CN117587163A

CN117587163A - Method for detecting African swine fever by using Cas enzyme

Info

Publication number: CN117587163A
Application number: CN202210978439.6A
Authority: CN
Inventors: 刘艳艳; 赵莹
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2022-08-16
Filing date: 2022-08-16
Publication date: 2024-02-23

Abstract

The invention provides a method for detecting African swine fever by using Cas protein, in particular to a method, a system and a kit for detecting target nucleic acid based on CRISPR technology, wherein the detection method comprises the step of contacting target nucleic acid to be detected with Cas protein, gRNA and a single-stranded nucleic acid detector.

Description

Method for detecting African swine fever by using Cas enzyme

Technical Field

The invention relates to the field of nucleic acid detection, and relates to a method for detecting nucleic acid by using Cas protein, in particular to a method, a system and a kit for detecting African swine fever based on a CRISPR technology.

Background

African swine fever (African Swine Fever) is an acute, hemorrhagic, virulent infectious disease caused by infection of domestic pigs and various wild pigs (such as African wild pigs, european wild pigs, etc.) with African swine fever virus (African Swine fever virus). The world animal health organization lists the animal epidemic disease as legal report animal epidemic disease, which is also an animal epidemic situation that is important to prevent in China. The method is characterized in that the morbidity process is short, the mortality rate of the most acute and acute infections is up to 100%, the clinical manifestations are fever (up to 40-42 ℃), the heart beat is accelerated, the breathing is difficult, partial cough, serous or mucopurulent secretion exists in eyes and noses, skin is cyanoted, lymph nodes, kidneys and gastrointestinal mucosa are obviously bleeding, and the clinical symptoms of African swine fever are similar to those of swine fever, and can be diagnosed only by means of laboratory monitoring.

The detection of specific nucleic acid molecules established at present usually requires two steps, the first step being the amplification of the nucleic acid of interest and the second step being the detection of the nucleic acid of interest. Existing detection techniques include restriction endonuclease methods, southern, northern, spot hybridization, fluorescent PCR detection techniques, LAMP loop-mediated isothermal amplification techniques, recombinase Polymerase Amplification (RPA), and the like. After 2012, CRISPR gene editing technology is raised, zhang Feng team developed a new nucleic acid diagnosis technology (shrlock technology) of targeting RNA with Cas13 as a core based on RPA technology, doudna team developed a diagnosis technology (detect technology) with Cas12 enzyme as a core, chinese academy of sciences Shanghai plant physiology and ecology institute king doctor and the like developed a new nucleic acid detection technology (HOLMES technology) based on Cas 12. Nucleic acid detection techniques developed based on CRISPR technology are playing an increasingly important role.

The CRISPR/Cas Type V system is a newly discovered class of CRISPR systems that have a 5' -TTN motif that performs cohesive end cleavage of a target sequence, e.g., cpf1, C2C1, casX, casY. However, the different CRISPR/Cas currently in existence each have different advantages and disadvantages. For example, cas9, C2C1 and CasX each require two RNAs for guide RNAs, whereas Cpf1 requires only one guide RNA and can be used for multiplex gene editing. CasX has a size of 980 amino acids, whereas common Cas9, C2C1, casY and Cpf1 are typically around 1300 amino acids in size. In addition, PAM sequences of Cas9, cpf1, casX, casY are all relatively complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted compared to other systems, thereby reducing potential off-target effects.

Cas12i also belongs to the V-type CRISPR/Cas system, chinese patent (CN 111757889B, publication date: 20210525) discloses a V-type Cas enzyme (Cas12f.4), and in the present invention, cas12f.4 is defined as Cas12i. The invention provides a novel method for detecting African swine fever virus, which is based on a CRISPR technology, in particular to a novel efficient detection activity of a Cas12i mutant on African swine fever, and provides a rapid, simple and convenient detection method with high specificity and high detection sensitivity.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting African swine fever virus based on a CRISPR technology.

In one aspect, the invention provides a method of detecting african swine fever virus in a sample to be tested, the method comprising contacting a nucleic acid to be tested with a Cas protein, a gRNA, and a single-stranded nucleic acid detector; detecting a detectable signal generated by cleavage of the single-stranded nucleic acid detector by the Cas protein, thereby detecting african swine fever virus; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target nucleic acid; compared with the amino acid sequence of the parent Cas protein, the amino acid sequence shown in SEQ ID No.8 is mutated at any one or more of the following amino acid positions, namely, the 369 th amino acid and the 433 th amino acid.

In one embodiment, the Cas protein has a mutation at amino acid position 369 described above; further, the mutation of the 433 th amino acid site is included on the basis of the 369 th amino acid mutation.

Preferably, the 369 th amino acid is mutated to arginine (Arg, R) and the 433 th amino acid is mutated to arginine (Arg, R). The Cas protein is mutated Cas12i, which is mutated protein in which the 369 th amino acid and the 433 th amino acid of SEQ ID No.8 are mutated simultaneously (both mutated into R), and compared with the wild Cas12i shown in SEQ ID No.8, the mutated Cas12i protein has obviously improved editing activity and detection activity.

