CN111363842A - Sequence, kit, method and application for rapidly detecting aspergillus fumigatus - Google Patents
Sequence, kit, method and application for rapidly detecting aspergillus fumigatus Download PDFInfo
- Publication number
- CN111363842A CN111363842A CN202010285710.9A CN202010285710A CN111363842A CN 111363842 A CN111363842 A CN 111363842A CN 202010285710 A CN202010285710 A CN 202010285710A CN 111363842 A CN111363842 A CN 111363842A
- Authority
- CN
- China
- Prior art keywords
- concentration
- sequence
- aspergillus fumigatus
- rpa
- mul
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a sequence for rapidly detecting aspergillus fumigatus, which comprises an aspergillus fumigatus-crRNA sequence and a corresponding RPA amplification primer sequence with a T7 promoter, wherein the nucleotide sequence of the aspergillus fumigatus-crRNA sequence is shown as SEQ ID NO.1, the nucleotide sequence of a forward primer of the RPA amplification primer sequence is shown as SEQ ID NO.2, and the nucleotide sequence of a reverse primer of the RPA amplification primer sequence is shown as SEQ ID NO. 3. The method can be used for simply, quickly, highly specifically and sensitively detecting the aspergillus fumigatus in the sample to be detected.
Description
Technical Field
The invention belongs to the field of biochemistry, particularly relates to an aspergillus detection method, and particularly relates to a sequence, a kit, a method and application for rapidly detecting aspergillus fumigatus.
Background
Invasive Pulmonary Aspergillosis (IPA) is an infectious disease caused by the invasion of aspergillus hyphae into the lung parenchyma, and has the characteristics of acute onset, rapid progress and high fatality rate. Aspergillus fumigatus is the most common pathogenic bacterium causing IPA, and the literature reports that if IPA pneumonia symptoms occur after 10 days of antifungal treatment, the mortality rate of patients is as high as 90%, while the mortality rate of early antifungal treatment can be reduced to 41%. The rapid and accurate identification of aspergillus fumigatus can guide the clinical selection of antifungal drugs and strive for treatment time.
Early diagnosis and timely treatment are key to good prognosis. Early diagnosis is particularly difficult due to the lack of typical clinical manifestations of the disease. The identification method of the aspergillus in the laboratory mainly comprises pathogen separation culture, pathological tissue identification, immunological detection and nucleic acid detection. However, the traditional pathogen isolation culture takes long time and has low positive rate. However, pathological tissue identification is limited by sample collection, the immunological detection sensitivity is not high, and different strains cannot be distinguished, so that whether aspergillus fumigatus is infected or not cannot be identified, and false positive or false negative often occurs. The nucleic acid detection method mainly comprises a Polymerase Chain Reaction (PCR) technology which is widely applied in the near field and some emerging isothermal amplification technologies.
The detection technology based on PCR gradually becomes the most mature nucleic acid detection method for clinical molecular diagnosis in recent years, and has higher sensitivity and higher detection speed, but the content of aspergillus fumigatus in a specimen can be reduced due to the links of specimen collection, transportation and the like and the factors of antibiotic treatment of patients, and the sensitivity of PCR nucleic acid detection can be influenced. LAMP (Loop-mediated isothermal amplification) developed in recent years is simpler and more economical, is 2.5 times faster than qPCR in time, and has better specificity than PCR when the sensitivity is the same.
However, aspergillus has a large variety, and the homology between species and between species (with other genera such as candida, cryptococcus, etc.) is high, and meanwhile, the probability of variation of the whole fungal genome is far greater than that of the human genome, so that the gene sequence which can be selected as a target gene sequence for species detection is not large, and therefore, the difficulty in designing an amplification primer and crRNA for specifically detecting common aspergillus (such as aspergillus fumigatus) is large.
Recombinase-polymerase amplification (RPA) is a rapidly emerging isothermal amplification technique, in which a detectable level of amplified nucleic acid is obtained at room temperature (optimum reaction temperature 37 ℃ to 42 ℃) by a recombinase capable of binding single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA binding protein (SSB), and a DNA polymerase having a strand displacement function. However, the essence of the single-stage amplification reaction is not changed in principle, and compared with most qPCR detection methods in the current market, the sensitivity cannot be substantially improved.
