NL2031160B1 - Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain - Google Patents

Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain Download PDF

Info

Publication number
NL2031160B1
NL2031160B1 NL2031160A NL2031160A NL2031160B1 NL 2031160 B1 NL2031160 B1 NL 2031160B1 NL 2031160 A NL2031160 A NL 2031160A NL 2031160 A NL2031160 A NL 2031160A NL 2031160 B1 NL2031160 B1 NL 2031160B1
Authority
NL
Netherlands
Prior art keywords
strain
brucella
probe
wild
vaccine strain
Prior art date
Application number
NL2031160A
Other languages
Dutch (nl)
Other versions
NL2031160A (en
Inventor
Zhang Chunhong
Ma Xiang
Zhang Jianfeng
Liao Ming
Sun Junying
Shen Haiyan
Liu Zhicheng
Original Assignee
Maoming Branch Center Of Guangdong Laboratory For Lingnan Modern Agricultural Science And Tech
Inst Animal Health Guangdong Academy Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Maoming Branch Center Of Guangdong Laboratory For Lingnan Modern Agricultural Science And Tech, Inst Animal Health Guangdong Academy Agricultural Sciences filed Critical Maoming Branch Center Of Guangdong Laboratory For Lingnan Modern Agricultural Science And Tech
Publication of NL2031160A publication Critical patent/NL2031160A/en
Application granted granted Critical
Publication of NL2031160B1 publication Critical patent/NL2031160B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed is a primer set, probe and application for distinguishing Bruce/la 82 vaccine strain from wild strain, and relates to the technical field of bacterial detection. According to the invention, the primer set including the upstream primer with the nucleotide sequence shown in SEQ ID No.1 and the downstream primer shown in SEQ ID NO.2 and the probe with the nucleotide sequence shown in SEQ ID No.3 are provided, so that Bruce/la 82 vaccine strain and wild strain can be quickly and accurately distinguished. The invention also provides a method for identifying Bruce/la 82 vaccine strain and wild strain by using the primer set and probe, which has high sensitivity and good specificity and is suitable for clinical application. The invention provides an effective new tool for brucellosis prevention and screening, greatly improves the efficiency of brucellosis prevention and control, is suitable for large - scale popularization and implementation, and has great application potential and potential commercial value.