In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 8.

In one embodiment, the amino acid sequence of the parent Cas protein is shown as SEQ ID No. 8.

In one embodiment, the target nucleic acid is derived from african swine fever virus.

The biological functions of the Cas protein include, but are not limited to, activity of binding to a guide RNA, endonuclease activity, activity of binding to and cleaving at a specific site of a target sequence under the guidance of a guide RNA, including, but not limited to Cis cleavage activity and Trans cleavage activity.

In one embodiment, the gRNA includes a first segment and a second segment; the first segment is also known as a "framework region", "protein binding segment", "protein binding sequence", or "Direct Repeat (Direct Repeat) sequence"; the second segment is also referred to as a "targeting sequence of a targeting nucleic acid" or a "targeting segment of a targeting nucleic acid", or a "targeting sequence of a targeting nucleic acid".

In one embodiment, the gRNA comprises, in order from the 5 'end to the 3' end, a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid.

In one embodiment, the targeting sequence that hybridizes to a target nucleic acid comprises 20-30 bases and hybridizes to the sequence shown in SEQ ID No.1 or a reverse sequence thereof, and the targeting sequence comprises any of the sequences shown in SEQ ID Nos. 2-6; preferably, the targeting sequence comprises the sequence shown in any one of SEQ ID No.2, 3, 4, 5, 6; more preferably, the targeting sequence comprises the sequence shown in SEQ ID No. 3.

In preferred embodiments, the targeting sequence that hybridizes to the target nucleic acid comprises 20-30 bases, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises any of the sequences shown in SEQ ID Nos. 2-6, and further comprises 1-10 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9 bases) at the 3' end of any of the sequences shown in SEQ ID Nos. 2-6, and hybridizes to the sequence shown in SEQ ID No.1 or its reverse complement.

The hybridization with the sequence shown in SEQ ID No.1 or the reverse complement thereof means that a continuous segment of the targeting sequence and the sequence shown in SEQ ID No.1 or the reverse complement of the sequence shown in SEQ ID No.1 can be subjected to continuous complementary pairing. For example, the targeting sequence that hybridizes to the target nucleic acid comprises 30 bases, and then 30 bases of the targeting sequence require complementary pairing with consecutive 30 bases of the sequence of SEQ ID No.1 or its complement.

In one embodiment, the targeting sequence that hybridizes to a target nucleic acid is a continuous deletion of 1-5 bases (e.g., 1, 2, 3, 4, 5 bases) at the 3' end of any of the sequences shown in SEQ ID Nos. 2-6 as compared to any of the sequences shown in SEQ ID Nos. 2-6.

In a more preferred embodiment, the targeting sequence that hybridizes to a target nucleic acid is set forth in any one of SEQ ID Nos. 2-6.

In one embodiment, the sequence of the region of the gRNA that binds to Cas protein is shown as agagaaugug ugcauagucacac (SEQ ID No. 7) or cucugaccac cugagagaau gugugcauag ucacacggua uaacaacuuc gacgagcucu (SEQ ID No. 16).

In other embodiments, the region of the gRNA that binds to Cas protein (or called the cognate repeat) may also have a base deletion, substitution, or addition on the basis of SEQ ID No.7 or SEQ ID No.16, as long as it ensures binding to Cas12i, e.g. "agagaaugugugcauagucaacac", "agagaaugugugcauagucuacac", "agagaaugugugcauaguccacac", or "agagaaugugugcauagucgacac" as described in chinese patent application (CN 113337502 a).

Further, the method further comprises the step of obtaining a test nucleic acid from the test sample; preferably, the nucleic acid to be detected is obtained from the sample to be detected by an amplification method.

In the present invention, the nucleic acid to be measured may be a double-stranded nucleic acid or a single-stranded nucleic acid.

In one embodiment, the target nucleic acid is an amplification product selected from one or more of PCR, nucleic Acid Sequencing Based Amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase Dependent Amplification (HDA), or Nicking Enzyme Amplification Reaction (NEAR), multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR), or derivative amplification method (RAM); preferably, loop-mediated isothermal amplification (LAMP) amplification is employed.

In one embodiment, the LAMP amplification comprises a set of LAMP primer sets:

outer forward primer F3: the sequence is shown as SEQ ID No. 10;

the sequence of the outer reverse primer B3 is shown as SEQ ID No. 11;

the sequence of the inner forward primer FIP is shown as SEQ ID No. 12;

inner reverse primer BIP: the sequence is shown as SEQ ID No. 13;

loop primer LF: the sequence is shown as SEQ ID No. 14;

the sequence of the loop primer LB is shown as SEQ ID No. 15.

In one embodiment, the sample may be cell culture, blood, secretions, excretions (feces, urine), interstitial fluid, lymph fluid, viscera, fetus, pig products, diseased pig tissue, lymph nodes, spleen, liver, intestine, and the like; preferably, the sample is from porcine serum, saliva, lymph node, spleen or lung.

In other embodiments, the sample may also be derived from environmental samples of the farm, e.g., air, water, soil, contamination of a contact with a sick pig, farm equipment, vector insects with viruses, and the like.

