CN111304342A

CN111304342A - PCR kit for identifying Brucella strain S2 vaccine strain and wild strains of other species and use method thereof

Info

Publication number: CN111304342A
Application number: CN201911340838.4A
Authority: CN
Inventors: 杨晓雯; 田国忠; 姜海; 赵鸿雁; 朴东日
Original assignee: National Institute for Communicable Disease Control and Prevention of Chinese Center For Disease Control and Prevention
Current assignee: National Institute for Communicable Disease Control and Prevention of Chinese Center For Disease Control and Prevention
Priority date: 2019-12-23
Filing date: 2019-12-23
Publication date: 2020-06-19

Abstract

A PCR kit for identifying Brucella strain S2 vaccine strain and other wild strains and a use method thereof belong to the field of detection. The kit comprises PCR buffer solution, DNA polymerase, sterilized double distilled water, wild strain quality control standard substance and vaccine strain quality control standard substance, wherein the kit comprises a specific primer pair seq ID No.1 and seq ID No.2 for identifying the type 1 strain of the pig species, and a specific primer pair seq ID No.3 and seq ID No.4 of an S2 vaccine strain and the wild strain. The PCR kit has strong practicability, low cost, short time consumption and good repeatability, can quickly, effectively and visually identify the Brucella swine S2 vaccine strain and other wild strains in a sample by using electrophoresis to detect the size of an amplification strip after common PCR amplification, and is used for solving the difficult problem of differential diagnosis of the Brucella and the vaccine strain and the wild strains in the prevention and control process.

Description

PCR kit for identifying Brucella strain S2 vaccine strain and wild strains of other species and use method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a PCR kit for identifying Brucella strain S2 vaccine strain and other wild strains and a using method thereof

Background

Brucella is a facultative intracellular parasite that infects animals by direct contact or ingestion of dairy products and is susceptible to persistent host infection, causing a global zoonotic epidemic disease, brucellosis. The disease is mainly manifested by symptoms of fever, hyperhidrosis, debilitation, arthralgia, etc., serious patients lose labor ability, and public health safety and economic development are affected^[1]. Based on biochemical identification and host preference, the Brucella is internationally divided into 12 species^[2-6]. Brucella, which commonly infect humans, is mainly of the ovine (b.melitensis), bovine (b.abortus), porcine (b.suis) and canine (b.canis) species. If people are infected with brucella abortus and are not diagnosed in time, various complications such as rachitis, endocarditis, encephalitis and the like are easily caused^[7]. The worldwide incidence rate of the brucellosis is more than 50 ten thousand per year on average, and the incidence rate of the brucellosis in each million population of some epidemic countries is more than 100^[8]The incidence of brucellosis in the middle east per million population is above 200, the highest incidence of syrian disease (1603.4), but according to the investigation of the World Health Organization (WHO), the actual incidence is 10-25 times that of the report^[9]. The brucellosis of China is firstly reported in inner Mongolia^[10]The interspecies Brucella disease epidemic situation showed two epidemic peaks in 1957-1963 and 1969-1971. With the use of animal brucellosis vaccines, the incidence of brucellosis of human and livestock in the last 80-90 s has decreased significantly^[11]However, since the mid-90 s of the 20 th century, brucellosis has been devastating again domestically and expanded from north to south^[12]Disease cases reported in 32 provinces and municipalities throughout the country^[13]. In 2018, the incidence number of the brucellosis in China is 39296 cases, and is slightly reduced compared with 2017 (40042 cases). The existing research shows that the brucellosis in China is mainly distributed in provinces and autonomous regions with developed animal husbandry such as inner Mongolia and Xinjiang, and farmers, veterinarians and butcheriesThe infection and incidence of diseases of the slaughtering workers are high.