Description

Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
TECHNICAL FIELD The invention relates to the technical field of bacterial detection, in particular to a primer set, a probe and application for distinguishing Brucella S2 vaccine strain and wild strain.
BACKGROUND Brucellosis is a zoonotic infectious disease caused by Brucella. Brucella is a gram - negative facultative anaerobic bacterium, which can be divided into at least 10 species according to the difference of pathogenicity and host selectivity, among which Brucella melitensis from sheep, Brucella abortus from cattle and Brucella suis from pigs are the most infectious.
Brucellosis is extremely harmful to animal husbandry, and its prevalence has caused serious safety hazards in meat, milk and other products in epidemic areas, greatly affecting the foreign trade of animal products such as cattle, sheep and pigs, and seriously threatening human health. At present, the epidemic prevention measures for Brucellosis mainly focus on vaccine prevention. Common Brucellosis live vaccine varieties mainly include bovine Brucella A19 (S19) strain, pig Brucella S2 strain, sheep Brucella M5 strain and M5 - 90 strain, etc.
The National Brucellosis Prevention and Control Plan (2016 - 2020) implements regional management of brucellosis prevention and control, and one of the areas (15 provinces and Xinjiang Production and Construction Corps) adopts the prevention and control strategy based on immunization. However, in view of the interference of vaccine immunization in a class of areas on the detection of wild virus infection, it is of great significance to establish a detection method to distinguish vaccine strains from wild virus strains. At present, the reported methods for distinguishing and detecting vaccine strain S2 from wild strain include the double fluorescence PCR method based on the 25 bp base deletion of vaccine strain S2 (Nan W, Tan P, Wang Y, Xu Z, Mao K, Peng D, Chen Y. Duplex PCR for differentiation of the vaccine strain Brucella suis S2 and B. suis biovar 1 from other strains of Brucella spp. Vet J. 2014 Sep;201(3):427 - 8. doi: 10.1016/j.tvjl.2014.05.033. Epub 2014 May 27. PMID: 25011712; tan Pengfei. Establishment of differential diagnosis method between Brucella vaccine strain and wild strain based on PCR [D]. Yangzhou University, 2012). However, this method needs double probe detection, and the detection and typing cost is high. At present, there is an urgent need for a simpler typing detection method with lower detection cost.
SUMMARY
The purpose of the present invention is to provide the primer set, probe and application for identifying Brucella S2 vaccine strain and wild strain, so as to solve the problems existing in the prior art and realize the rapid discrimination between Brucella S2 vaccine strain and wild strain.
To achieve the above objective, the present invention provides the following scheme: according to one of the technical schemes, a set of primers and probes for identifying Brucella S2 vaccine strain and wild strain are provided, wherein the primer set comprises an upstream primer with a nucleotide sequence of SEQ ID NO.1 and a downstream primer with a nucleotide sequence of SEQ ID NO.2, and the probe has a nucleotide sequence of SEQ ID NO.3.
In a preferred embodiment, the 5' end of the probe nucleotide sequence is connected with a fluorescent group and the 3' end is connected with a quenching group.
In a preferred embodiment, the 5' end of the probe nucleotide sequence is connected with one of FAM, HEX, VIC, CY5 and TET. The quenching group connected to the 3' end of the probe nucleotide sequence is selected from one of BHQ and TAMRA series.
In the second technical scheme, a kit for identifying Brucella S2 vaccine strain and wild strain is provided, wherein the kit comprises the primer set and the probe.
In a preferred embodiment, the kit also includes a positive reference substance of Brucella S2 vaccine strain and a positive reference substance of Brucella wild strain.
The third technical proposal provides the application of the primer set and probe or the kit in identifying Brucella S2 vaccine strain and wild strain.
The fourth technical proposal provides a method for identifying Brucella S2 vaccine strain and wild strain, which comprises the following steps: 1) PCR amplification of nucleic acid templates of a sample to be tested and a positive reference substance by using the primer set and probe; 2) respectively analyse the melting curve to determine the type of the sample to be tested.