In another aspect, the invention also provides a system, composition or kit for detecting or diagnosing african swine fever, comprising the Cas protein, the gRNA and the single-stranded nucleic acid detector described above.

Further, the system, composition or kit further comprises a LAMP primer set.

In another aspect, the invention also provides the use of the system or the composition for detecting or diagnosing African swine fever in preparing a reagent or a kit for diagnosing or detecting African swine fever or African swine fever virus.

Further, the Cas protein is selected from any one of the following groups I-III:

I. a Cas mutein resulting from mutation of the amino acid sequence shown in SEQ ID No.8 at a site comprising either or both of the following amino acids: 369 th and 433 th bits;

II. Compared to the Cas mutein of I, there is a mutation site as described in I; and, a Cas mutein having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to the Cas mutein of I;

III, compared to the Cas mutein of I, having the mutation site described in I; and, a sequence having one or more amino acid substitutions, deletions, or additions compared to the Cas mutein of I; the one or more amino acids include substitutions, deletions or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

In one embodiment, the Cas protein mutant comprises an amino acid substitution, deletion, or substitution, and the mutant retains at least its trans-cleavage activity. Preferably, the mutants have Cis and trans cleavage activity.

In the present invention, the single-stranded nucleic acid detector includes single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector comprises single-stranded DNA, single-stranded RNA, or a mixture of any two or three of single-stranded DNA-RNA hybrids, e.g., a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrids, a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single stranded nucleic acid detector further comprises modifications to the bases.

In a preferred embodiment, the single stranded nucleic acid detector is a single stranded oligonucleotide detector.

The single stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: visual-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase change/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring the detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein recognizes or hybridizes to the target nucleic acid and can trigger the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector to generate a detectable signal.

In the present invention, the detectable signal may be any signal that is generated when a single-stranded nucleic acid detector is cleaved. For example, gold nanoparticle based detection, fluorescence polarization, fluorescence signal, colloidal phase change/dispersion, electrochemical detection, semiconductor based sensing. The detectable signal may be read out by any suitable means including, but not limited to: measurement of detectable fluorescent signals, gel electrophoresis detection (by detecting a change in the band on the gel), detection based on the presence or absence of a visual or sensor color, or differences in color (e.g., based on gold nanoparticles), and differences in electrical signals.

In a preferred embodiment, the detectable signal is achieved by: different reporting groups are respectively arranged at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable reporting signal can be displayed; for example, a single-stranded nucleic acid detector may exhibit a detectable fluorescent signal when cleaved, with a fluorescent group and a quenching group disposed at each end of the single-stranded nucleic acid detector.

In one embodiment, the fluorophore is selected from one or any of FAM, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or TAMRA.

In other embodiments, the detectable signal may also be implemented by: different labeling molecules are respectively arranged at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and a reaction signal is detected in a colloidal gold detection mode.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal before cleavage by the Cas protein and a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, etc., to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain phosphorus atoms in the backbone and those that do not have phosphorus atoms in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatom nucleoside linkages. In other embodiments, the single stranded nucleic acid detector may be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetic is a Peptide Nucleic Acid (PNA), and another class of nucleic acid mimetics is based on a linked morpholino unit (morpholino nucleic acid) having a heterocyclic base linked to a morpholino ring, and other nucleic acid mimetics further include cyclohexenyl nucleic acid (CENA) and further include ribose or deoxyribose chains.

In one embodiment, the single stranded nucleic acid detector has 2-300 nucleotides, preferably 3-200 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

The term "hybridization" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence that enables it to bind non-covalently, i.e., form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. Typically, the hybridizable nucleic acid is 8 nucleotides or more in length (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It will be appreciated that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. Polynucleotides may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region in a target nucleic acid sequence to which it hybridizes.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living bodies are composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence of 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when two sequences are aligned to produce maximum identity. Such an alignment may be determined by computerized operation algorithms (GAP, BESTFIT, FASTA in Wisconsin Genet ics software package, and TFASTA, genetics Computer Grou p) using, for example, the identity of amino acid sequences may be determined by conventional methods, with reference to, for example, the teachings of Smith and Waterman,1981,Adv.Appl.Math.2:482Pearson&Lipma n,1988,Proc.Natl.Acad.Sci.USA 85:2444,Thompsonetal, 1994,Nucleic Acids Res 22:467380, etc. The BLAST algorithm available from the national center for Biotechnology information (NCBI www.ncbi.nlm.ni h.gov /) may also be used, using default parameters for determination.

As used herein, the "CRISPR" refers to clustered, regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats) from the immune system of a microorganism.

As used herein, "biotin" is also known as vitamin H, a small molecule vitamin having a molecular weight of 244 Da. "avidin" is also known as avidin, which is an alkaline glycoprotein having 4 binding sites with very high affinity for biotin, and is commonly known as streptavidin. The extremely strong affinity of biotin for avidin can be used to amplify or enhance the detection signal in a detection system. For example, biotin is easily combined with protein (such as antibody) by covalent bond, while avidin molecule combined with enzyme reacts with biotin molecule combined with specific antibody, thus playing the role of multi-stage amplification, and achieving the purpose of detecting unknown antigen (or antibody) molecule due to the catalytic action of enzyme when encountering corresponding substrate.

