, KX570634.1, KX570633.1, KC953633.1, GQ925258.1, HG976897.1, AJ608279.2, JX412912.1, JX412905.1, JX412876.1, JX412870.1, HQ268787.1, MH013461.1, MH013453.1, KF669145.1, KF669120.1, HG976902.1, KC953661.1, KC953658.1, KF669135.1, JX412896.1, JX412868.1, HQ268775.1, DQ504431. 1, KC953656.1, JX412873.1, JX412872.1, AJ608282.2, KF669130.1, JX412880.1, MH013440.1, MH013437.1, KC953645.1, KF669140.1, KF669127.1, JX412875.1, KC953651.1, KC953649.1, KC953642.1, KF669117.1, HQ268777.1, DQ504432.1, KF669124.1, JX412898.1, JX412906.1, JX412904.1, JX412863.1, MH013459.1, JX412886. 1, KC953637.1, KF669141.1, KF669123.1, KF669122.1, KF669125.1, JX412867.1, AM920715.1, KC953632 .1, JX412908.1, JX412900.1, JX412889.1, JX412878.1, KU641144.1, KC953660.1, KC953630.1, KF669142.1, KF669118.1, JX412909.1, JX412907.1, JX412894.1 , JX412884.1, KF669132.1, KF669132.1, JX412866.1, KT832673.1, KC953646.1, KF669136.1, MG199364.1, JX412902.1, JX412860.1, KC953662.1, JX412862.1, JX412869 .1, AM406793.1, KC953659.1, JX412885.1, KF669137.1, JX412883.1, KU641142.1, KJ425117.1, JX412882.1, AM920722.1, AJ617298.1, MG199387.1, KC953641.1 , KF669138.1, JX412897.1, JX412861.1, JX412901.1, JX412887.1, KJ425146.1, KJ425123.1, KJ425119.1, JX412891.1, JX412890.1, KF432189.1, AM920721.1, KF669114 .1, JX412881.1, KJ425126.1, MG199381.1, MG199380.1, MG199379.1, MG199378.1, MG199377.1, MG199376.1, MG199375.1, MG199374.1, MG199373.1, MG199372.1 , MG199371.1, MG199370.1, KC953636.1

As a result, a 5'-CCCATGTCAAAGT-3 'represented by SEQ ID NO: 7 as a biomarker of adenovirus subtype B, a 5'-AGAGCTCTTTGC-3 of SEQ ID NO: 8, and a 5'-CTCTTCTATGTAAGG-3' sequence of SEQ ID NO: 9 Three types were obtained and 5'-CCGCATGGATCA-3 'represented by SEQ ID NO: 10 as a biomarker of adenovirus subtype C, 5'-TTGTCTGACGTC-3' represented by SEQ ID NO: 11, and 5'-GGCGGTAACCG- of SEQ ID NO: 12 Three 3 'nucleotide sequences were secured. In addition, as a common biomarker of adenovirus subtype F and G, 5'-CGCACTTTGTAAGA-3 'of SEQ ID NO: 13, 5'-CTGGCCATGTC-3 of SEQ ID NO: 14 and 5'-CGCGGATGTCAA-3' of SEQ ID NO: 15 base sequence 3 Species were selected as candidates.

 5'-ACTTTGACATGGG-3 ', which is the nucleotide sequence of SEQ ID NO: 16 for detecting adenovirus subtype B from the base sequence selected as the gene marker for adenovirus detection in the above, 5'-GCAAAGAGCTCT-3' and sequence of SEQ ID NO: 17 Three 5'-CCTTACATAGAAGAG-3 'nucleotide sequences of No. 18 were produced with PNA probes, and 5'-TGATCCATGCGG-3' of SEQ ID NO: 19, 5'- of SEQ ID NO: 20 to detect adenovirus subtype C GACGTCAGACAA-3 'and 3 kinds of 5'-CGGTTACCGCC-3' nucleotide sequences of SEQ ID NO: 21 were prepared as PNA probes. In addition, 5'-TCTTACAAAGTGCG-3 'represented by SEQ ID NO: 22, 5'-GACATGGCCAG-3' represented by SEQ ID NO: 23 and 5'-TTGACATCCGCG-3 represented by SEQ ID NO: 23 to detect adenovirus subtypes F and G 'The above three nucleotide sequences were prepared with a PNA probe.