In a preferred embodiment, the reaction system of PCR is composed of the following components: Luna Universal Probe qPCR Master Mix 5.0 pl, upstream primer 0.8 pl, downstream primer 0.4 pl, probe 0.4 pl, template 1.0 pl and ddH:O 2.4 pl.
In a preferred embodiment, the PCR reaction procedure is: pre - denaturation at 95°C for 1 min; denaturing at 95°C for 15 s and annealing at 60°C for 30 s; cycling 55 times.
In a preferred embodiment, the melting curve analysis procedure is: denaturation at 95°C for 10 seconds; fluorescence signals are continuously collected at the rate of 0.13°C/s from 37°C to 97°C for 5 times/°C, and the melting curve is analysed.
The invention discloses the following technical effects: 1) aiming at the Brucella S2 vaccine strain, the invention designs and screens a set of primer sets and probes which can quickly identify Brucella S2 vaccine strain and wild strain, and the operation is simple, and only one probe is needed to realize the identification and detection of Brucella S2 vaccine strain and wild strain, thus breaking through the technical limitation of double probe detection in the prior art; the detection speed is fast and high - throughput, only one PCR is needed without sequencing operation, and the detection result can be obtained within 2 hours, and pure culture of Brucella is not needed, which greatly shortens the time required for differential detection of Brucella S2 vaccine strain and wild strain; 2) the PCR primer pair F/R of the invention can specifically amplify Brucella S2 vaccine strain and wild strain, which is helpful to improve the efficiency of PCR and reduce the detection time of Brucella; P probe can specifically hybridize with the nucleic acid site of Brucella S2 vaccine strain, with good specificity; the detection method established by the invention has better specificity, accurate detection result and high reliability; 3) the fluorescence detection method for quickly distinguishing Brucella S2 vaccine strain from wild strain of the invention has the lowest detection limit of 10 copies and higher sensitivity; 4) the invention provides an effective new tool for clinically preventing and screening brucellosis, greatly improves the efficiency of brucellosis prevention and control, is suitable for large - scale popularization and implementation, and has great application potential and potential commercial value.
BRIEF DESCRIPTION OF THE FIGURES In order to more clearly explain the embodiments of the present invention or the technical solutions in the prior art, the figures needed in the embodiments will be briefly introduced below.
Obviously, the figures in the following description are only some embodiments of the present invention, and for ordinary technicians in the field, other figures can be obtained according to these figures without creative efforts.
Fig. 1 shows SNP sites in the probe region of Brucella S2 vaccine strain and wild strain, and the name number is NCBI accession number - type - strain name in turn.
Fig. 2 is the melting curve of standardized sample fluorescence detection method, in which pS2 and pW are positive standards and water is negative control.
Fig. 3 is the melting curve of specificity test of fluorescence detection method. Brucella vaccine S2 strain, Brucella bovis 544A strain, Brucella suis 1330S strain, Brucella ovis 16M strain, Escherichia coli, Pasteurella suis, Streptococcus suis, Pseudomonas aeruginosa and Actinobacillus pleuropneumoniae are used as specific controls, pS2 and pW are positive controls and water is negative controls.
Fig. 4 is the melting curve of sensitivity test of fluorescence detection method. pS2 and pW standard plasmids are diluted by 10 times of 1.0 x 10 - 1.0 x 10° copies/yl, respectively, to ensure 1.0 x 108 - 1.0 x 10° copies/reaction and analysis sensitivity.
Fig. 5 is the melting curve of clinical samples detected by fluorescence detection method. There are 9 clinical samples including 5 bovine serum and 4 milk, with pS2 and pW as positive control and water as negative control.
Fig. 6 is the comparison result of sequencing probe region of positive sample.
DESCRIPTION OF THE INVENTION Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present invention.
It should be understood that the terms used in this invention are only for describing specific embodiments, and are not used to limit the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by the ordinary technicians in the field of this invention.