Due to the nature of the work, many veterinarians and herdsmen are involved in vaccine strain brucella infection. In china, the widely used brucella vaccine strains are the bovine species a19 and the swine species S2 vaccine strains. The swine S2 vaccine strain is separated from the fetus of aborted swine in 1952 by Chinese veterinary medicine inspection institute, and is biochemically identified as swine type 1 strain^[14]. The vaccine strain can generate good immunity to cattle, sheep and pigs, and the S2 vaccine strain is commonly used for preventing brucellosis in northern provinces of popular areas such as brucella at present. In the process of preventing animal brucellosis, the S2 vaccine strain is orally taken in an immunization mode, so veterinarians and breeders have higher brucella exposure risk, and the infection differential diagnosis of brucella wild strains and vaccine strains is difficult in actual work. At present, competitive ELISA (cELISA) and British light polarization test (FPT) are commonly adopted at home to identify S2 vaccine strain and wild strain infection, but for a sample with unknown serological background, single detection cannot determine whether the sample is infected by the vaccine strain S2; the molecular biology method (AMOS-PCR method) for identifying Brucella species can respectively identify strains of 1-3 subtypes of sheep species, 1, 2, 4 types of cattle species and 1 type of pig species through different fragment sizes^[15]The S2 vaccine strain and the wild strain cannot be distinguished; the existing method for differential diagnosis of the S2 vaccine strain and the wild strain needs sequencing, and has long time consumption and high cost. According to the method, the difference sequences of the genome of the S2 vaccine strain and the genome of the wild strain are compared according to the whole genome sequence of the vaccine strain, and the truly feasible difference sequence is screened out through multiple detections by combining the traditional Brucella species molecular biology typing method and is used for differential diagnosis of the vaccine strain S2 and other species of wild strains. The method has the advantages that instruments are common, the cost is low, whether the vaccine strain S2 is infected can be determined through visual inspection without sequencing, the method can be applied to identification, and the technical guarantee is practically provided for the identification and diagnosis of the Brucella swine S2 vaccine strain in China.

Reference to the literature

1.Nelson-Jones A.Brucellosis[J].Postgrad Med J,1952,28(324):529-534.

2.Foster G,B S Osterman,J Godfroid,et al.Brucella ceti sp.nov.andBrucella pinnipedialis sp. nov.for Brucella strains with cetaceans and sealsas their preferred hosts[J].Int J Syst Evol Microbiol,2007,57(Pt 11):2688-2693.

3.Ronai Z,Z Kreizinger,A Dan,et al.First isolation andcharacterization of Brucella microti from wild boar[J].BMC Vet Res,2015,11:147.

4.Whatmore A M,N Davison,A Cloeckaert,et al.Brucella papionissp.nov.,isolated from baboons(Papio spp.)[J].Int J Syst Evol Microbiol,2014,64(Pt 12):4120-4128.

5.Scholz H C,K Nockler,C Gollner,et al.Brucella inopinata sp.nov.,isolated from a breast implant infection[J].Int J Syst Evol Microbiol,2010,60(Pt 4):801-808.

6.Scholz H C,S Revilla-Fernandez,S A Dahouk,et al.Brucella vulpissp.nov.,isolated from mandibular lymph nodes of red foxes(Vulpes vulpes)[J].Int J Syst Evol Microbiol,2016, 66(5):2090-2098.

7.Boschiroli M L,V Foulongne and D O'callaghan.Brucellosis:aworldwide zoonosis[J].Curr Opin Microbiol,2001,4(1):58-64.

8.Bukhari E E.Pediatric brucellosis.An update review for the newmillennium[J].Saudi Med J, 2018,39(4):336-341.

9.Hasanjani Roushan M R and S Ebrahimpour.Human brucellosis:Anoverview[J].Caspian J Intern Med,2015,6(1):46-47.

10.Zia S H and F L Wang.Brucellosis in north China；a clinical,etiological and epidemiological study[J].Am J Trop Med Hyg,1949,29(6):925-936.

11.Li Z J,B Y Cui,H Chen,et al.Molecular typing of Brucella suiscollected from 1960s to 2010s in China by MLVA and PFGE[J].Biomed EnvironSci,2013,26(6):504-508.

12.Piao D R,X Liu,D D Di,et al.Genetic polymorphisms identify inspecies/biovars of Brucella isolated in China between 1953and 2013by MLST[J].BMC Microbiol,2018,18(1):7.

13.Li Y J,X L Li,S Liang,et al.Epidemiological features and riskfactors associated with the spatial and temporal distribution of humanbrucellosis in China[J].BMC Infect Dis,2013,13: 547.

14.Di D D,H Jiang,L L Tian,et al.Comparative genomic analysis betweennewly sequenced Brucella suis Vaccine Strain S2 and the Virulent Brucellasuis Strain 1330[J].BMC Genomics, 2016,17(1):741.