Target nucleic acid

As used herein, the term "target nucleic acid" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested). The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single cell organisms such as bacteria, yeasts, protozoa, amoebas and the like, multicellular organisms (e.g. plants or animals, including samples from healthy or surface healthy human subjects or human patients affected by the condition or disease to be diagnosed or investigated, e.g. infection by pathogenic microorganisms such as pathogenic bacteria or viruses). For example, the biological sample may be a biological fluid obtained from, for example, blood, plasma, serum, urine, stool, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion, exudate (e.g., fluid obtained from an abscess or any other site of infection or inflammation) or a fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab of a skin or mucosal surface. The sample may also be a sample obtained from any organ or tissue (including a biopsy or autopsy specimen, such as a tumor biopsy) or may comprise cells (primary cells or cultured cells) or a medium conditioned by any cell, tissue or organ. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cell centrifuge preparations, cytological smears, bodily fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (e.g., tumor biopsies), fine needle aspirates, and/or tissue sections (e.g., cryostat tissue sections and/or paraffin embedded tissue sections).

In the present invention, the target nucleic acid further includes a DNA molecule formed by reverse transcription of RNA, and further, the target nucleic acid may be amplified by using a technique known in the art, such as isothermal amplification technique and non-isothermal amplification technique, and the isothermal amplification may be nucleic acid sequencing-based amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), or Nicking Enzyme Amplification Reaction (NEAR). In certain exemplary embodiments, non-isothermal amplification methods may be used, including, but not limited to, PCR, multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR), or derivative amplification methods (RAM).

Further, the detection method of the present invention further comprises a step of amplifying the target nucleic acid; the detection system further comprises a reagent for amplifying the target nucleic acid. The amplified reagents include one or more of the following group: DNA polymerase, strand displacing enzyme, helicase, recombinase, single-stranded binding protein, and the like.

Cas proteins

"Cas protein" as used herein refers to a CRISPR-associated protein, preferably from a type V CRISPR/Cas protein, which upon binding to the feature sequence to be detected (target sequence), i.e. forming a ternary complex of Cas protein-gRNA-target sequence, can induce its trans activity, i.e. randomly cleaving non-targeted single stranded nucleotides, i.e. the single stranded nucleic acid detector described herein, preferably single stranded DNA (ssDNA), single stranded DNA-RNA hybrids, single stranded RNA. When the Cas protein binds to a signature sequence, it either cleaves or does not cleave the signature sequence, which can induce its trans activity; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single stranded signature sequence.

The Cas protein of the present invention is a protein having at least trans-cleavage activity, preferably, the Cas protein is a protein having Cis and trans-cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize PAM sites and specifically cut target sequences under the action of gRNA; however, when the target sequence is a single-stranded nucleic acid, a PAM site is not necessary.

In embodiments, the Cas protein referred to herein also encompasses functional variants of Cas or homologs or orthologs thereof. "functional variant" of a protein as used herein refers to a variant of such a protein that retains, at least in part, the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Functional variants also include fusion products of such proteins with another nucleic acid, protein, polypeptide or peptide that is not normally associated. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, or an ortholog or homolog thereof, may be codon optimized for expression in eukaryotic cells. Eukaryotes may be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or an ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding the same may have one or more mutations).

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, sart, legionella, treponema, actinomyces, eubacterium, streptococcus, lactobacillus, mycoplasma, bacteroides, flaviivola, flavobacterium, azospirillum, sphaerochaeta, gluconacetobacter, neisseria, rochanterium, parvibacum, staphylococcus, nifctifraactor, mycoplasma, campylobacter and chaetobacter.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule for encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by the cell or disrupted by conventional extraction techniques to obtain the protein. The coding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements that facilitate sequence integration, or self-replication. The vector may be, for example, a plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art, and preferably the expression vector in the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, streptomyces, agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select appropriate vectors and host cells.

gRNA

As used herein, the "gRNA" is also known as guide RNA or guide RNA, and has the meaning commonly understood by those of skill in the art. In general, the guide RNA can comprise, consist essentially of, or consist of, a direct (direct) repeat sequence and a guide sequence (spacer), also referred to in the context of endogenous CRISPR systems. The gRNA may include crRNA and tracrRNA, or may contain only crRNA, depending on the Cas protein on which it depends, in different CRISPR systems. The crRNA and tracrRNA may be fused by artificial engineering to form single guide RNA (sgRNA). In certain instances, a targeting sequence is any polynucleotide sequence that has sufficient complementarity to a target sequence (a feature sequence described herein) to hybridize to the target sequence and direct specific binding of a CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The co-repeat sequence can be folded to form a specific structure (e.g., a stem-loop structure) for Cas protein recognition to form a complex. The targeting sequence need not be 100% complementary to the feature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of matching) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, the Smith-Waterman algorithm (Smith-Waterman), bowtie, geneious, biopython, and SeqMan in ClustalW, matlab.