The materials, reagents and instruments used in the embodiment can be obtained commercially unless otherwise specified. Unless otherwise specified, the experimental methods used are all conventional experimental methods in this field.
The genomic nucleic acids of Brucella S2 vaccine and wild strain representative strains 544A, 1330S and 16M used in this invention are given by China Veterinary Drug Supervision Institute.
Embodiment 1 Designing and screening of primers and probes.
After screening a large number of primers and probes designed for Brucella S2 vaccine strain, it is found that primer pair F and R designed according to SNP site A290C of Brucella BSS2_10227(CP006961.1) and probe P fluorescence method could most effectively distinguish Brucella S2 vaccine strain from wild strain. The nucleotide sequences of primer pair F and R and probe P are as follows.
Primer f: 5' - GCTCGACAAGGAAATCAAG - 3 (SEQ ID NO: 1); R: 5'- TCAGGTCCGTGTAAAGATC -3' (SEQ ID NO: 2), P: 5' - CCAACCATTATTCTTTCGCGCCGCAATA - 3 (SEQ ID NO: 3).
The fluorescent group Texas Red is labelled at the 5' end of probe P, and the quenching group BHQ1 is labelled at the 3' end. However, other fluorescent groups and quenching groups that are conventional in the field can achieve the same effect.
As shown in Fig. 1, there is only one SNP site between Brucella S2 vaccine strain and wild strain at the position of probe P.
Embodiment 2 Establishment of fluorescence PCR detection method and melting curve analysis method 1) preparation of positive reference substance According to the results of probe sequence alignment analysis in Fig. 1, the sequence of Brucella S2 vaccine strain corresponding to probe P is one group, and other wild strains are another group. S2 vaccine nucleic acid and wild strain 1330S are used as templates, and the primer pairs DF: 5S'-TTATCCTTCCGCCCTACATCCG -3' (SEQ ID NO.4) and DR: 5'- TTCACCACCCTCGGCAACC -3' (SEQ ID NO.5) 5 are used as primers, and the nucleic acid fragments with the size of 1,590 bp are amplified by Premix Ex - Taq respectively. They are cloned into PMD18T Vector, named pS2 and pW in turn, which are used as positive controls of S2 vaccine strain and Brucella wild strain respectively.
2) Establishment of PCR system The two positive control samples obtained in step 1) are used as templates for fluorescence PCR amplification and melting curve analysis respectively. The PCR reaction system is a 10 pl reaction system, which specifically consists of the following components: Luna Universal Probe qPCR Master Mix 5.0 pl, 1 HM primer F 0.8 pl, 10 HM primer R 0.4 pl, 10 HM probe P 0.4 pl, template 1.0 pl and ddH20 2.4 pl. The reaction procedure of PCR is as follows: pre - denaturation at 95°C for 1 min; denaturing at 95°C for 15 s and annealing at 60°C for 30 s; cycling 55 times. 3) Melting curve analysis The PCR amplification products obtained in step 2) are analysed by LightCycler 96 analyser respectively. Melting curve analysis procedure: denaturation at 95°C for 10 s; from 37°C to 97°C, the fluorescence signal of Texas RedFAM is continuously collected at the rate of
0.13°C/s for 5 times/°C, and the melting curve is analysed. The melting curve analysis results are shown in Fig. 2. It can be seen that the melting curves of pS2 and pW positive control samples are separated from each other, indicating that the designed primers F, R and probe P are suitable for melting curve analysis of Brucella S2 vaccine strain and wild strain. The melting temperatures (Tm) of the two positive reference materials are different, pS2 is 71.8810.29°C and pW is 69.26+0.4°C. Embodiment 3 Specific detection The genomic nucleic acids of Brucella vaccine strain S2, Brucella bovis strain 544A, Brucella porcine strain 1330S, Brucella sheep strain 16M, and laboratory - preserved and extracted genomic nucleic acids of E. coli, Pasteurella, S. suis, P. aeruginosa, and actinobacillus pleuropneumoniae (App) are selected, respectively. The above nucleic acids and water (negative control) are used as PCR templates respectively, and the PCR amplification reactions and melting curve analysis methods established in Embodiment 2 are used for analysis, and the results are compared with those of the positive standard samples pS2 and pW. The melting curve peak pattern is shown in Fig. 3. As can be seen from Fig. 3, the detection method of the present invention can only specifically amplify Brucella positive standard sample and form a melting peak, while other pig disease - related bacteria can not amplify a specific melting peak. The results show that the primers F, R and probe P have good specificity and can be used for typing fluorescence detection of Brucella S2 vaccine strain and wild strain.