15.Bricker B J and S M Halling.Differentiation of Brucella abortusbv.1,2,and 4,Brucella melitensis,Brucella ovis,and Brucella suis bv.1by PCR[J].J Clin Microbiol,1994,32(11): 2660-2666.

Disclosure of Invention

The inventor discovers that the S2 vaccine strain and a parent wild strain B.suis1330 whole genome sequence comparison shows that the S2 vaccine strain has 69bp sequence insertion (CGCGCGTCGATTATGATGCCAATTGCCGGAGGGAAGTGCGGGAGGAAACGGGTATC GACCTTGCCGATG) in a gene BS1330_ I1369, according to the insertion sequence, the invention designs specific primer pairs seq ID No.3 and seq ID No.4, and can respectively identify sheep 1-3 subtypes,

cattle

1, 2, 4 types and pig 1 types through different fragment sizes by combining a traditional molecular biology identification brucella species identification method, screen specific primer pairs seq ID No.1 and seq ID No.2, and respectively identify brucella swine S2 vaccine strain and other species wild strain infection according to the sizes of amplified fragments of the two pairs of specific primer pairs. The above is the technical basis for the present invention.

The invention aims to provide a kit which can quickly, effectively and intuitively identify brucella swine S2 vaccine strains and other wild strains in samples and is used for solving the difficult problems of identification and diagnosis of the vaccine strains and the wild strains in the process of brucellosis and prevention and control and a using method thereof, and the kit can quickly and intuitively identify brucella swine S2 vaccine strains and other wild strains in the samples. The method has the advantages of common instruments, low cost, no need of sequencing, visual inspection and capability of determining whether the vaccine strain S2 is infected, and can be applied to identification.

In order to realize the purpose of the invention, the following technical scheme is adopted:

the PCR kit consists of PCR buffer solution, DNA polymerase, sterilized double distilled water, wild strain quality control standard substance and vaccine strain quality control standard substance; the PCR buffer solution comprises specific primer pairs seq ID No.1 and seq ID No.2 for identifying the type 1 strain of the pig species, and specific primer pairs seq ID No.3 and seq ID No.4 for an S2 vaccine strain and a wild strain, wherein the nucleotide base sequences are respectively as follows:

seq ID No.1：5’-TGCCGATCACTTAAGGGCCTTCAT-3’

seq ID No.2：5’-GCGCGGTTTTCTGAAGGTTCAGG-3’

seq ID No.3：5’-GACCCGTCGCCGATAAGG-3’

seq ID No.4：5’-ACGGCGTTGCCTCATTCA -3’

the wild strain quality control standard comprises a standard strain Brucella suis1330 with a turbidity regulation of 0.5McF (1.5 × 108 bacteria/mL) of a swine species type 1 strain and is subjected to heat inactivation at 80 ℃ for 60min, and the vaccine strain quality control standard comprises a vaccine strain S2 with a turbidity regulation of 0.5McF (1.5 × 10)⁸bacteria/mL) is inactivated by heat at 80 ℃ for 60 min;

the DNA polymerase may be a conventional DNA polymerase.

The sterilized double distilled water is a negative quality control standard substance in the reagent kit.

A method for identifying Brucella strain S2 vaccine strain and other wild strains by using the kit comprises the following steps:

(1) extracting the genome DNA of the sample to be detected, and detecting the concentration by a nucleic acid concentration detector to be higher than 1 ng/. mu.L. The sample to be tested includes but is not limited to blood, serum, milk sample, tissue sample, aerosol sample.

(2) Taking the extracted sample genome DNA as a template, respectively adding the template and DNA polymerase into PCR buffer solution containing a specific primer pair seq ID No.1 and seq ID No.2 and a specific primer pair seq ID No.3 and seq ID No.4, simultaneously carrying out wild strain quality control standard, vaccine strain S2 quality control standard and negative quality control standard control, and carrying out PCR amplification. The PCR amplification conditions were: 5min at 94 ℃, 30s at 55-58 ℃, 30s at 72 ℃ and 35 cycles at 72 ℃ for 10 min.

The PCR amplification system specifically comprises: mu.L of 10 XPCR Buffer, 8. mu.L of dNTP mix (2.5mM), 2. mu.L seq ID No.1/seq ID No.3 (i.e.forward primer), 2. mu.L seq ID No.2/seq ID No.4 (i.e.reverse primer), 0.5. mu.L DNA polymerase, 27.5. mu.L sterile double distilled water, 5. mu.L of extracted DNA template.