The gRNA of the invention can be natural or artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector according to the present invention means a detector comprising a sequence of 2 to 200 nucleotides, preferably 2 to 150 nucleotides, preferably 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector of the present invention comprises different reporter groups or marker molecules at both ends which, when in an initial state (i.e. not cleaved), exhibit no reporter signal and, when cleaved, exhibit a detectable signal, i.e. a detectable distinction between after and before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid contains a characteristic sequence to be detected; alternatively, if the detectable difference cannot be detected, it is reflected that the target nucleic acid does not contain the feature sequence to be detected.

In one embodiment, the reporter or marker molecule comprises a fluorophore and a quencher, wherein the fluorophore is selected from one or more of FAM, HEX, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In one embodiment, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to the 5 'end and a second molecule (e.g., biotin) attached to the 3' end. The reaction system containing the single-stranded nucleic acid detector is matched with a flow strip to detect a characteristic sequence (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody binding to a first molecule (i.e., a first molecular antibody) at the sample contact end (colloidal gold), an antibody binding to the first molecular antibody at the first line (control line), and an antibody binding to a second molecule (i.e., a second molecular antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g., color). As more reporter is cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (lateral) flow test or a (lateral) flow immunochromatographic assay. In certain aspects, the molecules in the single stranded nucleic acid detector may be interchanged or the positions of the molecules may be changed, so long as the reporting principle is the same or similar to that of the present invention, and the modified manner is also included in the present invention.

The detection method provided by the invention can be used for quantitative detection of target nucleic acid. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of the fluorescent group, the width of the color-developing strip, and the like.

Sequence information

The partial sequence information according to the present invention is provided as follows:

sequence number	Description of the invention
		SEQ ID No.1	Amplified target nucleic acid sequence
SEQ ID No.2	Targeting region of gRNA-1
		SEQ ID No.3	Targeting region of gRNA-2
SEQ ID No.4	Targeting region of gRNA-3
		SEQ ID No.5	Targeting region of gRNA-4
SEQ ID No.6	Targeting region of gRNA-5
		SEQ ID No.7	gRNA DR region
SEQ ID No.8	Amino acid sequence of wild Cas12i
		SEQ ID No.9	Nucleic acid sequence of wild Cas12i
SEQ ID No.10	LAMP outer forward primer F3
		SEQ ID No.11	LAMP outer reverse primer B3
SEQ ID No.12	LAMP inner forward primer FIP
		SEQ ID No.13	LAMP inner reverse primer BIP
SEQ ID No.14	LAMP loop primer LF
		SEQ ID No.15	LAMP Loop primer LB
SEQ ID No.16	gRNA DR region

Drawings

Fig. 1. Verification of editing efficiency of Cas12i protein, wherein 1 is wild-type Cas12i and 2 is mutant Cas12i protein (N369R and S433R).

FIG. 2.GRNA Activity validation results, abscissa is sample number, ordinate is fluorescence intensity, curve 1 is test results for the experimental group, and curve 2 is test results for the negative control group. FIG. 2a shows the results of activity detection of p72 lamp2 Cr-1; FIG. 2b shows the results of activity detection of p72 lamp2 Cr-2; FIG. 2c shows the results of activity assays for p72 lam p2 Cr-3; FIG. 2d shows the results of the activity assay of p72 lamp2 Cr-4; FIG. 2e shows the results of activity assays for p72 lamd2 Cr-5.

FIG. 3 shows the specific detection result of the African swine fever detection kit.

FIG. 4 shows the results of the detection of different subtypes of African swine fever.

Description of the embodiments

The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.

The technical scheme of the invention is based on the following principle that nucleic acid of a sample to be detected is obtained, for example, target nucleic acid can be obtained by an amplification method, and the target nucleic acid is identified and combined by using the gRNA which can be paired with the target nucleic acid to guide Cas protein; subsequently, the Cas protein excites the cleavage activity of the single-stranded nucleic acid detector, thereby cleaving the single-stranded nucleic acid detector in the system; fluorescent groups and quenching groups are respectively arranged at two ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence is excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label that can be detected by colloidal gold.

Example 1 acquisition of Cas12i muteins

The applicant carries out site-directed mutagenesis on the amino acid which is combined with the target sequence of the potential Cas12i3 through a bioinformatics method, the amino acid sequence of the wild Cas12i is shown as SEQ ID No.8, and the nucleic acid sequence is shown as SEQ ID No. 9. Site-directed mutagenesis methods referring to methods commonly used in the art, variants of Cas proteins were generated by PCR-based site-directed mutagenesis in this example. The specific method is to design a DNA sequence of the Cas12i3 protein into two parts by taking a mutation site as a center, design two pairs of primers to amplify the two parts of DNA sequences respectively, introduce the sequences to be mutated on the primers, and finally load the two fragments on a pcDNA3.3-eGFP vector in a Gibson cloning mode. The combination of mutants was constructed by splitting the DNA of Cas12i3 protein into multiple segments using PCR, gibson clone. Fragment amplification kit: transStart FastPfu DNA Polymerase (containing 2.5mM dNTPs) and the specific experimental procedures are shown in the specification. Glue recovery kit:gel DNA Extraction Mini Kit, the detailed experimental procedures are shown in the specification. Kit for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU 201-03), the specific experimental procedures are described in the specification. The mutant amino acid sites and primer sequences used in this embodiment are shown in the following table:

In this embodiment, a mutant protein of Cas12i in which N369R and S433R are mutated simultaneously is obtained by site-directed mutagenesis, wherein the amino acid sequence of the mutant protein is mutated to R at position 369 and mutated to R at position 433 as compared to SEQ ID No. 8.