Embodiment 4 Sensitivity detection The positive controls pS2 and pW prepared in Embodiment 2 are diluted in a 10 - fold gradient to form 9 gradients of 1.0 x 108, 1.0 x 107, 1.0 x 108, 1.0 x 105, 1.0 x 10%, 1.0 x 103, 1.0 x 102, 1.0 x 10" and 1.0 x 10° copies/ul and analysed according to the established fluorescence PCR amplification reactions and melting curve analysis methods established in Embodiment 2, and the melting curve peaking graphs are shown in Fig. 4. From Fig. 4, it can be seen that the detection method showed an obvious decreased fluorescence signal with the decrease of nucleic acid concentration, the number of plasmids is as low as 10 copy/ul, and the corresponding fluorescence signal could be detected in Texas RedFAM channel, which proved that the detection method established by the invention had high sensitivity.
Embodiment 5 detection of clinical samples 1) sample selection: 5 samples of bovine serum and 4 samples of milk are randomly collected clinically, and genomic DNA is extracted by commercial kit; 2) sample detection: according to the fluorescence PCR amplification method and melting curve analysis method established in Embodiment 2, the samples are amplified and the melting curve is analysed; 3) result judgment: when the melting curve of pS2 standard sample is used as control, the absolute value of TM value of the melting peak between the sample to be detected and the positive control pS2 is less than 1.0°C, it is judged as Brucella S2 vaccine strain; if the absolute value of TM of the melting temperature of the sample to be tested and the positive control pS2 is 2.81+1°C, it is judged as Brucella wild strain. The melting curve analysis results are shown in Fig. 5. It can be seen that 9 clinical samples are negative for Brucella.
Comparative embodiment 1 Clinical test verification The samples tested in Embodiment 4 and 5 are tested by ordinary PCR, in which the primers are: DF: 5 - TTATCCTGTCACGCCTACATCCG -3 (SEQ ID NO:4); DR: 5 - TTCACCACCCTCGGCAACC - & (SEQ ID NO:5).
PCR system is a 20 pl reaction system, which specifically includes the following components: 6.4 ul of ddHzO, 10.0 ul of Premix Ex - Taq, 10 uM primer ASwaif 0.8 ul and 2.0 pl of template.
The PCR procedure includes: pre - denaturation at 95°C for 3 min; denaturation at 95°C for 40 s, annealing at 53°C for 1.5 min and extension at 72°C for 7 min; cycling 35 times.
The size of the target PCR product is 1,590 bp, which is recovered by electrophoresis gel and sent to sequencing company for sequencing.
The positive samples are Brucella vaccine S2 strain, Brucella bovis 544A strain, Brucella suis 1330S strain and Brucella sheep 16M strain. Five serum samples and four milk samples collected clinically are all Brucella negative. The sequencing results are shown in Fig. 6, which shows that the probe region of Brucella vaccine S2 strain is consistent with the probe, and there is SNP site A10C in the probe region of other positive samples, which is consistent with the typing results of the detection method established in this study. However, compared with the two methods, the sequencing method takes longer and the detection procedure is more complicated, which makes it impossible to achieve high throughput.
The above - mentioned embodiments only describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, all kinds of modifications and improvements made by ordinary technicians in the field to the technical scheme of the present invention should fall within the protection scope determined by the claims of the present invention.
Sequence list
<110> Institute of Animal Health, Guangdong Academy of Agricultural Sciences
Maoming Branch Center of Guangdong Laboratory for LingNan Modern Agricultural Science and Technology <120> Primer set, probe and application for distinguishing Brucella S2 vaccine strain from wild strain <130> SHX-Brucella S2 NL <150> CN202110297506.3 <151> 2021-03-19 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 gctcgacaag gaaatcaag 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 tcaggtccgt gtaaagatc 19 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 3 ccaaccatta ttctttcgcg ccgcaata 28 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 4 ttatcctgtc acgcctacat ccg 23 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 5 ttcaccaccc tcggcaacc