In addition, 5'-GACAGRGAACTKATGCACAG-3 ', 5'-GCGAGTACYTGGAAGACTG-3', adenovirus represented by SEQ ID NOs: 1 and 2, which amplifies specific adenovirus subtype B for adenovirus detection including the genetic marker selected above. 5'-AAATTCGCAAGGGTATCATGGC-3 ', 5'-TTGGCTTMYTTCCAGGCGC-3' represented by SEQ ID NOS: 3 and 4 amplifying subtype C and 5'-CCACGATGTRACCACRGA-3 represented by SEQ ID NOS: 5 and 6 amplifying adenovirus subtypes F and G A ', 5'-TCGTGGCCCCAGCTTTAA-3' primer was prepared. The mixed bases R, M, Y and K used in the primers for amplifying the adenovirus were expressed based on the official base code as shown in Table 5.

IUPAC nucleotide code Base A Adenine C Cytosine G Guanine T (or U) Thymine * or Uracil) R A or G Y C or T S G or C W A or T K G or T M A or C B C or G or T D A or G or T H A or C or T V A or C or G N any base

The gene of adenovirus strains in FIG. 3 was analyzed to construct a phylogenetic tree and grouping was confirmed for each subtype of adenovirus. As shown in FIGS. 4 and 5, primers and PNA probe sites derived from base sequences for each adenovirus subtype And the information of the PNA probe was indicated.

division Sequence number Sequence (5 '-> 3') transform goal primer SEQ ID NO: 1 GACAGRGAACTKATGCACAG Adenovirus B primer SEQ ID NO: 2 GCGAGTACYTGGAAGACTG primer SEQ ID NO: 3 AAATTCGCAAGGGTATCATGGC Adenovirus C primer SEQ ID NO: 4 TTGGCTTMYTTCCAGGCGC primer SEQ ID NO: 5 CCACGATGTRACCACRGA Adenovirus
F and G primer SEQ ID NO: 6 TCGTGGCCCCAGCTTTAA Gene marker SEQ ID NO: 7 CCCATGTCAAAGT Adenovirus B Gene marker SEQ ID NO: 8 AGAGCTCTTTGC Gene marker SEQ ID NO: 9 CTCTTCTATGTAAGG Gene marker SEQ ID NO: 10 CCGCATGGATCA Adenovirus C Gene marker SEQ ID NO: 11 TTGTCTGACGTC Gene marker SEQ ID NO: 12 GGCGGTAACCG Gene marker SEQ ID NO: 13 CGCACTTTGTAAGA Adenovirus
F and G Gene marker SEQ ID NO: 14 CTGGCCATGTC Gene marker SEQ ID NO: 15 CGCGGATGTCAA PNA probe SEQ ID NO: 16 ACTTTGACATGGG FAM, Dabcyl Adenovirus B PNA probe SEQ ID NO: 17 GCAAAGAGCTCT PNA probe SEQ ID NO: 18 CCTTACATAGAAGAG PNA probe SEQ ID NO: 19 TGATCCATGCGG FAM, Dabcyl Adenovirus C PNA probe SEQ ID NO: 20 GACGTCAGACAA PNA probe SEQ ID NO: 21 CGGTTACCGCC PNA probe SEQ ID NO: 22 TCTTACAAAGTGCG HEX, Dabcyl Adenovirus
F and G PNA probe SEQ ID NO: 23 GACATGGCCAG PNA probe SEQ ID NO: 24 TTGACATCCGCG

In addition, as shown in Table 6, a PNA probe was prepared with a base sequence, a reporter, and a quencher. The PNA probe was synthesized by HPLC purification method in Panagene (Korea), and the purity of all synthesized probes was confirmed using mass spectrometry. Did. The secondary structure of the probe was designed to avoid binding more effectively to the target nucleic acid.

Example 2: PNA Tm confirmation oligo test results

Using the PNA probe prepared in Example 1, a template oligomer was produced as a target of the PNA probe by confirming the Tm value generated when binding to the adenovirus gene marker. The template oligomer was sequenced as a complementary sequence to the PNA probe, and proceeded to confirm the Tm value generated when the PNA probe was bound. The above analysis method was performed using a CFX96 ^TM Real-Time system (Bio-Rad, USA), and the composition was 10pmole PNA probe 1ul, Normal qPCR 2X PreMIX (TNS, Korea) 10ul, oligomer 1ul, Destilled water based on 1test. The mixture was mixed to a total volume of 20 ul.