Since 2017, more and more documents report that CRISPR-Cas gene editing technology can be applied to clinical molecular diagnosis. In a CRISPR-Cas system, Cas protein is guided by guide RNA, target sequence and then starts self 'additional cutting' activity, if a fluorescent reporter molecule (a commonly used reporter molecule is an oligonucleotide sequence, one end of the reporter molecule is provided with a luminescent group, and the other end of the reporter molecule is provided with a quenching group, under normal conditions, the complete reporter molecule cannot be detected due to quenching effect, and when the oligonucleotide molecule is hydrolyzed, free fluorescent signal can be detected), the conversion of sequence information to be detected to the fluorescent signal can be realized by virtue of the additional cutting activity of Cas enzyme. And through the coupling of the RPA and the CRISPR-Cas, the two-stage amplification of 'sequence amplification' (RPA completion) and 'enzymatic cascade' (Cas enzyme completion) can be realized, thereby surpassing the sensitivity of single-stage amplification of qPCR. In addition, the RPA amplification mode does not need complex temperature change, so that the dependence on complex variable-temperature amplification instruments such as a qPCR instrument and the like is eliminated, the CRISPR-Cas technology has wide application prospect in the aspect of instant diagnosis of aspergillus fumigatus, the detection result can be realized within 40 minutes at the fastest speed, the detection time is greatly shortened, the infection of epidemic diseases in a wider range can be avoided, and the method has great application advantages.
Disclosure of Invention
The invention aims to solve the technical problems and provides a technical scheme for simply, quickly, highly specifically and sensitively detecting aspergillus fumigatus.
In order to achieve the above object, the present invention provides the following technical solutions:
a sequence for rapidly detecting aspergillus fumigatus comprises an aspergillus fumigatus-crRNA sequence and a corresponding RPA amplification primer sequence with a T7 promoter, wherein the nucleotide sequence of the aspergillus fumigatus-crRNA sequence is shown as SEQ ID No.1, the nucleotide sequence of a forward primer of the RPA amplification primer sequence is shown as SEQ ID No.2, and the nucleotide sequence of a reverse primer of the RPA amplification primer sequence is shown as SEQ ID No. 3.
Preferably, the final concentration of the RPA amplification primer sequence is 0.1-1 mu mol/L, and the final concentration of the Aspergillus fumigatus-crRNA is 20-200 nmol/L.
On the other hand, the invention also provides a kit, which contains the sequence for rapidly detecting aspergillus fumigatus, as well as RPA enzyme premix, a signal report probe, LwCas13a protein, magnesium acetate, T7RNA polymerase mixed liquor and NTP buffer mixed liquor.
Preferably, the RPA enzyme premix contains creatine phosphate, creatine kinase, dNTPs, ATP, DTT, potassium acetate, recombinase uxsX, recombinase uxsY, single-strand binding protein, and Bsu polymerase.
On the other hand, the invention also provides a method for rapidly detecting aspergillus fumigatus, which comprises the following steps:
the method comprises the following steps: extracting DNA of a sample to be detected;
step two: amplification and signal detection of aspergillus fumigatus nucleic acids using RPA and CRISPR one-step detection system, wherein the sequences for rapid detection of aspergillus fumigatus according to claim 1 or 2 are used.
Preferably, in the second step, the RPA and CRISPR one-step detection system comprises a first part and a second part;
the first part comprises 0.5-2.5 muL of RPA forward primer with the concentration of 10 muM, 21 muL of RPA reverse primer with the concentration of 10 muM, 0.5-2.5 mu L, RPA enzyme premix, wherein the RPA enzyme premix comprises creatine phosphate with the concentration of 20-80mM, creatine kinase with the concentration of 50-150mM, dNTPs with the concentration of 100-300 muM, ATP with the concentration of 20-80mM, DTT with the concentration of 1-10mM, potassium acetate with the concentration of 50-200mM, recombinase uxsX with the concentration of 50-300 ng/muL, recombinase uxsY with the concentration of 10-100 ng/muL, single-strand binding protein with the concentration of 200-1000 ng/muL and Bsu polymerase with the concentration of 10-100 ng/muL;
the second part contains 1 muL of Lwcas13a protein with the concentration of 1-5 muM, 1-10 muL of crRNA1 mu L, T7RNA polymerase mixed liquor with the concentration of 1-5 muM, 1.2-2 mu L, NTP buffer mixed liquor and 1 muL of signal reporting probe with the concentration of 1-10 muM.
More preferably, the system is collected at the bottom of the tube by shaking and centrifugation after the first part is prepared, then the second part is added, after the reaction is carried out for 10 to 30 minutes at the constant temperature of 37 ℃, the mixture is shaken, mixed and centrifuged, and the fluorescence value of FAM is read.