Verifying the activity of gene editing of the mutated Cas12i protein in animal cells, designing a target point for a chinese hamster ovary Cell (CHO) FUT8 gene, and FUT8-Cas-XX-g3: TTCCAGCCAAGGTTGTGGACGGATCA, italic part PAM sequence, underlined region targeting region. The vector pcDNA3.3 is transformed to carry EGFP fluorescent protein and PuroR resistance genes. The SV40 NLS-Cas-XX fusion protein is inserted through enzyme cutting sites XbaI and PstI; the U6 promoter and the gRNA sequence are inserted through the enzyme cutting site Mfe 1. The CMV promoter initiates expression of the fusion protein SV40 NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS is linked to the protein GFP with the linker peptide T2A. Promoter EF-1. Alpha. Initiates puromycin resistance gene expression. And (3) paving: CHO cells were plated at a confluence of 70-80% and the number of cells seeded in 12 well plates was 8 x 10 x 4 cells/well. Transfection: plating for 24h for transfection, 6.25. Mu.l Hieff Trans were added to 100. Mu.l opti-MEM ^TM A liposome nucleic acid transfection reagent, and mixing uniformly; mu.l opti-ME M was added with 2.5ug plasmid and mixed well. Diluted Hieff Trans ^TM The liposome nucleic acid transfection reagent is mixed with the diluted plasmid uniformly and incubated for 20min at room temperature. The incubated mixture is added to the cell-plated medium for transfection. Screening by adding puromycin: puromycin was added 24h after transfection, at a final concentration of 10. Mu.g/ml. Puromycin treatment for 24h was replaced with normal medium and incubation continued for 24h.

Extracting DNA, PCR amplifying the vicinity of the editing region, and carrying out hiTOM sequencing: cells were collected after pancreatin digestion and genomic DNA was extracted using the cell/tissue genomic DNA extraction kit (baitaike). Amplifying the region near the target for genomic DNA. The PCR products were subjected to hiTOM sequencing. Sequencing data analysis, counting sequence types and proportions in the range of 15nt and 10nt at the upstream and downstream of the target position, and counting mutation frequencies of SNV (single nucleotide sequences) with frequency greater than/equal to 1% or non-SNV in the sequenceAnd (3) at/equal to 0.06% of the sequence, the editing efficiency of the Cas-XX protein on the target position is obtained. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g3: TTC (TTC)CAGCCAAGGTTGTGGACGGATCAThe italic portion is PAM sequence and the underlined region is the targeting region. The gRNA sequence is: AGAGAAUGUGUGCAUAGUCAACACCAGCCAAGGUUGUGGACGGAUCAThe underlined region is the targeting region, and the other regions are DR (repeat sequence) regions.

As shown in fig. 1, 1 is the editing efficiency of the wild Cas12i protein, 2 is the editing efficiency of the Cas12i protein with the combined mutation of N369R and S433R, and compared with the wild Cas12i protein, the Cas12i protein with the combined mutation of N369R and S433R has significantly improved editing efficiency, which is improved by nearly 1 time, and the types of editing the target gene include base deletion, base insertion, base substitution and the like.

In the subsequent examples 2-5, nucleic acid detection experiments were performed using Cas12i proteins with increased efficiency of the combination mutations of N369R and S433R.

Example 2 LAMP isothermal amplification primer design and screening of gRNA

2.1 design of LAMP primer

LAMP amplification fragments are designed according to the partial sequence of the African swine fever virus P72 gene, the amplified target sequence is shown as SEQ ID No.1, and the obtained amplification primers are shown in the following table:

TABLE 1 LAMP primer specific sequence information

Name of the name	Sequence information (5 '-3')
		p72 LAMP F3	CTCGGTGTTGATGAGGATT
p72 LAMP B3	CCCCTGAAATACACAACCT
		p72 LAMP FIP	TGCTCTTAAATGGCCCATTGAATATTGATCGGAGATGTTCCAGG
p72 LAMP BIP	TCATCGTGGTGGTTATTGTTGGTTTTGTAAAACGCGTTCGC
		p72 LAMP LF	TGTTTAIAGGATTAAAACCT
p72 LAMP LB	GTCACCTGCGTTTTATGGACACG