Fluorescence was taken at 95 ° C for 2 minutes and 50 ° C to 80 ° C at 1 ° C for 5 seconds.

As a result, as shown in Figure 6, SEQ ID NO: 16 capable of detecting adenovirus subtype B, SEQ ID NO: 62 was confirmed, Tm of 62 ° C and SEQ ID NO: 18 was 63 ° C, and adenovirus subtype C was identified. The detectable sequence number 19 was 64 ° C, the sequence number 20 was 65 ° C, and the sequence number 21 was Tm of 59 ° C. Adenovirus subtypes F and G that can be commonly detected were SEQ ID NO: 22 at 59 ° C, SEQ ID NO: 23 at 63 ° C, and SEQ ID NO: 24 at 62 ° C.

Example 3: Optimization of real-time gene amplification adenovirus kit

Using the primer prepared in Example 1, an amplification curve and a lysis curve were derived for the adenovirus nucleic acid sample, and this was analyzed to optimize real-time gene amplification confirmation conditions. Real-time PCR reaction was performed using the CFX96 ^™ Real-Time system (Bio-Rad, USA). 1 pmol forward primer 1 ul and 10 pmol reverse primer 1 ul were used as the composition for 1 test, and PNA probe Is 10 pmol PNA probe 1 ul each, Normal qPCR 2X PreMIX (TNS, Korea) 10ul, DNA 1 ~ 5ul and Destilled water maximum volume 20 ul was mixed, Table 7 was subjected to real-time gene amplification under the reaction conditions.

Normal PCR conditions Temperature (℃) Reaction time and cycle Reaction time Gene amplification and real-time gene identification 95 10 min 143 min 95 30 sec 45 cycle 55 * 30 sec 72 30 sec Melting ** 95 2 min 50 to 80 Increment 1.0 ℃, 5 sec (FAM, HEX) In step *, real-time gene amplification is confirmed by fluorescence imaging.
** In this step, fluorescence is taken to obtain a melting curve.

As a result, as shown in FIGS. 7, 8 and 9, adenovirus could be detected for each subtype using a real-time gene amplification method.

Through analysis using the PNA probes SEQ ID NOs: 16, 17 and 18 to detect adenovirus subtype B, SEQ ID NO: 16 shows the results of the amplification curve 20 and the melting curve of 61 ° C, and SEQ ID NO: 17 shows the results of the amplification curve 23 and the melting curve of 64 ° C. Although confirmed, SEQ ID No. 18 is not confirmed in the amplification and fusion curves, so it is presumed that PNA binding is not smoothly performed.

Through analysis using PNA probes SEQ ID NOs: 19, 20 and 21 to detect adenovirus subtype C, SEQ ID NO: 19 shows the results of the amplification curve 20 and the melting curve of 62 ° C, and SEQ ID NO: 20 of the amplification curve 27 and the melting curve of 59 ° C. Although confirmed, SEQ ID No. 21 was not confirmed in the amplification and fusion curves, and it is assumed that PNA binding is not smoothly performed.

Through analysis using the PNA probes SEQ ID NOs: 22, 23, and 24 for common detection of adenovirus subtypes F and G, SEQ ID NO: 22 was identified as an amplification curve 25 and a melting curve of 56 ° C, and SEQ ID NO: 24 was fused with an amplification curve 28 The result of the curve 60 ° C was confirmed. SEQ ID NO: 23 does not confirm the results on the amplification and fusion curves, and is seen as an unexpected PNA complementary problem based on a negative signal.

Example 4: Optimization of high-speed real-time gene amplification adenovirus kit

Fast PCR conditions were established to detect faster adenoviruses in the field where rapid detection is required.

Fast real-time gene amplification reaction was performed using CFX96 ^™ Real-Time system (Bio-Rad, USA). As a composition, 1 pmol forward primer 1 ul, 10 pmol reverse primer 1 ul was used based on 1 test, and PNA probe Was 10 pmol PNA probe 1 ul each, fast qPCR 2X PreMIX (TNS, Korea) 10ul, DNA 1 ~ 5ul and Destilled water maximum volume 20 ul was mixed, Table 8 was subjected to real-time gene amplification under the reaction conditions. At this time, the PNA probe used was performed based on the PNA probe selected in Example 3.