(3) Preparing 1.5% agarose gel, taking 5-10 μ L of the PCR product to carry out agarose gel electrophoresis detection, wherein the detection conditions are as follows: voltage 80v, electrophoresis time 1h 10min, and observing the size of the strip after electrophoresis.

(4) And (4) judging a result: the wild strain quality control standard and the vaccine strain quality control standard are amplified to obtain fragments, and the negative quality control standard (namely, the sterilized double distilled water) is not amplified to obtain strips, otherwise, the test fails and needs to be repeated.

For using the specific primer pair seq ID No.1 and seq ID No.2, detecting and amplifying a fragment (namely a 285bp fragment) with the same size with the wild strain quality control standard and the vaccine strain quality control standard by using agarose gel, and then obtaining the swine species 1 strain; fragments with consistent sizes are not amplified and are infected by other subtypes of sheep species, cattle species, dog species, pig species or other infections.

For the use of the specific primer pair seq ID No.3 and seq ID No.4, combining the results of the specific primer pair seq ID No.1 and seq ID No.2, if the specific primer pair seq ID No.1 and seq ID No.2 amplifies the fragments (285 bp fragments) with the sizes consistent with the wild strain quality control standard and the vaccine strain quality control standard and the a. the specific primer pair seq ID No.3 and seq ID No.4 amplifies the fragments (349 bp fragments) with the sizes consistent with the wild strain quality control standard, the strain is the type 1 wild strain; b. the specific primer pair seq ID No.3 and seq ID No.4 amplifies the fragment (418 bp fragment) with the same size as the quality control standard of the vaccine strain S2, and the fragment is the swine vaccine strain S2. If the specific primer pair seq ID No.1 and seq ID No.2 does not amplify a fragment (285 bp fragment) with the same size as the wild strain quality control standard and the vaccine strain quality control standard and the a-specific primer pair seq ID No.3 and seq ID No.4 amplifies a single fragment with the same size as the wild strain quality control standard (349 bp)/vaccine strain S2 quality control standard (418 bp fragment), the strain is a wild strain of sheep species, cattle species, dog species or other subtypes of pig species; b. the specific primer pair seq ID No.3 and seq ID No.4 do not amplify fragments with the same size as the wild strain quality control standard (349 bp) and the vaccine strain S2 quality control standard (418 bp fragments), and the fragments are not infected by the common Brucella; c. two fragments with the same size as the wild strain quality control standard (349 bp) and the vaccine strain S2 quality control standard (418 bp fragment) are amplified by the specific primer pair seq ID No.3 and seq ID No.4, and then the brucella strain is infected in a mixed way.

The identification kit and the use method thereof directly aim at identifying the strain type rather than obtaining the disease diagnosis result.

The specificity of the specific primer pair seq ID No.3 and seq ID No.4 is extremely high, and the specific primer pair seq ID No.1 and seq ID No.2 are combined, so that the Brucella strain S2 vaccine strain and other wild strains can be effectively distinguished through agarose electrophoresis detection.

The invention is used for diagnosis and treatment of non-diseases.

The invention provides a PCR kit capable of quickly, effectively and intuitively identifying a Brucella swine S2 vaccine strain and other wild strains in a sample and a use method thereof, which are used for solving the difficult problem of differential diagnosis of the Brucella swine S2 vaccine strain and other wild strains in the process of prevention and control of Brucella disease. The method can be applied to identification, can be completely popularized and applied, and is beneficial to promoting the diagnosis, epidemiological investigation and prevention and control of brucellosis.

Drawings

FIG. 1 shows the differential fragment detection of vaccine strain S2 and wild strain. Lanes from left to right are negative control, DNAmarker, vaccine strain S2, wild strain B.suis1330, sheep, cattle, dog, pig type 2, respectively.

FIG. 2 shows the results of detection of vaccine strain S2, wild strain and common Brucella species. From left to right, the lanes are genomic DNA samples extracted from DNAmarker, wild strain quality control standard, vaccine strain quality control standard, sheep species, cattle species, pig species type 2, dog species and pig species type 1 Brucella respectively.