Claims (10)

CONCLUSIESCONCLUSIONS 1. Een set primers en probes voor het maken van onderscheid tussen een Brucella S2- vaccinstam en een wilde stam, waarbij de set primers een stroomopwaartse primer met een nucleotidesequentie van SEQ ID NO.1 en een stroomafwaartse primer met een nucleotidesequentie van SEQ ID NO.2 omvat, en de probe een nucleotidesequentie heeft van SEQ ID NO.3.1. A set of primers and probes for distinguishing between a Brucella S2 vaccine strain and a wild strain, the set of primers comprising an upstream primer having a nucleotide sequence of SEQ ID NO.1 and a downstream primer having a nucleotide sequence of SEQ ID NO. .2, and the probe has a nucleotide sequence of SEQ ID NO.3. 2. De set primers en probes voor het maken van onderscheid tussen een Brucella S2- vaccinstam en een wilde stam volgens conclusie 1, waarbij het 5'-uiteinde van de nucleotidesequentie van de probe verbonden is met een fluorescerende groep en het 3'- uiteinde verbonden is met een uitdovende groep.The set of primers and probes for distinguishing between a Brucella S2 vaccine strain and a wild strain according to claim 1, wherein the 5' end of the nucleotide sequence of the probe is linked to a fluorescent group and the 3' end associated with an extinct group. 3. De set primers en probes voor het maken van onderscheid tussen een Brucella S2- vaccinstam en een wilde stam volgens conclusie 2, waarbij de fluorescerende groep gekozen is uit FAM, HEX, VIC, CY5 en TET; en de uitdovende groep gekozen is uit een van de BHQ- en de TAMRA-reeksen.The set of primers and probes for distinguishing between a Brucella S2 vaccine strain and a wild strain according to claim 2, wherein the fluorescent group is selected from FAM, HEX, VIC, CY5 and TET; and the quenching group is selected from one of the BHQ and the TAMRA series. 4. Een samengestelde set voor de identificatie van een Brucella S2-vaccinstam en een wilde stam, waarbij de set set primers en probes volgens willekeurig welke van conclusies 1-3 omvat.A kit for the identification of a Brucella S2 vaccine strain and a wild strain, the kit comprising set of primers and probes according to any one of claims 1-3. 5. De samengestelde set voor de identificatie van een Brucella S2-vaccinstam en een wilde stam volgens conclusie 4, waarbij de set voorts een positieve referentiestof voor de Brucella S2-vaccinstam en een positieve referentiestof voor de wilde Brucella stam.The composite kit for identification of a Brucella S2 vaccine strain and a wild strain according to claim 4, wherein the kit further comprises a positive reference substance for the Brucella S2 vaccine strain and a positive reference substance for the wild Brucella strain. 6. Een toepassing van de set primers en probes volgens willekeurig welke van conclusies 1 — 3 of de samengestelde set volgens willekeurig welke van conclusies 4 - 5 voor het identificeren van een Brucella S2-vaccinstam en een wilde stam.A use of the set of primers and probes according to any one of claims 1 to 3 or the composite set according to any one of claims 4 to 5 for identifying a Brucella S2 vaccine strain and a wild strain. 7. Een werkwijze voor het maken van onderscheid tussen een Brucelfa S2-vaccinstam en een wilde stam, waarbij de werkwijze de volgende stappen omvat: 1) PCR-amplificatie van nucleinezuurmatrijzen van een te testen monster en een positieve controle door gebruik te maken van de set primers en de probes volgens willekeurig welke van conclusies 1 —3; 2) het analyseren van de smeltkromme om het type van het te testen monster te bepalen.A method for distinguishing between a Brucelfa S2 vaccine strain and a wild strain, the method comprising the steps of: 1) PCR amplification of nucleic acid templates from a sample to be tested and a positive control using the set of primers and the probes according to any one of claims 1-3; 2) analyzing the melting curve to determine the type of sample to be tested. 8. De werkwijze voor het maken van onderscheid tussen een Brucella S2-vaccinstam en een wilde stam volgens conclusie 7, waarbij het PCR - reactiesysteem de volgende bestanddelen omvat: Luna Universal Probe qPCR Master Mix 5,0 ul, stroomopwaartse primer 0,8 ul, stroomafwaartse primer 0,4 ul, probe 0,4 ul, sjabloon 1,0 yl en ddH2O 2,4 pl.The method for distinguishing between a Brucella S2 vaccine strain and a wild strain according to claim 7, wherein the PCR reaction system comprises the following components: Luna Universal Probe qPCR Master Mix 5.0 µl, upstream primer 0.8 µl , downstream primer 0.4 µl, probe 0.4 µl, template 1.0 µl and ddH2O 2.4 µl. 9. De werkwijze voor het maken van onderscheid tussen een Brucella S2-vaccinstam en een wilde stam volgens conclusie 7, waarbij de PCR - reactieprocedure als volgt is: — voordenatureren bij 95°C gedurende 1 min; — denatureren bij 95°C gedurende 15 s en — aaneenhechten van de strengen bij 60°C gedurende 30 s; waarbij deze cyclus 55 keer wordt uitgevoerd.The method for distinguishing between a Brucella S2 vaccine strain and a wild strain according to claim 7, wherein the PCR reaction procedure is as follows: pre-denaturing at 95°C for 1 min; — denaturing at 95°C for 15 s and — annealing the strands at 60°C for 30 s; where this cycle is performed 55 times. 10. De werkwijze voor het maken van onderscheid tussen een Brucella S2-vaccinstam en een wilde stam volgens conclusie 7, waarbij de analyseprocedure van de smeltkromme de volgende stappen omvat: — denatureren bij 95°C gedurende 10 seconden; — het continue verzamelen van fluorescentiesignalen met een snelheid van 0,13°C/s van 37°C tot 97°C gedurende 5 keer/°C, en — het analyseren van de smeltkromme.The method for distinguishing between a Brucella S2 vaccine strain and a wild strain according to claim 7, wherein the melting curve analysis procedure comprises the steps of: denaturing at 95°C for 10 seconds; — collecting fluorescence signals continuously at a rate of 0.13°C/s from 37°C to 97°C for 5 times/°C, and — analyzing the melting curve.
NL2031160A 2021-03-19 2022-03-04 Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain NL2031160B1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110297506.3A CN112899385A (en) 2021-03-19 2021-03-19 Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe

Publications (2)

Publication Number Publication Date
NL2031160A NL2031160A (en) 2022-09-27
NL2031160B1 true NL2031160B1 (en) 2022-12-02

Family

ID=76105664

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2031160A NL2031160B1 (en) 2021-03-19 2022-03-04 Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain

Country Status (2)

Country Link
CN (1) CN112899385A (en)
NL (1) NL2031160B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113817851A (en) * 2021-09-09 2021-12-21 内蒙古民族大学 Method for identifying S2 vaccine strain in Brucella infection strain

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016193896A1 (en) * 2015-05-30 2016-12-08 The Director General, Defence Research And Development Organisation (DRDO) Nucleotide sequences for simultaneous and differential identification of brucella spp
CN104862405A (en) * 2015-06-01 2015-08-26 何洪彬 Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid
CN105002173A (en) * 2015-08-07 2015-10-28 山东省农业科学院奶牛研究中心 Kit for identifying Brucella S2 vaccine strain and wild strain
CN105018489B (en) * 2015-08-07 2018-03-20 山东省农业科学院奶牛研究中心 Differentiate brucella street strain and vaccine strain A19 and S2 kit
CN108315483B (en) * 2018-03-30 2021-06-25 广东省农业科学院动物卫生研究所 Combination of primers and probes for distinguishing wild strains and vaccine strains of duck tembusu virus
CN111304342A (en) * 2019-12-23 2020-06-19 中国疾病预防控制中心传染病预防控制所 PCR kit for identifying Brucella strain S2 vaccine strain and wild strains of other species and use method thereof
CN111286552B (en) * 2020-03-13 2022-06-24 广东省农业科学院动物卫生研究所 PCR-HRM primer and method for identifying wild strains and vaccine strains of riemerella anatipestifer
CN111876502B (en) * 2020-07-28 2022-04-01 中国动物疫病预防控制中心(农业农村部屠宰技术中心) Method for identifying Brucella S2 vaccine strain by dual real-time fluorescent quantitative PCR and kit used by same
CN111778342A (en) * 2020-08-14 2020-10-16 新疆畜牧科学院兽医研究所（新疆畜牧科学院动物临床医学研究中心） Primers, probe and kit for identifying Brucella vaccine strain and wild strain
CN111778343A (en) * 2020-08-31 2020-10-16 青岛中创汇科生物科技有限公司 Primer pair and kit for detecting Brucella S2 vaccine strain and application of primer pair and kit
CN111793704B (en) * 2020-09-10 2021-01-05 中国疾病预防控制中心传染病预防控制所 SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof

Also Published As

Publication number Publication date
CN112899385A (en) 2021-06-04
NL2031160A (en) 2022-09-27

Similar Documents

Publication Publication Date Title
NL2031171B1 (en) Primer, Probe and Application for Identifying Brucella Vaccine Strain A 19 and Wild Strain
KR102044683B1 (en) Pepetide nucleic acid probe for identifying Coxiella burnetii and Method for identifying Coxiella burnetii using the same
CN108220480B (en) RPA fluorescent quantitative primer pair, probe and kit for specific detection of HPV18
CN105603123B (en) Real-time fluorescent RPA kit and test strip RPA kit for rapidly detecting porcine parvovirus and application thereof
WO2017143866A1 (en) Kit and method for quantitative detection of dna methylation in rprm genes
CN113201594A (en) Method for rapidly detecting food-borne Burkholderia gladioli
CN110408727B (en) CPA primer group for detecting J subgroup avian leukosis virus, CPA nucleic acid test strip kit and application thereof
CN113980957A (en) Single-stranded DNA probe based on CRISPR/Cas12a and method for detecting target nucleic acid
NL2031160B1 (en) Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
CN112458208B (en) Kit and method for detecting bovine sarcoidosis virus
KR20230057778A (en) Method and Kit for Diagnosing Bovine tuberculosis using PNA
CN113046476A (en) Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
CN109536625B (en) iiPCR detection method and detection kit for mycoplasma bovis
CN116656845A (en) Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof
KR20200129600A (en) Pepetide nucleic acid probe for genotyping Helicobacter pylori and Method using the same
CN111004855A (en) Primer combination and kit for detecting staphylococcus aureus
CN118207347B (en) Rapid detection method of haemophilus influenzae based on CRISPR-Cas12a system
CN117467781B (en) SNP (Single nucleotide polymorphism) marker, PCR (polymerase chain reaction) primer pair and probe pair related to brucella compound neonomine drug resistance, kit and application of SNP marker and PCR primer pair and probe pair
CN114634972B (en) Method for detecting nucleic acid by using Cas enzyme
Hasanpour et al. Development of a multiplex real-time PCR assay for phylogenetic analysis of uropathogenic Escherichia coli
CN101892313A (en) Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology
CN117587163A (en) Method for detecting African swine fever by using Cas enzyme
CN118600111A (en) RPA-CRISPR/Cas12a kit for detecting II-type grass carp reovirus and application thereof
CN117025733A (en) Probe and primer composition, detection system and application thereof in detecting single nucleotide polymorphism of ALDH2 gene
CN115747218A (en) CrRNA and kit for detecting simian pox virus nucleic acid