Fast PCR conditions Temperature (℃) Reaction time and cycle Reaction time Gene amplification and real-time gene identification 95 10 min 75 min 95 10 sec 45 cycle 55 * 15 sec Melting ** 95 2 min 50 to 80 Increment 1 ℃, 5 sec
(FAM, HEX) In step *, real-time gene amplification is confirmed by fluorescence imaging.
** In this step, fluorescence is taken to obtain a melting curve.

As a result, as shown in Figs. 10, 11, and 12, it was possible to confirm the ability to detect adenovirus by confirming high-speed real-time gene amplification.

Through analysis using PNA probes SEQ ID NOs: 16, 17 and 18 to detect adenovirus subtype B under high-speed real-time gene amplification conditions, SEQ ID NO: 16 confirmed the results of the amplification curve 24 and the melting curve 60 ° C, but SEQ ID NO: 17 amplification The results were not confirmed in the curve and the melting curve, which is presumed to be a problem caused by the characteristics of the high-speed real-time gene amplification process, and SEQ ID NO: 18 could not confirm the results as in Example 3.

Through the analysis using PNA probes SEQ ID NOs: 19, 20 and 21 to detect adenovirus subtype C, SEQ ID NO: 19 confirmed the results of the amplification curve 24 and the melting curve 62 ° C., but SEQ ID NO: 20 was the result from the amplification curve and the melting curve. It was not confirmed, and it is presumed to be a problem caused by the characteristics of the high-speed real-time gene amplification process, and SEQ ID NO: 21 could not confirm the results as in Example 3.

In addition, through analysis using PNA probes SEQ ID NOs: 22, 23, and 24 to commonly detect adenovirus subtypes F and G, SEQ ID NO: 22 confirmed the results of the amplification curve 29 and the melting curve 56 ° C, but SEQ ID NO: 23 As in the result of Example 3, the result could not be confirmed, and SEQ ID NO: 24 was not confirmed in the amplification curve and the melting curve, which is presumed to be a problem caused by high-speed real-time gene amplification characteristics.

Example 5: Sensitivity and specificity of the adenovirus kit

The DNA concentration was prepared from 10 ⁷ copies / ul to 10 ² copies / ul using each target nucleic acid, and then analyzed with an adenovirus kit to confirm sensitivity.

As a result, as shown in Figure 14, it was confirmed that the melting curve using the adenovirus-specific primer and PNA probe showed a clear melting peak. As a result, the sensitivity to the adenovirus DNA template ranging from 10 ⁷ copies / ul to 10 ² copies / ul was confirmed.

In addition, Influenzavirua A, Influenzavirus B, Parainfluenza virus 1, Parainfluenza virus 2, Parainfluenza virus 3, Parainfluenza virus 4a, Parainfluenza virus 4b, Respiratory syncytial virus A, Respiratory syncytial virus B, Metapneumovirus known as other types of respiratory viruses other than adenovirus , Coronavirus OC43, Coronavirus 229E, Coronavirus NL63, Bocavirus, Rhinovirus A and Rhinovirus B DNA were used to confirm whether they interfere with adenovirus primers and probes. In addition, Salmonella spp., Shigella spp., E.coli spp. Known as a type of pathogen causing intestinal infections other than adenovirus. Vibrio spp. DNA of Norovirus GI, Norovirus GII, Rotavirus, Sapovirus GI, Sapovirus GII, and Sapovirus GIV was used to confirm whether they interfere with adenovirus primers and probes.

As a result, as shown in FIG. 15, amplification and fusion curves were not observed except for adenovirus, and the specificity of the real-time adenovirus detection kit according to the present invention was confirmed.