FIG. 3 shows the results of the detection of vaccine strain S2, wild strain and partial vaccine infection samples. FIG. 3A shows the amplification results of seq ID No.1 and seq ID No.2 with the selected primers, and the lanes from left to right are DNA marker, DNA sample 1-4 infected with vaccine strain S2, Brucella detection negative sample, negative control, and vaccine strain quality control standard. FIG. 3B shows the amplification results of seq ID No.3 and seq ID No.4 with the selected primers, and the agarose electrophoresis results show that the lanes from left to right are negative control, DNAmarker, vaccine strain quality control standard, wild strain quality control standard, mixed vaccine strain S2 and sample infected by wild strain, DNA sample 4 infected by vaccine strain S2, brucella detection negative sample, DNA sample 3 infected by vaccine strain S2, DNA sample 2 infected by vaccine strain S2, and DNA sample 1 infected by vaccine strain S2, respectively.

FIG. 4 shows the detection results of vaccine strain S2, wild strain and isolate. Lanes from left to right are respectively a negative control, a DNAmarker, a vaccine strain quality control standard, a wild strain quality control standard and a Brucella isolate.

Detailed Description

The following examples are intended to further illustrate the invention but are not intended to limit the scope of the invention.

The following examples were conducted according to conventional test conditions and methods or according to test conditions recommended by the manufacturer.

1. Test materials

The swine Brucella vaccine strain S2(B.suis S2), the bovine Brucella 544A (B.abortus 544A), the ovine Brucella 16M (B.melitensis 16M), the canine Brucella RM6/66(B.canis RM6/66), the background clear vaccine strain S2 infects sample DNA, and the sample is separated and identified as a swine Brucella 1 isolate by conventional biochemistry, and the like, and the sample is preserved by infectious disease prevention and control of the Chinese disease prevention and control center.

10 XPCR Buffer, dNTP mix (2.5mM), DNA polymerase from Baozhen (Dalian) Co., Ltd., agarose from Qinkuan New Industrial Bio Co., Ltd.,

the Genomic DNA Purification Kit genome extraction Kit is purchased from Promega corporation, the PCR primer is synthesized by Biotechnology engineering (Shanghai) GmbH, and other biochemical reagents are imported, subpackaged or domestic analytically pure.

2. Testing instrument

PCR amplification instrument (Thermo Co.), electrophoresis instrument (six instruments of Beijing), gel imaging instrument (Bio-Rad Co., Ltd.)

Example 1 method of using PCR kit for identifying Brucella strain S2 vaccine strain and wild strain of other species

(1) The genome extraction kit is used for extracting genome DNA of samples such as blood, serum, milk samples, tissue samples, aerosol samples and the like, and the concentration detected by a nucleic acid concentration detector is higher than 1 ng/muL.

(2) Taking the extracted sample genome DNA as a template, respectively adding the template and DNA polymerase into PCR buffer solution containing a specific primer pair seq ID No.1 and seq ID No.2 and a specific primer pair seq ID No.3 and seq ID No.4, simultaneously carrying out wild strain quality control standard, vaccine strain S2 quality control standard and negative quality control standard control, and carrying out PCR amplification. The PCR amplification conditions were: 5min at 94 ℃, 30s at 55 ℃, 30s at 72 ℃ and 35 cycles at 72 ℃ for 10 min.

The PCR amplification system is 50 mu L, and specifically comprises: mu.L of 10 XPCR Buffer, 8. mu.L of dNTP mix (2.5mM), 2. mu.L of seq ID No.1/seq ID No.3 (i.e.forward primer), 2. mu.L of seq ID No.2/seq ID No.4 (i.e.reverse primer), 0.5. mu.L of DNA polymerase, 27.5. mu.L of sterile double distilled water, 5. mu.L of extracted DNA template.

(3) Preparing 1.5% agarose gel, taking 5-10 microliter of common PCR product to carry out agarose gel electrophoresis detection, wherein the detection conditions are as follows: voltage 80v, electrophoresis time 1h 10min, and observing the size of the strip after electrophoresis.

(4) And (4) judging a result: the wild strain quality control standard and the vaccine strain quality control standard are amplified to form fragments, and the negative quality control standard (namely, the sterilized double distilled water) is not amplified to form strips. For using the specific primer pair seq ID No.1 and seq ID No.2, detecting and amplifying a fragment (namely a 285bp fragment) with the same size with the wild strain quality control standard and the vaccine strain quality control standard by using agarose gel, and then obtaining the swine species 1 strain; fragments with consistent sizes are not amplified and are infected by other subtypes of sheep species, cattle species, dog species, pig species or other infections.