2.2, gRNA design selection and Activity validation

5 gRNAs are designed in the LAMP amplification section, the first 3 bases at the 5' -end of each gRNA are TTN (PAM sequence), and the binding regions of the 5 gRNAs and the target nucleic acid are respectively: the experimental design shows that the gRNAs of p72 lamp2 Cr-1 (gRNA-1), p72 lamp2 Cr-2 (gRNA-2), p72 lamp2 Cr-3 (gRNA-3), p72 lamp2 Cr-4 (gRNA-4) and p72 lamp2 Cr-5 (gRNA-5) have the length of 20bp, and the addition or reduction of the base at the 3' end on the basis of the length can not substantially influence the activity of the gRNA, and the gRNA has the length of 16-28bp, and the specific sequence information is shown in the following table:

TABLE 2 specific sequence information of gRNA

Note that: the italics in the sequence information in the tables are DR regions that bind to the protein, and the underlined regions are the sequences of the gRNA targeting target nucleic acid.

And (3) verifying the activity of the gRNA, respectively carrying out in-vitro double-strand cleavage experiments on 5 designed gRNA, wherein the target nucleic acid is double-strand DNA containing a gRNA sequence, and the target nucleic acid adopts a LAMP amplification and enzyme digestion detection system, and the table is shown below:

TABLE 3 LAMP amplification System

TABLE 4 enzyme digestion system

The experimental steps are as follows: (1) LAMP amplification is carried out at 65 ℃ for 30min and stored at 4 ℃; (2) Mixing 15ul of enzyme cutting systems which are added at the top of a PE pipe in advance together by centrifugation in the enzyme cutting systems, mixing the enzyme cutting systems upside down, and centrifuging again; (3) The enzyme was digested at 37℃for 20s in one cycle, and fluorescence was read once per cycle.

As shown in FIG. 2, the fluorescence curve 1 is a test group, the fluorescence curve 2 is a negative control without adding target nucleic acid in the system, the dotted line is the number of corresponding cycles for the test group to reach the detection plateau, i.e., the detection time to reach the plateau, p72 lamp2 Cr-1 reaches the detection plateau at 11 minutes, p72 lamp2 Cr-2 reaches the detection plateau at 9 minutes, p72 lamp2 Cr-3 reaches the detection plateau at 11 minutes, p72 lamp2 Cr-4 reaches the detection plateau at 15 minutes, and p72 lamp2 Cr-5 does not reach the detection plateau.

As is clear from the above results, the double strand cleavage activity of p72 lamp2 Cr-2 was better than that of p72 lamp2 Cr-1, p72 lamp2 Cr-3, p72 lamp2 Cr-4, and p72 lamp2 Cr-5, and the subsequent experiments (examples 3 to 5) were performed by selecting gRNA p72 lamp2 Cr-2 having a good double strand cleavage effect.

Implementation 3. African swine fever detection kit specificity detection result

Cas enzyme digestion is carried out after LAMP amplification is carried out in the experiment, the identification condition of the African swine fever kit for different types of swine diseases is detected, the specificity of the African swine fever detection kit is verified, an experimental object comprises a swine endogenous gene, PRV (quality control of pseudorabies live vaccine), PRRSV (quality control of porcine circovirus type 2 inactivated vaccine), PCV (porcine reproductive and respiratory syndrome virus) and CSFV (quality control of swine fever virus), the amplification system is the same as that in the table 3 of the example 2, the experimental steps refer to the example 2, the enzyme digestion system refers to the table 4, and gRNA is p72 LAMP2 Cr-2.

As shown in FIG. 3, the horizontal axis represents the number of samples, the vertical axis represents the fluorescence intensity, and only the fluorescence curve of the target nucleic acid containing African swine fever can be detected, and for other types of diseases, the endogenous genes and PRRSV, PRV, PCV, CSFV of the swine fever are not detected.

Example 4 detection of African swine fever Virus of different subtypes

According to the subtype types of the African swine fever viruses which are currently popular globally, subtypes such as I, II, V, VIII, IX, X are selected for experiments, and the detection conditions of the African swine fever virus detection kit for the African swine fever viruses of other subtypes are detected. Amplification System, cleavage System and Experimental procedure reference example 2, gRNA was p72 lamp2 Cr-2..

As a result, as shown in FIG. 4, fluorescence curve 1 was African swine fever type I virus, fluorescence curve 2 was African swine fever type II virus, fluorescence curve 5 was African swine fever type V virus, fluorescence curve 8 was African swine fever type VIII virus, fluorescence curve 9 was African swine fever type IX virus, and fluorescence curve 10 was African swine fever type X virus.

According to the results, the common African swine fever virus I, II, V, VIII, IX, X with various subtypes can be detected by using the LAMP-Cas system, and the African swine fever kit in the application has broad spectrum, can detect the African swine fever viruses with various subtypes, and is suitable for various detection environments.