As the specific parts of the present invention have been described in detail above, it will be apparent to those of ordinary skill in the art that this specific technique is only a preferred embodiment and the scope of the present invention is not limited thereby. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> BongSuk Kim: T & S <120> Adenovirus screening method associated gastrointestinal          Infections and acute respiratory infections by PNA based          real-timc PCR <130> P19DS0076 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Adenovirus subtype B <400> 1 gacagrgaac tkatgcacag 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Adenovirus subtype B <400> 2 gcgagtacyt ggaagactg 19 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Adenovirus subtype C <400> 3 aaattcgcaa gggtatcatg gc 22 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Adenovirus subtype C <400> 4 ttggcttmyt tccaggcgc 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Adenovirus subtype F and G <400> 5 ccacgatgtr accacrga 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Adenovirus subtype F and G <400> 6 tcgtggcccc agctttaa 18 <210> 7 <211> 13 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype B <400> 7 cccatgtcaa agt 13 <210> 8 <211> 12 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype B <400> 8 agagctcttt gc 12 <210> 9 <211> 15 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype B <400> 9 ctcttctatg taagg 15 <210> 10 <211> 12 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype C <400> 10 ccgcatggat ca 12 <210> 11 <211> 12 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype C <400> 11 ttgtctgacg tc 12 <210> 12 <211> 11 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype C <400> 12 ggcggtaacc g 11 <210> 13 <211> 14 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype F and G <400> 13 cgcactttgt aaga 14 <210> 14 <211> 11 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype F and G <400> 14 ctggccatgt c 11 <210> 15 <211> 12 <212> DNA <213> Unknown <220> <223> Biomarker of Adenovirus subtype F and G <400> 15 cgcggatgtc aa 12 <210> 16 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype B <400> 16 actttgacat ggg 13 <210> 17 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype B <400> 17 gcaaagagct ct 12 <210> 18 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype B <400> 18 ccttacatag aagag 15 <210> 19 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype C <400> 19 tgatccatgc gg 12 <210> 20 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype C <400> 20 gacgtcagac aa 12 <210> 21 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype C <400> 21 cggttaccgc c 11 <210> 22 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype F and G <400> 22 tcttacaaag tgcg 14 <210> 23 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype F and G <400> 23 gacatggcca g 11 <210> 24 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PNA probe for Adenovirus subtype F and G <400> 24 ttgacatccg cg 12

Claims (18)

(A) primer set for detecting adenovirus subtype B comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 ;,
(b) a primer set for detecting adenovirus subtype C comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; And
(c) a primer set for detecting at least one subtype of adenovirus subtypes F and G comprising the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6;
Including,
(d) a PNA probe for adenovirus subtype B detection comprising the nucleotide sequence of SEQ ID NO: 16 ;,
(e) a PNA probe for adenovirus subtype C detection comprising the nucleotide sequence of SEQ ID NO: 19; And
(f) a PNA probe for detecting at least one subtype of adenovirus subtypes F and G comprising the nucleotide sequence of SEQ ID NO: 22;
In the composition for detecting adenovirus for fast real-time PCR characterized in that it comprises,
The amplification step of the fast real-time PCR composition for adenovirus detection, characterized in that the thermal cycle is repeated 45 times at 95 ° C for 10 seconds and at 55 ° C for 15 seconds. delete delete delete delete delete According to claim 1,
Adenovirus detection composition for fast real-time PCR, characterized in that no pathogen showing similar infection symptoms other than the pathogenic virus to be detected is not detected. delete According to claim 1,
A composition for detecting adenovirus, characterized in that the PNA probe includes a reporter and a quencher. A kit for detecting adenovirus according to claim 1, comprising the composition for detecting adenovirus. delete (a) amplifying the target sequence by performing a fast real-time PCR using the composition for detecting adenovirus of claim 1 on a target nucleic acid extracted from a sample; And
(B) analyzing the amplified target sequence to specifically detect and detect adenovirus by subtype;
Specific detection method for each adenovirus subtype comprising a. delete delete delete The method of claim 12,
The amplification step of the Fast PCR condition is a specific detection method for each adenovirus subtype, characterized in that the thermal cycle is repeated 45 times at 95 ° C for 10 seconds and at 55 ° C for 15 seconds. The method of claim 12,
The detection method is a specific detection method for each adenovirus subtype, which is shortened by up to 68 minutes than a normal pcr. The method of claim 12, 16 or 17,
The detection method has a sensitivity of 10 ⁷ copies / ul to 10 ² copies / ul, and a specific detection method for each adenovirus subtype.

Images