Example 2 Assembly of PCR kit

(1) Preparation of PCR reaction solution

a. Two pairs of specific amplification primers are designed and synthesized by biological engineering (Shanghai) corporation, and the specific primer sequences are as follows:

forward primer seq ID No. 1: 5'-TGCCGATCACTTAAGGGCCTTCAT-3'

Reverse primer seq ID No. 2: 5'-GCGCGGTTTTCTGAAGGTTCAGG-3'

Forward primer seq ID No. 3: 5'-GACCCGTCGCCGATAAGG-3'

Reverse primer seq ID No. 4: 5'-ACGGCGTTGCCTCATTCA-3'

b, preparing a PCR buffer solution:

the PCR amplification system is 50 mu L, and specifically comprises: mu.L of 10 XPCR Buffer, 8. mu.L of dNTP mix (2.5mM), 2. mu.L of seq ID No.1/seq ID No.3 (i.e.forward primer) (concentration 10. mu. moL/L after primer dilution), 2. mu.L of seq ID No.2/seq ID No.4 (i.e.reverse primer), 0.5. mu.L of DNA polymerase, 27.5. mu.L of sterile double distilled water, 5. mu.L of extracted DNA template.

(2) Preparing a wild strain quality control standard:

the control standard of wild strain quality is adjusted to have turbidity of 0.5McF (1.5 multiplied by 10) by a standard strain of swine type 1 (B.suis 1330)⁸Bacteria count/mL) was heat inactivated at 80 ℃ for 60 min.

(3) Preparing a vaccine strain quality control standard:

the turbidity of the vaccine strain quality control standard is adjusted to 0.5McF (1.5 × 10) by the swine S2 vaccine strain (B.suis S2)⁸bacteria/mL) is inactivated by heat at 80 ℃ for 60 min;

(4) preparing a negative quality control standard:

the negative quality control standard substance is sterilized double distilled water with the volume of 5 mu L.

Example 3 feasibility detection of Brucella vaccine strain S2 and wild strain specific amplification primers

The PCR kit is adopted to detect genome DNA extracted from a swine S2 vaccine strain, a swine 1 type wild strain, a sheep species, a cattle species, a dog species and a swine 2 type strain respectively, primers are selected as seq ID No.3 and seq ID No.4, and negative control is set.

The feasibility detection result of the specific amplification primers of the Brucella vaccine strain S2 and the wild strain is shown in figure 1. Agarose electrophoresis results show that lanes from left to right are respectively negative control, DNA marker, vaccine strain S2, wild strain B.suis1330 of pig type 1, sheep species, cattle species, dog species and pig species type 2. The negative control does not amplify a band, the amplified fragment of the pig species S2 is larger than the amplified fragment of the wild strain, and the amplified fragments of the 2-type strains of the sheep species, the cattle species, the dog species and the pig species are consistent with the amplified fragment of the vaccine strain S2. According to the comparison result with the DNAmarker, the amplified fragments are about 400bp and between 300 and 400bp respectively.

Example 4 detection of quality control standards for wild strains and vaccine strains

The PCR kit is adopted to detect the prepared wild strain quality control standard and the vaccine strain quality control standard respectively, and simultaneously genome DNA extracted from Brucella melitensis of sheep species, cattle species, pig species 2 and dog species is used as a control, primers are selected as seq ID No.1 and seq ID No.2, and negative control is set.

The detection results of the wild strain quality control standard and the vaccine strain quality control standard are shown in figure 2. Agarose electrophoresis results show that the lanes from left to right are genomic DNA samples extracted from DNA marker, wild strain quality control standard, vaccine strain quality control standard, sheep species, cattle species, pig species type 2, dog species and pig species type 1 Brucella respectively. The negative control does not amplify a strip, the wild strain quality control standard and the vaccine strain quality control standard amplify fragments with the same size as the swine type 1 strain, and the amplified fragments are respectively between 200 and 300bp according to the comparison result with the DNA marker.

Example 5 detection of infection sample with clear background vaccine strain S2

The positive brucella and clear background stored in a laboratory are respectively 4 parts of DNA sample infected by vaccine strain S2, 1 part of brucella negative DNA sample, and 1 part of DNA sample infected by mixed vaccine strain S2 and wild strain, and the detection is carried out according to a PCR kit, and meanwhile, negative control is set.