In another aspect, the invention also provides application of the sequence for rapidly detecting aspergillus fumigatus in preparation of an aspergillus fumigatus detection reagent.
Compared with the prior art, the technical scheme of the invention designs the crRNA corresponding to the Cas13a by optimizing the specific sequence of the aspergillus fumigatus, performs fluorescence detection, improves the detection sensitivity, and realizes the detection of the copy close to a single genome in a reaction system.
Drawings
FIG. 1 shows the results of the Aspergillus fumigatus crRNA sequence verification screening
FIG. 2 shows the results of Aspergillus fumigatus primer screening.
FIG. 3 shows the results of sensitivity analysis of the Aspergillus fumigatus system.
FIG. 4 shows the results of Aspergillus fumigatus system-specific analysis.
Detailed Description
The present invention will be further described with reference to the following examples. It should be understood that the following examples are illustrative of the present invention only, and are not intended to limit the scope of the present invention.
Experimental Material
The primers and the plasmid vector inserted with the target sequence are synthesized by Egyi Biotechnology, Inc., the signal reporter probe is synthesized by Biotechnology engineering (Shanghai) Inc., the guide RNA (crRNA) is synthesized by Kisry Biotechnology, Inc., and the LwCas13a protein is expressed and purified by Kisry Biotechnology, Inc. The RPA enzyme premix is purchased from Hangzhou mass-testing Biotechnology Limited, and other biochemical reagents are imported, subpackaged or domestic analytically pure.
Laboratory apparatus
Metal baths, centrifuges, vortex mixers, ABI7500 fluorescence detectors, and the like.
Example 1
Design of related sequences for Aspergillus fumigatus detection.
1. And selecting a target sequence.
An ITS region of an aspergillus fumigatus genome is selected as a target detection sequence, primers and crRNA capable of specifically detecting the aspergillus fumigatus are designed through sequence comparison and screening, the sequence combination can identify the aspergillus fumigatus, but the primers and the crRNA are not crossed with other fungus strains such as aspergillus flavus, aspergillus niger, aspergillus terreus, aspergillus nidulans and the like, and the primers and the crRNA have high specificity and sensitivity.
The sample to be tested in this example is a plasmid (synthesized by Egyi Biotechnology Ltd.) into which a region of a target sequence selected from Aspergillus fumigatus is inserted, and the inserted sequence (SEQ ID NO.4) is as follows:
5’TCAAACCCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATT-3’
2. design of amplification primer pairs and crRNA.
The length of the RPA primer is generally 30-38 nt, the activity of the recombinase is seriously influenced by the excessively short primer, and a secondary structure is easily formed by the excessively long primer. The GC content is 30-70%, and the sequence of the primer is strictly complementary with the amplified fragment. The amplification product is generally less than 500bp, the optimal length is 100-200 bp, and the shortest length is 70-80 bp.
In the experiment, a plurality of pairs of RPA primer amplification target sequences are required to be designed aiming at the ITS region of the aspergillus fumigatus, and screening optimization is carried out. The length of the designed primer amplification product is 110-260 bp, 4 upstream amplification primers and 4 downstream amplification primers are respectively designed for an ITS region, and the primer sequences are as follows:
the structure of guide RNA (crRNA) is 5 '-anchor sequence-guide sequence-3'
The anchor sequence is divided into LshCas13a, LkuCas 13a, LwCas13a and the like according to the source difference of the Cas13a protein, the source of the Cas13a protein in the invention is LwCas13a, and the specific anchor sequence is 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3' (SEQ ID NO. 5);
the guide sequence matches the fragment in the targeting RNA and is 20-30 nucleotides, preferably 28 (see Table 1).
TABLE 1 Aspergillus fumigatus crRNA and amplification primer pair sequences
Example 2: screening for amplification efficiency of crRNA and RPA amplification primers
1. Screening for crRNA detection efficiency
1.1 methods
In the experiment, 2 crRNAs are designed from the target sequence for optimization and screening. According to 2 crRNA sequences, two single-stranded sequences which are specifically recognized and contain the T7 promoter are respectively synthesized to be used as templates, namely, the transcription templates are obtained after the two single-stranded sequences which are identical to and complementary to a guide sequence in the crRNA (the specific sequence is shown in table 2) are annealed, and the influence on the signals of the crRNA due to the difference of amplification primers is avoided.