Example 5 detection of sensitivity of African swine fever detection kit

5 concentration gradients of 5.8 copies/. Mu.l, 2.9 copies/. Mu.l, 1.4 copies/. Mu.l, 0.7 copies/. Mu.l and 0.35 copies/. Mu.l are set for the LAMP amplification reaction template, 8 positive repeats are set for each concentration gradient according to the LAMP amplification system, the enzyme digestion system and the experimental procedure in example 3, and the lowest concentration with the detection rate of > 85% is the lowest concentration limit which can be detected by the kit of the application, namely the detection limit. The detection results are shown in the following table:

sample concentration	Number of detected repetition	Detection rate of
			5.8copies/μl	8 pieces of	100％
2.9copies/μl	8 pieces of	100％
			1.4copies/μl	7 pieces of	87.5％
0.7copies/μl	3 pieces of	37.5％
			0.35copies/μl	4 pieces of	50％

As can be seen from the above table, when the sample concentration is 5.8 copies/. Mu.l, 8 positive samples are repeatedly detected, and the detection rate is 100%; when the concentration of the sample is 2.9 copies/. Mu.l, 8 positive samples are repeatedly detected, and the detection rate is 100%; when the concentration of the sample is 1.4 copies/. Mu.l, 7 samples are repeatedly detected from 8 positives, and the detection rate is 87.5%; 3 samples were repeatedly detected for 8 positives when the sample concentration was 0.7 copies/. Mu.l, and the detection rate was 37.5%; when the sample concentration was 0.35 copies/. Mu.l, 4 samples were repeatedly detected for 8 positives, and the detection rate was 50%.

According to the standard that the lowest sample concentration with the detection rate of >85% is the lowest detection limit of the kit, namely the detection limit of the kit is 1.4 copies/. Mu.l, the kit has higher sensitivity compared with other African swine fever detection kits.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate that: many modifications and variations of details may be made to adapt to a particular situation and the invention is intended to be within the scope of the invention. The full scope of the invention is given by the appended claims together with any equivalents thereof.

Claims

1. A method of detecting african swine fever virus, the method comprising contacting a nucleic acid to be tested with a Cas protein, a gRNA, and a single-stranded nucleic acid detector; detecting a detectable signal generated by cleavage of the single-stranded nucleic acid detector by the Cas protein, thereby detecting african swine fever virus; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target nucleic acid; compared with the amino acid sequence of the parent Cas protein, the amino acid sequence shown in SEQ ID No.8 is mutated at any one or more of the following amino acid sites, and the 369 th amino acid and the 433 th amino acid are mutated; preferably, amino acid 369 of the Cas protein is mutated to R, preferably, amino acid 433 of the Cas protein is mutated to R.

2. The method of claim 1, wherein the targeting sequence in the gRNA that hybridizes to the target nucleic acid is selected from any one of the group consisting of:

(1) The targeting sequence hybridized with the target nucleic acid contains 20-30 bases and hybridizes with the sequence shown in SEQ ID No.1 or the reverse complement thereof, and the targeting sequence contains any one of the sequences shown in SEQ ID No. 2-6;

(2) The guide sequence hybridized with the target nucleic acid comprises any one of the sequences shown in SEQ ID No.2-6, and further comprises 1-10 bases at the 3' -end of any one of the sequences shown in SEQ ID No.2-6, and hybridizes with the sequence shown in SEQ ID No.1 or the reverse complement thereof;

(3) Compared with any one of the sequences shown in SEQ ID No.2-6, the guide sequence hybridized with the target nucleic acid continuously lacks 1-5 bases at the 3' -end of any one of the sequences shown in SEQ ID No. 2-6;

(4) The targeting sequence hybridized with the target nucleic acid is shown in any one of SEQ ID Nos. 2-6.

3. The method of claim 1, wherein the region of the gRNA that binds to the Cas protein is set forth in SEQ ID No.7 or SEQ ID No. 16.

4. The method of claim 3, further comprising the step of obtaining the test nucleic acid from the test sample.

5. The method of claim 4, wherein the target nucleic acid is an amplification product, the amplification is isothermal amplification, and the isothermal amplification is LAMP amplification; preferably, the LAMP amplification comprises a group of LAMP primer groups, wherein the LAMP primer groups are as follows:

outer forward primer F3: the sequence is shown as SEQ ID No. 10;

the sequence of the outer reverse primer B3 is shown as SEQ ID No. 11;

the sequence of the inner forward primer FIP is shown as SEQ ID No. 12;

inner reverse primer BIP: the sequence is shown as SEQ ID No. 13;

loop primer LF: the sequence is shown as SEQ ID No. 14;

the sequence of the loop primer LB is shown as SEQ ID No. 15.

6. The method of claim 4 or 5, wherein the sample to be tested is derived from porcine serum, saliva, lymph node, spleen or lung.

7. The method of claim 1, wherein the detectable signal is achieved by either: visual-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase change, electrochemical detection, or semiconductor-based detection.

8. A system, composition or kit for detecting or diagnosing african swine fever, characterized in that the system, composition or kit comprises a Cas protein, a gRNA and a single-stranded nucleic acid detector in any one of the methods of claims 1-7.

9. The system, composition or kit of claim 8, further comprising the LAMP primer set of claim 5.

10. Use of the system or composition of claim 8 or 9 in the manufacture of a reagent or kit for diagnosing or detecting african swine fever.