The detection result of the vaccine strain S2 infection sample with clear background is shown in figure 3. In FIG. 3, A is the amplification results of seq ID No.1 and seq ID No.2 selected as primers, and the agarose electrophoresis results show that lanes from left to right are DNA marker, DNA sample 1-4 infected by vaccine strain S2, Brucella detection negative sample, negative control, and vaccine strain quality control standard. The result shows that the negative control and brucella detection negative sample does not amplify a strip, and the DNA sample 1-4 infected by the vaccine strain S2 and the quality control standard of the vaccine strain amplify fragments with the same size.

In fig. 3, B is the amplification result of seq ID No.3 and seq ID No.4 selected as primers, and the agarose electrophoresis result shows that lanes from left to right are respectively negative control, DNA marker, vaccine strain quality control standard, wild strain quality control standard, mixed vaccine strain S2 and sample infected by wild strain, DNA sample 4 infected by vaccine strain S2, brucella detection negative sample, DNA sample 3 infected by vaccine strain S2, DNA sample 2 infected by vaccine strain S2, and DNA sample 1 infected by vaccine strain S2. And a strip is not amplified in the negative control, single fragments with the size consistent with the quality control standard of the vaccine strain are amplified in DNA samples 1-4 infected by the vaccine strain S2, fragments are not amplified in the brucella detection negative sample, and two fragments with the size consistent with the sizes of the wild strain and the quality control standard of the vaccine strain are amplified in the sample infected by the mixed vaccine strain S2 and the wild strain.

Example 6 isolation of Brucella Strain assays

And (3) performing differential diagnosis of the vaccine strain S2 and a wild strain on the Brucella isolate which is stored in a laboratory and is identified as the type 1 of the pig strain respectively, wherein the primers are selected as a specific primer pair seq ID No.3 and seq ID No. 4.

The differential diagnosis of Brucella isolates is shown in FIG. 4. Agarose electrophoresis results show that lanes from left to right are respectively a negative control, a DNA marker, a vaccine strain quality control standard, a wild strain quality control standard and a brucella isolate. The result shows that the negative control does not amplify a band, and the wild strain quality control standard and the isolate sample amplify fragments with the same size. Specific primer pair seq ID No.1 and seq ID No.2 for amplifying pig variety type 1 sequence

Amplification of wild strain sequences by specific primer pair seq ID No.3 and seq ID No.4

Specific primer pair seq ID No.3 and seq ID No.4 for amplifying vaccine strain S2 sequence

。

Claims

1. A PCR kit for identifying Brucella strain S2 vaccine strain and other wild strain is characterized by comprising specific primer pairs seq ID No.1 and seq ID No.2 for identifying type 1 strain of pig strain, and specific primer pairs seq ID No.3 and seq ID No.4 for S2 vaccine strain and wild strain, wherein the nucleotide base sequences are respectively as follows:

seq ID No.1：5’-TGCCGATCACTTAAGGGCCTTCAT-3’

seq ID No.2：5’-GCGCGGTTTTCTGAAGGTTCAGG-3’

seq ID No.3：5’-GACCCGTCGCCGATAAGG-3’

seq ID No.4：5’-ACGGCGTTGCCTCATTCA-3’。

2. the PCR kit for identifying the Brucella strain S2 vaccine strain and other wild strains according to claim 1, which is characterized by comprising PCR buffer solution, DNA polymerase, sterilized double distilled water, wild strain quality control standard substance and vaccine strain quality control standard substance; the PCR buffer solution comprises a specific primer pair seq ID No.1 and seq ID No.2 for identifying the type 1 strain of the pig strain, and a specific primer pair seq ID No.3 and seq ID No.4 for identifying the type 1 strain of the S2 vaccine strain and the wild strain;

the wild strain quality control standard is adjusted to have a turbidity of 0.5McF (1.5 multiplied by 10) by a standard strain Brucella suis1330 of the swine species 1⁸Bacteria count/mL) is inactivated by heat at 80 deg.C for 60min, and the turbidity of the vaccine strain quality control standard is adjusted to 0.5McF (1.5 × 10) by using swine S2 vaccine strain⁸Bacteria count/mL) was heat inactivated at 80 ℃ for 60 min.