TABLE 2 sequences used to validate crRNA
Fumigatus-crRNA1-F and Fumigatus-crRNA1-R were diluted to 20. mu.M, respectively, and mixed at a volume ratio of 1:1, Fumigatus-crRNA2-F and Fumigatus-crRNA2-R were diluted to 20. mu.M, respectively, and mixed at a volume ratio of 1:1, and annealed at 95 ℃ for 2 minutes, 95 ℃ to 22 ℃ for 0.1 ℃/s, and held at 4 ℃ in a PCR apparatus under an annealing buffer (Tris, pH 7.5 to 8.010 mM, NaCl 50mM, EDTA 1mM) environment of 1 ×, respectively, and the obtained annealed product was used as a template to verify and screen the optimal crRNA in combination with 2 specific crRNAs listed in Table 1.
The specific operation is as follows:
reaction system: 0.1. mu.M of annealing product, 1. mu.L of Lwcas13a protein (concentration 1-5. mu.M), 1. mu.L of crRNA (concentration 1-5. mu.M), 0.2-2. mu.L of T7RNA polymerase mixture, 1-10. mu.L of NTP mix, and 1. mu.L of signal reporter probe (concentration 1-10. mu.M). Negative controls were set for each group using water as template.
Reaction conditions are as follows: the reaction was carried out at 37 ℃ for 10min, and FAM fluorescence was read every 1 min.
1.2 analysis of results
And (4) carrying out fluorescence detection on the amplification product by using a fluorescence detector, and setting a negative control in the experiment. Calculating the Fold change value of the target sample according to the fluorescence value read by the fluorescence detector (the Fold change value is the fluorescence quantity of the detection sample/the fluorescence quantity of the positive control), and judging the negative standard: the Fold change value ≦ 3.0. Positive judgment standard: fold change value >3.0
The results of the detection and screening of the Aspergillus fumigatus crRNA in Table 1 above using an ABI7500 fluorescence detector are shown in FIG. 1, where the ordinate is Flod change, indicating that the signals of crRNA-1 are all ideal.
2. Screening for amplification efficiency of RPA primers
2.1 method
To screen for the RPA amplification primers for Cas13a, the target sequence was first amplified by RPA at 1000 copies/. mu.l template.
The system of the reaction system is 30 mu L, and is mainly divided into two parts:
the first part comprises 0.5-2.5 μ L of RPA upstream primer (concentration 10 μ M), 0.5-2.5 μ L of RPA downstream primer (concentration 10 μ M), 21 μ L of RPA enzyme premix (containing creatine phosphate (concentration 20-80mM), creatine kinase (concentration 50-150mM), dNTPs (concentration 100-
The second part comprises 1 μ L of Lwcas13a protein (concentration 1-5 μ M), 1 μ L of crRNA (concentration 1-5 μ M), 0.2-2 μ L of T7 RNApolyelectrolyte mix, 1-10 μ L of NTP mix, and 1 μ L of signal reporter probe (concentration 1-10 μ M).
The first part is prepared, then the system is vibrated and centrifuged to be collected at the bottom of the tube, the second part of mixed liquid is added on the tube cover, the tube cover is covered, after the reaction is carried out at the constant temperature of 37 ℃ for 10-30min, the liquid on the cover is centrifugally collected at the bottom of the tube, the liquid is vibrated and uniformly mixed and then centrifuged for a short time, a fluorescence detector with a specific FAM fluorescence reading function is used for reading signals, and the fluorescence detector can be selected from ABI7500 (Thermo Fisher), ABI ViiA7Dx (Thermo Fisher), SLAN-96P (Shanghai macrostone), or a microplate reader (BioTek), and the like, the reaction condition and time are 37 ℃ for reaction for 10-30min, and the FAM fluorescence value is read every 1 min.
2.2. And (4) analyzing results:
and (4) carrying out fluorescence detection on the amplification product by using a fluorescence detector, and setting a negative control in the experiment. Calculating the Fold change value of the target sample according to the fluorescence value read by the fluorescence detector (the Fold change value is the fluorescence quantity of the detection sample/the fluorescence quantity of the positive control), and judging the negative standard: the Fold change value ≦ 3.0. Positive judgment standard: the Fold change value is > 3.0.
In this embodiment, the positive signal is a fluorescent signal emitted after the RNA probe is cleaved, the sequence of the RNA probe is characterized by RNA with a fluorescent group and a quenching group, and after the Cas13a protein recognizes the target RNA with the target sequence with the help of crRNA, the activated Cas13a enzyme can degrade the RNA probe with the signal, thereby releasing the fluorescent signal and realizing detection.