3. The method for identifying the Brucella strain S2 vaccine strain and other wild strains by using the kit of claim 1 or 2, which comprises the following steps:

(1) extracting the genome DNA of a sample to be detected, and detecting the concentration by a nucleic acid concentration detector to be higher than 1 ng/muL;

(2) taking the extracted sample genome DNA as a template, respectively adding the template and DNA polymerase into PCR buffer solution containing a specific primer pair seq ID No.1 and seq ID No.2 and a specific primer pair seq ID No.3 and seq ID No.4, simultaneously carrying out wild strain quality control standard, vaccine strain S2 quality control standard and negative quality control standard control, and carrying out PCR amplification;

(3) preparing 1.5% agarose gel, taking 5-10 μ L of the PCR product to carry out agarose gel electrophoresis detection, wherein the detection conditions are as follows: voltage is 80v, electrophoresis time is 1h 10min, and the size of a strip is observed after electrophoresis is finished;

(4) and (4) judging a result: amplifying fragments of the wild strain quality control standard and the vaccine strain quality control standard, wherein the negative quality control standard, namely the sterilized double distilled water, does not amplify strips, otherwise, the test fails and needs to be redone;

for using the specific primer pair seq ID No.1 and seq ID No.2, detecting and amplifying the fragments with the same size as the wild strain quality control standard and the vaccine strain quality control standard by agarose gel, and then obtaining the type 1 strain of the pig; fragments with consistent sizes are not amplified and are infected by other subtypes of sheep species, cattle species, dog species, pig species or other infections.

4. The method according to claim 3, wherein the sample to be tested in step (1) is selected from the group consisting of blood, serum, milk, tissue sample, and aerosol sample.

5. The method according to claim 3, wherein the PCR amplification conditions in step (1) are: 5min at 94 ℃, 30s at 55-58 ℃, 30s at 72 ℃ and 35 cycles at 72 ℃ for 10 min.

6. The method according to claim 3, wherein the PCR amplification system of step (1) comprises: mu.L of 10 XPCR Buffer, 8. mu.L of dNTP mix (2.5mM), 2. mu.L of seq ID No.1/seq ID No.3 i.e.forward primer, 2. mu.L of seq ID No.2/seq ID No.4 i.e.reverse primer, 0.5. mu.L of DNA polymerase, 27.5. mu.L of sterile double distilled water, 5. mu.L of extracted DNA template.

7. The method according to claim 3, wherein, when the result of step (4) is judged, for the use of the specific primer pair seq ID No.3 and seq ID No.4, the result of the specific primer pair seq ID No.1 and seq ID No.2 is combined, if the specific primer pair seq ID No.1 and seq ID No.2 amplify a fragment 285bp which is consistent with the size of the quality control standard of the wild strain and the quality control standard of the vaccine strain, and the fragment 349bp which is consistent with the size of the quality control standard of the wild strain is amplified by the a specific primer pair seq ID No.3 and seq ID No.4, the wild strain is the swine type 1; b. amplifying a fragment with the same size as the quality control standard of the vaccine strain S2, namely a 418bp fragment by using the specific primer pair seq ID No.3 and seq ID No.4, and obtaining a swine vaccine strain S2;

if the specific primer pair seq ID No.1 and seq ID No.2 does not amplify a fragment (285 bp fragment) with the same size as the wild strain quality control standard and the vaccine strain quality control standard and the a-specific primer pair seq ID No.3 and seq ID No.4 amplifies a single fragment with the same size as the wild strain quality control standard (349 bp/vaccine strain S2 quality control standard, 418bp fragment), the strain is the wild strain of other subtypes of the sheep species, the cattle species, the dog species or the pig species; b. the specific primer pair seq ID No.3 and seq ID No.4 do not amplify fragments with the same size as the 349bp of the wild strain quality control standard and the 418bp of the vaccine strain S2 quality control standard, and do not belong to common Brucella species infection; c. two fragments with the same size as the 349bp of the wild strain quality control standard substance and the 418bp of the vaccine strain S2 quality control standard substance are amplified by the specific primer pair seq ID No.3 and seq ID No.4, and then the Brucella strain is subjected to mixed infection.

8. The use of the kit of claim 1 or 2 for identifying brucella suis S2 vaccine strain from wild strains of other species.