The primers of aspergillus fumigatus (primers shown in the primer in the table 1 above) are combined pairwise by using an ABI7500 fluorescence detector for detection and screening, and finally a group of primer pairs F4/R1 with good amplification efficiency is selected, wherein the screening result is shown in figure 2, and the ordinate in the figure is the Flod change value.
Example 3
This example is based on RPA amplification, T7 in vitro transcription and Cas13a for sensitive detection.
Plasmids with the conserved sequence of aspergillus fumigatus respectively are taken as templates, and 5 gradients of 3000 copies/muL, 300 copies/muL, 30 copies/muL, 3 copies/muL and 0 copies/muL are calculated and diluted as the templates of sensitivity detection.
1. A method.
Reference was made to the procedure for primer screening in example 2 above
Sensitivity analysis is carried out on the aspergillus fumigatus system, and negative control is set in the experiment.
2. And (6) obtaining the result.
And carrying out fluorescence detection on the amplification product by using an ABI7500 fluorescence detector. The results showed that the detection limit of A.fumigatus was 7.5 copies per reaction system, as shown in FIG. 3.
Example 4: specificity test
This example was based on RPA amplification, T7 in vitro transcription in combination with Cas13a, for specificity validation of aspergillus fumigatus.
The DNA of the Aspergillus fumigatus genome, the plasmid DNA having the target sequence inserted therein, the Aspergillus flavus genome DNA, the Aspergillus niger genome DNA, the Aspergillus terreus genome DNA, the Aspergillus nidulans genome DNA, the Aspergillus tamaricus genome DNA, the Monascus purpureus genome DNA, the Penicillium citrinum genome DNA, or the likeTaking streptococcus lactis genome DNA, mycobacterium tuberculosis genome DNA and escherichia coli genome DNA as detection templates, and diluting each genome sample to 104copy/uL, and test the specificity of the Aspergillus fumigatus system by taking Hela cell genome DNA as negative quality control.
1. The method comprises the following steps:
reference is made to the process of example 2 above
The total volume was 30. mu.L, using the primer pair F4/R1.
2. And (4) analyzing results:
and carrying out fluorescence detection on the amplification product by using an ABI7500 fluorescence detector. As shown in FIG. 4, only the genomic DNA of A.fumigatus and the plasmid DNA having the target sequence inserted therein were detected specifically, and no significant signal was observed in the other samples.
Example 5
The kit for detecting aspergillus fumigatus is prepared and comprises:
(1) the specific primers for Aspergillus fumigatus and crRNA are as follows:
aspergillus fumigatus-crRNA:
5 'GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUACGAUAAUCAACUCAGACUGCAUACU-3' at a concentration of 1. mu.M;
aspergillus fumigatus forward primer:
5'-TAATACGACTCACTATAGGGGGTCCAACCTCCCACCCGTGTCTATC-3', concentration 10. mu.M;
reverse primer of aspergillus fumigatus:
5'-TCGATGATTCACTGAATTCTGCAATTCACATTAC-3', concentration 10. mu.M;
RPA enzyme premix: creatine phosphate (concentration 20-80mM), creatine kinase (concentration 50-150mM), dNTPs (concentration 100-300. mu.M), ATP (concentration 20-80mM), DTT (concentration 1-10mM), potassium acetate (concentration 50-200mM), recombinase uxsX (50-300 ng/. mu.L), uxsY (10-100 ng/. mu.L), single-stranded binding protein (200-1000 ng/. mu.L), Bsu polymerase (10-100 ng/. mu.L);
magnesium acetate: the concentration was 280 mM.
LwCas13a protein: the concentration is 2 μ M;
t7RNA polymerase mixture: market selling (NEB)
NTP mixed liquor 1-10 mu L: commercially available, at a concentration of 20mM for each NTP;
signal reporting probe: 5 '6-FAM-UUUUUUUUUUUUUU-BHQ 1-3' at a concentration of 10. mu.M.
Secondly, the aspergillus fumigatus is detected by adopting the kit
(1) DNA extraction of test samples
The test sample may be cultured virus strain, clinical sample (mainly including sputum, alveolar lavage fluid, etc.) or other scientific research samples.
(2) RPA amplification and CRISPR analysis
Reference is made to the procedure described above in example 2.
(3) And (4) analyzing results:
in the detection process, because the signal reporting probe with two ends respectively connected with the fluorescent group and the quenching group is added into the reaction system, after the Cas13a protein recognizes the target RNA with the target sequence with the help of crRNA, the activated Cas13a enzyme can degrade the RNA with the signal, thereby releasing the fluorescent signal and realizing the detection.
Using an ABI7500 fluorescence detector, the obtained accumulated fluorescence value was used as a signal intensity, and based on the fluorescence value read by the fluorescence detector, the Fold change value of the target sample (the Fold change value is the fluorescence amount of the detection sample/the fluorescence amount of the positive control) was calculated, and the negative judgment criterion was: the Fold change value ≦ 3.0. Positive judgment standard: the Fold change value is > 3.0.
Among them, a negative control group was set for each experimental group to add a negative signal group simultaneously treated with DEPC (Biotechnology engineering (Shanghai) Co., Ltd.).
The test of clinical samples was carried out with the kit of example 5 above. The result shows that aspergillus fumigatus in clinical samples can be detected quickly, sensitively and highly specifically.
Sequence listing
<110> Guangzhou medical university affiliated first hospital
GUANGZHOU INSTITUTE OF RESPIRATORY HEALTH
<120> sequence, kit, method and application for rapidly detecting aspergillus fumigatus
<160>16
<170>SIPOSequenceListing 1.0
<210>1
<211>67
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ggggauuuag acuaccccaa aaacgaaggg gacuaaaacu uacgauaauc aacucagacu 60
gcauacu 67
<210>2
<211>46
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
taatacgact cactataggg ggtccaacct cccacccgtg tctatc 46
<210>3
<211>34
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tcgatgattc actgaattct gcaattcaca ttac 34
<210>4
<211>659
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tcaaacccgg tcatttagag gaagtaaaag tcgtaacaag gtttccgtag gtgaacctgc 60
ggaaggatca ttaccgagtg agggccctct gggtccaacc tcccacccgt gtctatcgta 120
ccttgttgct tcggcgggcc cgccgtttcg acggccgccg gggaggcctt gcgcccccgg 180
gcccgcgccc gccgaagacc ccaacatgaa cgctgttctg aaagtatgca gtctgagttg 240
attatcgtaa tcagttaaaa ctttcaacaa cggatctctt ggttccggca tcgatgaaga 300
acgcagcgaa atgcgataag taatgtgaat tgcagaattc agtgaatcat cgagtctttg 360
aacgcacatt gcgccccctg gtattccggg gggcatgcct gtccgagcgt cattgctgcc 420
ctcaagcacg gcttgtgtgt tgggcccccg tccccctctc ccgggggacg ggcccgaaag 480
gcagcggcgg caccgcgtcc ggtcctcgag cgtatggggc tttgtcacct gctctgtagg 540
cccggccggc gccagccgac acccaacttt atttttctaa ggttgacctc ggatcaggta 600
gggatacccg ctgaacttaa gcatatcaat aagcggagga aaagaaacca acagggatt 659
<210>5
<211>36
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gauuuagacu accccaaaaa cgaaggggac uaaaac 36
<210>6
<211>67
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggggauuuag acuaccccaa aaacgaaggg gacuaaaacc ucagacugca uacuuucaga 60
acagcgu 67
<210>7
<211>54
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
taatacgact cactataggg taggtgaacc tgcggaagga tcattaccga gtga 54
<210>8
<211>54
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
taatacgact cactataggg tgaacctgcg gaaggatcat taccgagtga gggc 54
<210>9
<211>55
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
taatacgact cactataggg cggaaggatc attaccgagt gagggccctc tgggt 55
<210>10
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
actcgatgat tcactgaatt ctgcaattca cattac 36
<210>11
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
atgattcact gaattctgca attcacatta c 31
<210>12
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
ttagaaaaat aaagttgggt gtcggc 26
<210>13
<211>55
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
taatacgact cactataggg tgaaagtatg cagtctgagt tgattatcgt aatca 55
<210>14
<211>55
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
tgattacgat aatcaactca gactgcatac tttcacccta tagtgagtcg tatta 55
<210>15
<211>53
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
taatacgact cactataggg tgaacgctgt tctgaaagta tgcagtctga gtt 53
<210>16
<211>53
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
aactcagact gcatactttc agaacagcgt tcaccctata gtgagtcgta tta 53
Claims (8)
1. A sequence for rapidly detecting aspergillus fumigatus comprises an aspergillus fumigatus-crRNA sequence and a corresponding RPA amplification primer sequence with a T7 promoter, wherein the nucleotide sequence of the aspergillus fumigatus-crRNA sequence is shown as SEQ ID No.1, the nucleotide sequence of a forward primer of the RPA amplification primer sequence is shown as SEQ ID No.2, and the nucleotide sequence of a reverse primer of the RPA amplification primer sequence is shown as SEQ ID No. 3.
2. The sequence of claim 1, wherein the final concentration of the RPA amplification primer sequence is 0.1-1 μmol/L and the final concentration of the Aspergillus fumigatus-crRNA is 20-200 nmol/L.
3. A kit comprising the sequence for rapidly detecting aspergillus fumigatus according to claim 1 or 2, further comprising RPA enzyme premix, a signal reporter probe, LwCas13a protein, magnesium acetate, T7RNA polymerase mixture and NTP buffer mixture.
4. The kit of claim 3, wherein the RPA enzyme premix comprises creatine phosphate, creatine kinase, dNTPs, ATP, DTT, potassium acetate, recombinase uxsX, recombinase uxsY, single-stranded binding protein, and Bsu polymerase.
5. A method for rapidly detecting aspergillus fumigatus is characterized by comprising the following steps:
the method comprises the following steps: extracting DNA of a sample to be detected;
step two: amplification and signal detection of aspergillus fumigatus nucleic acids using RPA and CRISPR one-step detection system, wherein the sequences for rapid detection of aspergillus fumigatus according to claim 1 or 2 are used.
6. The method according to claim 5, wherein in the second step, the RPA and CRISPR one-step detection system comprises a first part and a second part;
the first part comprises 0.5-2.5 muL of RPA forward primer with the concentration of 10 muM, 21 muL of RPA reverse primer with the concentration of 10 muM, 0.5-2.5 mu L, RPA enzyme premix, wherein the RPA enzyme premix comprises creatine phosphate with the concentration of 20-80mM, creatine kinase with the concentration of 50-150mM, dNTPs with the concentration of 100-300 muM, ATP with the concentration of 20-80mM, DTT with the concentration of 1-10mM, potassium acetate with the concentration of 50-200mM, recombinase uxsX with the concentration of 50-300 ng/muL, recombinase uxsY with the concentration of 10-100 ng/muL, single-strand binding protein with the concentration of 200-1000 ng/muL and Bsu polymerase with the concentration of 10-100 ng/muL;
the second part contains 1 muL of Lwcas13a protein with the concentration of 1-5 muM, 1-10 muL of crRNA1 mu L, T7RNA polymerase mixed solution with the concentration of 1-5 muM, 1.2-2 mu L, NTP buffer mixed solution and 1 muL of signal reporting probe with the concentration of 1-10 muM.
7. The method as claimed in claim 6, wherein the first part is prepared and then centrifuged to collect the system at the bottom of the tube, and then the second part is added and reacted at a constant temperature of 37 ℃ for 10-30 minutes, and then centrifuged after shaking and mixing, and the fluorescence value of FAM is read.
8. Use of the sequence for the rapid detection of aspergillus fumigatus according to claim 1 or 2 for the preparation of an aspergillus fumigatus detection reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010285710.9A CN111363842B (en) | 2020-04-13 | 2020-04-13 | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010285710.9A CN111363842B (en) | 2020-04-13 | 2020-04-13 | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111363842A true CN111363842A (en) | 2020-07-03 |
| CN111363842B CN111363842B (en) | 2021-02-02 |
Family
ID=71203322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010285710.9A Active CN111363842B (en) | 2020-04-13 | 2020-04-13 | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111363842B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808931A (en) * | 2020-07-15 | 2020-10-23 | 南方科技大学 | One-step RPA-CRISPR nucleic acid detection method, kit and application |
| CN114075564A (en) * | 2022-01-17 | 2022-02-22 | 广东华美众源生物科技有限公司 | Malassezia detection composition, kit and detection method thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707691A (en) * | 2018-06-07 | 2018-10-26 | 杭州缔蓝生物技术有限公司 | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method |
| WO2018209307A1 (en) * | 2017-05-12 | 2018-11-15 | The Regents Of The University Of California | Methods for detecting dysbiosis and treating subjects with dysbiosis |
| CN110184329A (en) * | 2019-05-31 | 2019-08-30 | 华南理工大学 | A kind of one-step method nucleic acid detection method and kit based on CRISPR/Cas and constant-temperature amplification |
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
| CN110760605A (en) * | 2019-10-31 | 2020-02-07 | 中国人民解放军疾病预防控制中心 | Real-time fluorescence RPA detection kit for aspergillus fumigatus and special primer and probe thereof |
| CN110804669A (en) * | 2019-11-28 | 2020-02-18 | 广州微远基因科技有限公司 | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof |
| CN111836903A (en) * | 2017-12-22 | 2020-10-27 | 博德研究所 | Multiple diagnostics based on CRISPR effector systems |
-
2020
- 2020-04-13 CN CN202010285710.9A patent/CN111363842B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
| WO2018209307A1 (en) * | 2017-05-12 | 2018-11-15 | The Regents Of The University Of California | Methods for detecting dysbiosis and treating subjects with dysbiosis |
| CN111836903A (en) * | 2017-12-22 | 2020-10-27 | 博德研究所 | Multiple diagnostics based on CRISPR effector systems |
| CN108707691A (en) * | 2018-06-07 | 2018-10-26 | 杭州缔蓝生物技术有限公司 | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method |
| CN110184329A (en) * | 2019-05-31 | 2019-08-30 | 华南理工大学 | A kind of one-step method nucleic acid detection method and kit based on CRISPR/Cas and constant-temperature amplification |
| CN110760605A (en) * | 2019-10-31 | 2020-02-07 | 中国人民解放军疾病预防控制中心 | Real-time fluorescence RPA detection kit for aspergillus fumigatus and special primer and probe thereof |
| CN110804669A (en) * | 2019-11-28 | 2020-02-18 | 广州微远基因科技有限公司 | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 廖新辉: "重组酶介导等温核酸扩增技术快速检测烟曲霉菌", 《医药卫生科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808931A (en) * | 2020-07-15 | 2020-10-23 | 南方科技大学 | One-step RPA-CRISPR nucleic acid detection method, kit and application |
| CN114075564A (en) * | 2022-01-17 | 2022-02-22 | 广东华美众源生物科技有限公司 | Malassezia detection composition, kit and detection method thereof |
| CN114075564B (en) * | 2022-01-17 | 2022-04-22 | 广东华美众源生物科技有限公司 | Malassezia detection composition, kit and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111363842B (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114058679B (en) | CRISPR cascade nucleic acid detection system and detection method and application thereof | |
| CN112375847B (en) | Hepatitis B virus genotyping detection method based on CRISPR/Cas13a system | |
| KR102098772B1 (en) | Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR | |
| CN110804669B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| CN113403424B (en) | Method and kit for rapidly detecting novel coronaviruses and mutant strains based on CRISPR/Cas12a technology | |
| CN113046475B (en) | Primer composition and kit for rapidly detecting mutant novel coronavirus | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN111363842B (en) | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus | |
| CN113913552B (en) | Primer, probe, kit and detection method for real-time fluorescent RT-RPA detection of mouse hepatitis virus | |
| CN110791578A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for bordetella pertussis and application of CRISPR detection primer group | |
| KR102555330B1 (en) | Composition For Detecting SARS-CoV-2, Kit For Detecting the Same and Method of Detecting SARS-CoV-2 Using the Same | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN113373223A (en) | CRISPR-Cas system for FLT3-D835Y mutation detection and application thereof | |
| CN112662809A (en) | Nucleic acid composition for detecting novel coronavirus COVID-19 and application thereof | |
| CN112695134A (en) | Novel coronavirus COVID-19 nucleic acid detection primer group, probe group, detection kit and detection method | |
| CN112662808A (en) | Novel coronavirus COVID-19 nucleic acid detection kit and detection method thereof | |
| US20050048509A1 (en) | Diagnosis of invasive mold infection | |
| CN114592042B (en) | Micro RNA detection method and kit | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| CN114350853A (en) | Kit and method for detecting virus and mutant thereof | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| WO2022257664A1 (en) | Method and kit for detecting and screening n439k mutation of novel coronavirus | |
| CN115058493B (en) | DNA probe for multiple nucleic acid detection, CRISPR-reverse dot hybridization nucleic acid detection system and application | |
| CN117467804B (en) | Primer for rapidly detecting respiratory syncytial virus nucleic acid and application thereof | |
| CN117265185A (en) | Adenovirus rapid detection method based on One-Tube RPA-CRISPR/Cas12a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220719 Address after: 510700 No. 303, building G10, South China new materials innovation park, self compiled building 3, No. 31 Kefeng Road, Guangzhou high tech Industrial Development Zone, Guangdong Province Patentee after: GUANGZHOU VISION GENE TECHNOLOGY Co.,Ltd. Address before: 510120 151 Yanjiang Road, Yuexiu District, Guangzhou, Guangdong Patentee before: THE FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL University Patentee before: Guangzhou Institute of respiratory health |